Starting /dee2/code/volunteer_pipeline.sh SRR6958208 current disk space = 1550474895360 free memory = 1377438264 SRR6958208 SRAfilesize 552696ed7ecbba0fa36e04f65cd1ecf6 SRR6958208.sra SRR6958208.sra file validated SRR6958208 is paired end SRR6958208 is conventional basespace SRR6958208 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958208_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.676 33.0 33.0 34.0 32.0 34.0 2 32.67075 33.0 33.0 34.0 31.0 34.0 3 32.0175 33.0 31.0 33.0 31.0 34.0 4 32.451 33.0 33.0 33.0 31.0 34.0 5 32.459 33.0 33.0 33.0 31.0 34.0 6 36.502 38.0 36.0 38.0 34.0 38.0 7 37.2635 38.0 38.0 38.0 36.0 38.0 8 37.37425 38.0 38.0 38.0 36.0 38.0 9 37.5805 38.0 38.0 38.0 37.0 38.0 10-14 37.5916 38.0 38.0 38.0 38.0 38.0 15-19 37.60705 38.0 38.0 38.0 38.0 38.0 20-24 37.6149 38.0 38.0 38.0 38.0 38.0 25-29 37.558350000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.5588 38.0 38.0 38.0 38.0 38.0 35-39 37.5107 38.0 38.0 38.0 38.0 38.0 40-44 37.49305 38.0 38.0 38.0 37.6 38.0 45-49 37.477 38.0 38.0 38.0 37.0 38.0 50-54 37.436 38.0 38.0 38.0 37.0 38.0 55-59 37.4149 38.0 38.0 38.0 37.0 38.0 60-64 36.775 38.0 38.0 38.0 36.4 38.0 65-69 37.1409 38.0 38.0 38.0 36.2 38.0 70-74 37.24655 38.0 38.0 38.0 36.4 38.0 75-79 37.17005 38.0 38.0 38.0 36.0 38.0 80-84 37.18365 38.0 38.0 38.0 36.0 38.0 85-89 37.0815 38.0 38.0 38.0 35.8 38.0 90-94 36.9899 38.0 38.0 38.0 35.2 38.0 95-99 36.937400000000004 38.0 38.0 38.0 35.2 38.0 100-104 36.82625 38.0 38.0 38.0 35.0 38.0 105-109 36.68495 38.0 38.0 38.0 34.8 38.0 110-114 36.5554 38.0 38.0 38.0 34.2 38.0 115-119 36.51055 38.0 38.0 38.0 34.0 38.0 120-124 36.3383 38.0 38.0 38.0 33.8 38.0 125-129 35.99005 38.0 37.6 38.0 32.2 38.0 130-134 35.525099999999995 38.0 36.0 38.0 31.0 38.0 135-139 35.2017 38.0 36.0 38.0 30.4 38.0 140-144 34.73805 38.0 35.8 38.0 28.0 38.0 145-149 34.236000000000004 38.0 35.4 38.0 26.6 38.0 150-151 29.723625 35.5 26.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 4.0 21 1.0 22 6.0 23 10.0 24 7.0 25 7.0 26 9.0 27 16.0 28 21.0 29 21.0 30 30.0 31 48.0 32 68.0 33 79.0 34 140.0 35 250.0 36 645.0 37 2635.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.575 9.75 8.425 34.25 2 25.025 10.75 33.625 30.599999999999998 3 21.925 15.85 25.825 36.4 4 28.325 21.775 22.725 27.175 5 27.975 24.349999999999998 24.525 23.150000000000002 6 25.6 30.3 22.3 21.8 7 20.275000000000002 23.75 36.025 19.950000000000003 8 22.625 22.900000000000002 28.375 26.1 9 21.55 20.200000000000003 32.875 25.374999999999996 10-14 24.34352023208123 24.798679537838243 25.49892462361827 25.358875606462263 15-19 25.085 24.03 24.875 26.009999999999998 20-24 24.43 24.759999999999998 24.990000000000002 25.82 25-29 24.36 23.355 25.275 27.01 30-34 24.45 24.060000000000002 25.069999999999997 26.419999999999998 35-39 24.565 23.849999999999998 25.1 26.484999999999996 40-44 24.255 24.295 24.86 26.590000000000003 45-49 24.44 24.44 24.605 26.515 50-54 24.165 23.494999999999997 25.235000000000003 27.105 55-59 24.44855699494823 24.133446706347222 24.908718051317962 26.509278247386586 60-64 24.616712356584426 24.07351000101533 24.850238602903847 26.459539039496395 65-69 24.373998397435898 23.62780448717949 24.634415064102562 27.363782051282055 70-74 25.009999999999998 23.51 24.825 26.655 75-79 25.009999999999998 23.535 24.91 26.545 80-84 24.685000000000002 24.325 24.495 26.495 85-89 25.03 23.669999999999998 24.195 27.105 90-94 24.895 23.810000000000002 24.3 26.995 95-99 24.595 23.169999999999998 25.155 27.08 100-104 24.87 23.565 24.595 26.97 105-109 25.145 23.445 24.83 26.58 110-114 25.2 23.815 24.765 26.22 115-119 24.834999999999997 23.87 24.87 26.424999999999997 120-124 25.374999999999996 23.645 24.095 26.884999999999998 125-129 25.045 23.905 24.154999999999998 26.895000000000003 130-134 25.174999999999997 23.135 24.94 26.75 135-139 24.645 23.78 24.349999999999998 27.224999999999998 140-144 25.869999999999997 23.47 23.86 26.8 145-149 25.19 24.29 23.79 26.729999999999997 150-151 26.0375 24.3625 23.0375 26.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 0.5 29 2.5 30 4.5 31 6.0 32 7.0 33 7.5 34 13.5 35 23.0 36 33.0 37 42.0 38 60.0 39 77.0 40 101.0 41 134.5 42 158.5 43 154.0 44 161.0 45 189.0 46 198.5 47 190.0 48 172.0 49 174.0 50 162.0 51 127.0 52 111.5 53 119.0 54 133.5 55 118.0 56 98.0 57 94.0 58 93.0 59 100.5 60 108.0 61 90.0 62 74.5 63 72.0 64 57.5 65 60.5 66 68.0 67 69.5 68 58.5 69 46.0 70 44.0 71 38.0 72 36.0 73 36.5 74 26.5 75 17.0 76 12.5 77 7.5 78 3.5 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.034999999999999996 60-64 1.51 65-69 0.16 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1679273827534 98.32499999999999 2 0.8068582955118508 1.6 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.4625000000000004 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.3625 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.800000000000001 0.0 0.0 0.0 0.0 138-139 6.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958208 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958208_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94325 33.0 33.0 34.0 32.0 34.0 2 32.95475 34.0 33.0 34.0 33.0 34.0 3 33.0375 34.0 33.0 34.0 33.0 34.0 4 32.9805 34.0 33.0 34.0 33.0 34.0 5 33.02375 34.0 33.0 34.0 33.0 34.0 6 37.261 38.0 38.0 38.0 37.0 38.0 7 37.239 38.0 38.0 38.0 37.0 38.0 8 37.25075 38.0 38.0 38.0 37.0 38.0 9 37.25 38.0 38.0 38.0 37.0 38.0 10-14 37.206300000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.21855000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.1584 38.0 38.0 38.0 37.0 38.0 25-29 37.1533 38.0 38.0 38.0 37.0 38.0 30-34 37.149300000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.142 38.0 38.0 38.0 37.0 38.0 40-44 37.13575 38.0 38.0 38.0 37.0 38.0 45-49 37.0783 38.0 38.0 38.0 37.0 38.0 50-54 37.01645 38.0 38.0 38.0 36.8 38.0 55-59 36.942899999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.98375 38.0 38.0 38.0 36.0 38.0 65-69 36.89085 38.0 38.0 38.0 35.8 38.0 70-74 36.90095 38.0 38.0 38.0 36.0 38.0 75-79 36.861399999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.79854999999999 38.0 38.0 38.0 35.6 38.0 85-89 36.741699999999994 38.0 38.0 38.0 35.2 38.0 90-94 36.672799999999995 38.0 38.0 38.0 35.0 38.0 95-99 36.45645 38.0 38.0 38.0 34.8 38.0 100-104 36.4898 38.0 38.0 38.0 34.8 38.0 105-109 36.28770000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.110400000000006 38.0 38.0 38.0 33.6 38.0 115-119 35.8635 38.0 38.0 38.0 33.0 38.0 120-124 35.85415 38.0 37.8 38.0 33.0 38.0 125-129 35.814350000000005 38.0 38.0 38.0 32.8 38.0 130-134 35.6342 38.0 36.6 38.0 32.4 38.0 135-139 35.39295 38.0 36.0 38.0 31.4 38.0 140-144 35.165350000000004 38.0 36.0 38.0 31.0 38.0 145-149 34.52995 38.0 35.6 38.0 28.6 38.0 150-151 30.121750000000002 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 5.0 4 2.0 5 2.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 2.0 14 4.0 15 2.0 16 2.0 17 2.0 18 4.0 19 6.0 20 4.0 21 5.0 22 2.0 23 10.0 24 8.0 25 8.0 26 7.0 27 21.0 28 16.0 29 29.0 30 44.0 31 46.0 32 61.0 33 71.0 34 120.0 35 180.0 36 500.0 37 2818.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.52091159529176 17.355371900826448 11.445028800400701 30.678687703481096 2 28.496240601503757 23.43358395989975 24.761904761904763 23.308270676691727 3 24.110275689223055 24.360902255639097 27.343358395989974 24.185463659147867 4 26.835379604109242 30.39338511651215 18.992733650714104 23.778501628664493 5 26.81032322726134 30.74417439238286 18.767226259082936 23.678276121272866 6 23.28664332166083 34.167083541770886 19.034517258629315 23.51175587793897 7 22.7 20.3 32.800000000000004 24.2 8 24.325 22.475 22.125 31.075000000000003 9 24.2 22.725 25.650000000000002 27.425 10-14 26.250250050010003 25.53510702140428 22.404480896179237 25.81016203240648 15-19 26.63731425426527 24.3208085255416 22.994946715364986 26.046930504828136 20-24 26.769015352302844 24.463669550432567 23.103465519827974 25.663849577436615 25-29 26.904797638701282 24.93871629396168 22.482365300915504 25.67412076642153 30-34 27.125 24.84 22.735 25.3 35-39 26.527958387516254 24.547364209262778 23.28698609582875 25.637691307392217 40-44 26.816340817040853 24.286214310715536 23.05615280764038 25.841292064603234 45-49 26.750350070014 24.5999199839968 23.099619923984797 25.550110022004404 50-54 27.094064109616443 24.36365454818223 22.74341151172676 25.79886983047457 55-59 26.830732292917165 24.014605842336934 23.224289715886353 25.930372148859544 60-64 26.42925023758315 24.05341869654379 23.328164857700195 26.18916620817286 65-69 26.611330566528324 24.456222811140556 23.391169558477923 25.54127706385319 70-74 26.997148716922613 24.140863388524835 23.120404181881845 25.741583712670703 75-79 26.8 24.25 23.630000000000003 25.319999999999997 80-84 26.88 24.36 23.419999999999998 25.34 85-89 26.69 24.675 23.064999999999998 25.569999999999997 90-94 27.11 24.7 22.95 25.240000000000002 95-99 26.782051923365515 24.320944424991247 23.16542444099845 25.73157921064479 100-104 26.947126206793058 24.355960182081937 23.295482967335303 25.40143064378971 105-109 26.836101660996597 24.744846908144886 23.37402441464879 25.045027016209726 110-114 26.915186389792346 25.334000500375282 23.042281711283465 24.70853139854891 115-119 27.77527640202111 24.303366851768473 23.28780829456201 24.63354845164841 120-124 27.690768076057044 25.26394796097073 22.55191393545159 24.49337002752064 125-129 27.548264479343803 24.712413724117237 23.31699509852956 24.422326698009403 130-134 27.581895473868467 24.706176544136035 23.210802700675167 24.50112528132033 135-139 28.357835783578356 24.847484748474848 23.382338233823383 23.412341234123414 140-144 27.794169125368807 25.393809071360707 23.133470020503076 23.678551782767414 145-149 27.846961740435113 25.566391597899475 23.10577644411103 23.48087021755439 150-151 27.875 27.0625 22.9875 22.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.0 28 1.5 29 1.5 30 1.0 31 3.0 32 5.5 33 7.5 34 10.0 35 15.5 36 19.5 37 34.5 38 50.5 39 64.5 40 85.0 41 112.0 42 129.5 43 143.0 44 166.0 45 173.0 46 178.5 47 177.0 48 155.5 49 148.5 50 150.5 51 150.0 52 144.0 53 124.0 54 111.5 55 102.0 56 110.0 57 116.5 58 109.0 59 106.0 60 114.0 61 112.5 62 95.5 63 91.5 64 90.0 65 83.5 66 79.5 67 76.5 68 65.5 69 63.5 70 58.5 71 41.0 72 29.5 73 26.5 74 23.0 75 14.5 76 8.5 77 5.5 78 3.5 79 1.0 80 1.0 81 2.5 82 1.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.25 3 0.25 4 0.22499999999999998 5 0.22499999999999998 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.065 20-24 0.015 25-29 0.055 30-34 0.0 35-39 0.03 40-44 0.005 45-49 0.02 50-54 0.015 55-59 0.04 60-64 0.034999999999999996 65-69 0.005 70-74 0.045 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.045 100-104 0.045 105-109 0.06 110-114 0.075 115-119 0.055 120-124 0.075 125-129 0.03 130-134 0.025 135-139 0.01 140-144 0.015 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85815782796244 97.39999999999999 2 0.8627251966505963 1.7000000000000002 3 0.20299416391778738 0.6 4 0.07612281146917026 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.3625 0.0 0.0 0.0 0.0 116-117 1.6375000000000002 0.0 0.0 0.0 0.0 118-119 1.825 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.4124999999999996 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.325 0.0 0.0 0.0 0.0 132-133 4.737500000000001 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.8125 0.0 0.0 0.0 0.0 138-139 6.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGAGA 35 0.0035366106 20.714287 35-39 >>END_MODULE Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462152 spots for SRR6958208.sra Written 1462152 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra Read 1462148 spots for SRR6958208.sra Written 1462148 spots for SRR6958208.sra SRR ids: ['SRR6958208.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9oj_mv9m SRR6958208.sra spots: 29242964 blocks: [[1, 1462148], [1462149, 2924296], [2924297, 4386444], [4386445, 5848592], [5848593, 7310740], [7310741, 8772888], [8772889, 10235036], [10235037, 11697184], [11697185, 13159332], [13159333, 14621480], [14621481, 16083628], [16083629, 17545776], [17545777, 19007924], [19007925, 20470072], [20470073, 21932220], [21932221, 23394368], [23394369, 24856516], [24856517, 26318664], [26318665, 27780812], [27780813, 29242964]] SRR6958208 file size 9887780 SRR6958208 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958208 SRR6958208_1.fastq SRR6958208_2.fastq Input file: SRR6958208_1.fastq Paired file: SRR6958208_2.fastq trimmed: SRR6958208-trimmed-pair1.fastq, SRR6958208-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:11:55 2024 >> started Fri Dec 6 16:12:29 2024 >> done (33.941s) 29242964 read pairs processed; of these: 51014 ( 0.17%) short read pairs filtered out after trimming by size control 62103 ( 0.21%) empty read pairs filtered out after trimming by size control 29129847 (99.61%) read pairs available; of these: 11346002 (38.95%) trimmed read pairs available after processing 17783845 (61.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 7 0.00% 21 8 0.00% 22 10 0.00% 23 7 0.00% 24 10 0.00% 25 8 0.00% 26 13 0.00% 27 9 0.00% 28 13 0.00% 29 7 0.00% 30 8 0.00% 31 10 0.00% 32 8 0.00% 33 11 0.00% 34 12 0.00% 35 11 0.00% 36 15 0.00% 37 20 0.00% 38 14 0.00% 39 16 0.00% 40 25 0.00% 41 18 0.00% 42 25 0.00% 43 20 0.00% 44 22 0.00% 45 28 0.00% 46 42 0.00% 47 39 0.00% 48 42 0.00% 49 48 0.00% 50 43 0.00% 51 54 0.00% 52 56 0.00% 53 63 0.00% 54 72 0.00% 55 58 0.00% 56 93 0.00% 57 91 0.00% 58 107 0.00% 59 129 0.00% 60 140 0.00% 61 163 0.00% 62 175 0.00% 63 193 0.00% 64 217 0.00% 65 235 0.00% 66 264 0.00% 67 333 0.00% 68 376 0.00% 69 407 0.00% 70 439 0.00% 71 524 0.00% 72 594 0.00% 73 746 0.00% 74 859 0.00% 75 948 0.00% 76 1073 0.00% 77 1183 0.00% 78 1386 0.00% 79 1550 0.01% 80 1824 0.01% 81 1989 0.01% 82 2396 0.01% 83 2943 0.01% 84 4919 0.02% 85 6282 0.02% 86 6420 0.02% 87 6834 0.02% 88 7249 0.02% 89 7617 0.03% 90 8005 0.03% 91 8491 0.03% 92 8974 0.03% 93 9888 0.03% 94 10831 0.04% 95 11674 0.04% 96 12084 0.04% 97 13463 0.05% 98 13971 0.05% 99 15229 0.05% 100 16533 0.06% 101 17426 0.06% 102 19120 0.07% 103 20843 0.07% 104 22386 0.08% 105 23390 0.08% 106 25301 0.09% 107 26821 0.09% 108 27876 0.10% 109 29623 0.10% 110 31243 0.11% 111 33184 0.11% 112 35810 0.12% 113 38139 0.13% 114 40548 0.14% 115 43585 0.15% 116 45906 0.16% 117 47572 0.16% 118 49260 0.17% 119 51066 0.18% 120 53372 0.18% 121 55858 0.19% 122 58647 0.20% 123 61477 0.21% 124 65071 0.22% 125 68844 0.24% 126 70737 0.24% 127 73659 0.25% 128 75284 0.26% 129 78360 0.27% 130 80828 0.28% 131 84674 0.29% 132 88262 0.30% 133 92448 0.32% 134 96492 0.33% 135 101563 0.35% 136 105452 0.36% 137 109674 0.38% 138 113651 0.39% 139 120087 0.41% 140 125586 0.43% 141 132659 0.46% 142 143332 0.49% 143 155072 0.53% 144 171106 0.59% 145 197494 0.68% 146 233408 0.80% 147 288932 0.99% 148 413504 1.42% 149 825375 2.83% 150 6185271 21.23% 151 17783845 61.05% 29129847 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=20 prefix-density=0.80 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=32.08 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=16 prefix-density=0.53 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=87.40 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=4.0 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958208 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:13:19 Started mapping on | Dec 06 16:13:19 Finished on | Dec 06 16:15:43 Mapping speed, Million of reads per hour | 728.25 Number of input reads | 29129847 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 27992020 Uniquely mapped reads % | 96.09% Average mapped length | 295.51 Number of splices: Total | 31073028 Number of splices: Annotated (sjdb) | 29168718 Number of splices: GT/AG | 30650783 Number of splices: GC/AG | 367690 Number of splices: AT/AC | 11218 Number of splices: Non-canonical | 43337 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 325633 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 41372 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.76% % of reads unmapped: other | 0.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 840537 840537 840537 N_multimapping 325633 325633 325633 N_noFeature 800908 27233117 998072 N_ambiguous 671726 3430 110975 UnstrandedReadsAssigned:26519386 PositiveStrandReadsAssigned:755473 NegativeStrandReadsAssigned:26882973 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958208 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958208-trimmed-pair1.fastq SRR6958208-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,129,847 reads, 26,909,996 reads pseudoaligned [quant] estimated average fragment length: 238.553 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52973 SRR6958208.ke.tsv 35125 SRR6958208.se.tsv 88098 total ==> SRR6958208.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.813 0 0 PNS24247 1044 806.447 84.7535 5.38146 PNS24249 1928 1690.45 126.982 3.84644 PNS24246 1044 806.447 84.7535 5.38146 PNS24248 1044 806.447 84.7535 5.38146 PNS24244 1471 1233.45 42.7574 1.77504 PNS24243 293 93.4968 0 0 KQK14069 1603 1365.45 16078.5 602.96 KQK14071 474 246.092 291.439 60.6411 ==> SRR6958208.se.tsv <== BRADI_1g14170v3 17292 BRADI_1g53295v3 305 BRADI_1g59795v3 472 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 264 BRADI_1g74790v3 154 BRADI_1g09890v3 0 BRADI_1g77505v3 367 BRADI_1g48960v3 0 SRR6958208 completed mapping pipeline successfully