Starting /dee2/code/volunteer_pipeline.sh SRR6958209 current disk space = 1550474895360 free memory = 1599334700 SRR6958209 SRAfilesize e78f7cd2a67c3b9150e87d5b980fd0fa SRR6958209.sra SRR6958209.sra file validated SRR6958209 is paired end SRR6958209 is conventional basespace SRR6958209 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958209_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.553 31.0 18.0 33.0 18.0 34.0 2 31.8965 33.0 31.0 34.0 29.0 34.0 3 32.8835 33.0 33.0 34.0 31.0 34.0 4 32.69475 33.0 33.0 34.0 31.0 34.0 5 32.5845 33.0 33.0 33.0 32.0 34.0 6 36.40275 38.0 36.0 38.0 34.0 38.0 7 37.27325 38.0 38.0 38.0 36.0 38.0 8 37.35175 38.0 38.0 38.0 36.0 38.0 9 37.49825 38.0 38.0 38.0 37.0 38.0 10-14 37.554050000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.58399999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.551249999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.53585 38.0 38.0 38.0 37.6 38.0 30-34 37.5184 38.0 38.0 38.0 37.4 38.0 35-39 37.490649999999995 38.0 38.0 38.0 37.6 38.0 40-44 37.46785 38.0 38.0 38.0 37.2 38.0 45-49 37.4655 38.0 38.0 38.0 37.0 38.0 50-54 37.44905000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.0603 38.0 38.0 38.0 36.4 38.0 60-64 36.5686 38.0 38.0 38.0 36.0 38.0 65-69 37.2341 38.0 38.0 38.0 36.6 38.0 70-74 37.314 38.0 38.0 38.0 36.6 38.0 75-79 37.2188 38.0 38.0 38.0 36.2 38.0 80-84 37.13215 38.0 38.0 38.0 36.2 38.0 85-89 36.99875 38.0 38.0 38.0 35.4 38.0 90-94 36.9587 38.0 38.0 38.0 35.4 38.0 95-99 36.850449999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.695 38.0 38.0 38.0 34.6 38.0 105-109 36.580799999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.4541 38.0 38.0 38.0 34.0 38.0 115-119 36.304500000000004 38.0 38.0 38.0 34.0 38.0 120-124 35.9847 38.0 37.2 38.0 32.2 38.0 125-129 35.8913 38.0 37.0 38.0 31.8 38.0 130-134 35.689949999999996 38.0 36.4 38.0 31.2 38.0 135-139 35.09065 38.0 36.0 38.0 29.8 38.0 140-144 34.486149999999995 38.0 35.2 38.0 26.6 38.0 145-149 34.25144999999999 38.0 35.0 38.0 27.0 38.0 150-151 29.050874999999998 34.5 18.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 2.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 1.0 18 1.0 19 5.0 20 3.0 21 3.0 22 2.0 23 3.0 24 5.0 25 6.0 26 10.0 27 18.0 28 20.0 29 32.0 30 31.0 31 44.0 32 66.0 33 85.0 34 151.0 35 287.0 36 711.0 37 2510.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.4 10.95 8.95 34.699999999999996 2 22.55 11.875 32.7 32.875 3 21.275 16.45 26.0 36.275 4 26.400000000000002 23.150000000000002 21.375 29.075 5 25.525 27.375 24.15 22.95 6 24.474999999999998 29.425 23.9 22.2 7 18.95 24.65 37.55 18.85 8 22.375 22.1 28.275 27.250000000000004 9 21.175 22.425 31.374999999999996 25.025 10-14 23.443205121792626 25.754013904866703 25.824038413444704 24.978742559895963 15-19 24.03 24.615000000000002 25.44 25.915 20-24 23.415 25.205 25.490000000000002 25.89 25-29 23.200000000000003 24.675 25.650000000000002 26.474999999999998 30-34 24.165 24.279999999999998 25.569999999999997 25.985000000000003 35-39 23.76 25.115 24.935 26.19 40-44 24.015 24.52 25.285000000000004 26.179999999999996 45-49 24.215 24.490000000000002 25.380000000000003 25.915 50-54 23.895 24.57 24.965 26.57 55-59 24.076593600403122 24.797178130511462 25.195263290501384 25.930964978584026 60-64 23.962312197606312 24.23223834988541 25.352686529157115 26.45276292335116 65-69 24.115000000000002 24.235 25.355 26.295 70-74 24.34 24.51 24.89 26.26 75-79 24.46 24.81 24.349999999999998 26.38 80-84 24.325 24.235 24.834999999999997 26.605 85-89 24.0 24.63 24.945 26.424999999999997 90-94 24.625 24.474999999999998 24.55 26.35 95-99 24.15 23.995 25.245 26.61 100-104 24.175 24.79 24.995 26.040000000000003 105-109 24.43 24.08 25.34 26.150000000000002 110-114 24.16 24.535 25.205 26.1 115-119 24.65 24.4 24.759999999999998 26.19 120-124 24.404999999999998 24.315 25.28 26.0 125-129 24.755 23.89 25.11 26.245 130-134 24.6 24.09 24.75 26.56 135-139 24.875 23.82 24.815 26.490000000000002 140-144 24.665 23.95 24.785 26.6 145-149 24.725 24.115000000000002 25.264999999999997 25.895000000000003 150-151 25.8125 24.0125 24.3125 25.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 1.0 30 3.0 31 4.5 32 9.5 33 11.5 34 11.0 35 21.5 36 37.0 37 42.5 38 60.5 39 92.0 40 107.0 41 119.5 42 156.0 43 180.0 44 194.0 45 209.0 46 217.0 47 226.5 48 198.0 49 177.5 50 173.5 51 146.0 52 140.5 53 131.5 54 105.0 55 96.0 56 100.0 57 95.0 58 80.0 59 79.5 60 76.5 61 72.5 62 75.5 63 73.5 64 64.0 65 60.5 66 59.0 67 50.5 68 40.5 69 40.5 70 36.5 71 29.0 72 29.5 73 23.0 74 15.5 75 12.0 76 8.0 77 3.0 78 1.0 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.775 60-64 1.825 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.2000000000000002 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.3875000000000002 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 1.975 0.0 0.0 0.0 0.0 136-137 2.1500000000000004 0.0 0.0 0.0 0.0 138-139 2.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGAAT 10 0.006875036 144.6875 1 >>END_MODULE SRR6958209 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958209_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01375 33.0 33.0 34.0 32.0 34.0 2 33.086 34.0 33.0 34.0 32.0 34.0 3 33.16225 34.0 33.0 34.0 33.0 34.0 4 33.15825 34.0 33.0 34.0 33.0 34.0 5 33.0845 34.0 33.0 34.0 33.0 34.0 6 37.2305 38.0 38.0 38.0 37.0 38.0 7 37.2795 38.0 38.0 38.0 37.0 38.0 8 37.223 38.0 38.0 38.0 37.0 38.0 9 37.29375 38.0 38.0 38.0 37.0 38.0 10-14 37.245000000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.2266 38.0 38.0 38.0 37.0 38.0 20-24 37.23395 38.0 38.0 38.0 37.0 38.0 25-29 37.176050000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.17515 38.0 38.0 38.0 37.0 38.0 35-39 37.14405000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.0949 38.0 38.0 38.0 36.8 38.0 45-49 37.151199999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.07515 38.0 38.0 38.0 36.8 38.0 55-59 37.021550000000005 38.0 38.0 38.0 36.2 38.0 60-64 37.0022 38.0 38.0 38.0 36.2 38.0 65-69 36.945499999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.85960000000001 38.0 38.0 38.0 35.8 38.0 75-79 36.859899999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.8393 38.0 38.0 38.0 36.0 38.0 85-89 36.67685 38.0 38.0 38.0 35.2 38.0 90-94 36.681650000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.54205 38.0 38.0 38.0 34.8 38.0 100-104 36.453649999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.4069 38.0 38.0 38.0 34.2 38.0 110-114 36.1277 38.0 38.0 38.0 33.6 38.0 115-119 35.97 38.0 38.0 38.0 33.2 38.0 120-124 36.06395 38.0 38.0 38.0 33.8 38.0 125-129 35.928599999999996 38.0 38.0 38.0 33.2 38.0 130-134 35.7835 38.0 37.0 38.0 33.0 38.0 135-139 35.51195 38.0 36.0 38.0 31.2 38.0 140-144 35.2644 38.0 36.0 38.0 31.4 38.0 145-149 34.6101 38.0 35.6 38.0 29.0 38.0 150-151 30.694875 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 4.0 5 2.0 6 0.0 7 1.0 8 0.0 9 4.0 10 2.0 11 2.0 12 0.0 13 3.0 14 2.0 15 1.0 16 4.0 17 3.0 18 1.0 19 2.0 20 6.0 21 6.0 22 2.0 23 7.0 24 7.0 25 9.0 26 16.0 27 14.0 28 22.0 29 25.0 30 34.0 31 33.0 32 59.0 33 87.0 34 101.0 35 220.0 36 467.0 37 2843.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.95 18.224999999999998 11.175 30.65 2 28.275 22.875 27.0 21.85 3 23.275000000000002 25.4 27.375 23.95 4 28.275 29.325000000000003 19.15 23.25 5 27.200000000000003 33.225 18.075 21.5 6 24.14914914914915 34.75975975975976 19.96996996996997 21.12112112112112 7 22.872872872872875 19.61961961961962 33.033033033033036 24.474474474474476 8 23.823823823823822 23.673673673673672 23.473473473473476 29.02902902902903 9 25.275275275275277 22.44744744744745 26.3013013013013 25.975975975975974 10-14 26.376376376376378 25.545545545545544 22.4974974974975 25.58058058058058 15-19 25.690690690690694 25.430430430430427 23.693693693693692 25.185185185185183 20-24 25.845845845845844 25.020020020020016 23.563563563563562 25.570570570570574 25-29 26.651651651651655 24.72972972972973 23.43843843843844 25.18018018018018 30-34 25.690690690690694 24.964964964964963 23.97897897897898 25.365365365365367 35-39 25.860860860860864 24.67967967967968 23.71871871871872 25.74074074074074 40-44 26.116116116116117 24.564564564564563 23.58858858858859 25.730730730730734 45-49 26.08108108108108 24.904904904904903 23.57857857857858 25.435435435435434 50-54 27.05205205205205 24.364364364364363 23.73873873873874 24.844844844844847 55-59 26.45145145145145 24.50950950950951 23.83883883883884 25.2002002002002 60-64 26.326326326326328 24.71971971971972 23.72872872872873 25.225225225225223 65-69 25.805805805805804 25.205205205205207 23.943943943943943 25.045045045045043 70-74 27.192192192192195 23.863863863863862 23.5985985985986 25.345345345345343 75-79 27.005655372603975 24.017816926079778 23.822631499924928 25.153896201391323 80-84 26.616616616616618 24.12912912912913 23.91891891891892 25.335335335335333 85-89 26.856856856856858 24.33933933933934 24.064064064064063 24.73973973973974 90-94 26.55155155155155 24.74974974974975 23.48848848848849 25.21021021021021 95-99 26.42142142142142 25.255255255255253 23.363363363363362 24.95995995995996 100-104 26.38138138138138 24.77977977977978 23.973973973973976 24.864864864864867 105-109 26.34134134134134 24.66966966966967 24.05905905905906 24.92992992992993 110-114 26.97197197197197 25.25025025025025 23.52852852852853 24.24924924924925 115-119 26.811811811811815 24.73973973973974 23.963963963963963 24.484484484484483 120-124 26.16116116116116 25.21021021021021 23.93893893893894 24.68968968968969 125-129 26.446446446446448 25.270270270270267 23.223223223223226 25.060060060060056 130-134 27.217217217217215 24.94994994994995 23.04804804804805 24.784784784784787 135-139 26.706706706706708 24.81981981981982 24.114114114114113 24.35935935935936 140-144 26.616616616616618 25.435435435435434 23.998998998999 23.94894894894895 145-149 27.057057057057055 25.25025025025025 23.573573573573572 24.11911911911912 150-151 27.45245245245245 25.212712712712715 23.485985985985984 23.84884884884885 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.5 4 2.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 2.0 29 2.0 30 3.0 31 4.5 32 4.0 33 8.0 34 14.5 35 17.5 36 29.0 37 39.5 38 52.0 39 82.5 40 103.0 41 131.5 42 159.5 43 162.0 44 165.0 45 178.0 46 171.5 47 154.5 48 176.5 49 172.0 50 141.0 51 143.0 52 139.0 53 129.0 54 121.5 55 106.5 56 101.5 57 103.0 58 107.0 59 98.0 60 86.0 61 95.5 62 100.0 63 94.5 64 77.5 65 65.5 66 72.0 67 66.0 68 57.5 69 62.0 70 51.0 71 35.0 72 31.0 73 24.0 74 15.5 75 12.0 76 9.5 77 7.0 78 4.5 79 2.5 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.1 15-19 0.1 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.1 75-79 0.095 80-84 0.1 85-89 0.1 90-94 0.1 95-99 0.1 100-104 0.1 105-109 0.1 110-114 0.1 115-119 0.1 120-124 0.1 125-129 0.1 130-134 0.1 135-139 0.1 140-144 0.1 145-149 0.1 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9091831557585 97.475 2 0.837138508371385 1.6500000000000001 3 0.15220700152207 0.44999999999999996 4 0.076103500761035 0.3 5 0.025367833587011668 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.2000000000000002 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.625 0.0 0.0 0.0 0.0 132-133 1.8375 0.0 0.0 0.0 0.0 134-135 2.025 0.0 0.0 0.0 0.0 136-137 2.2 0.0 0.0 0.0 0.0 138-139 2.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCCAA 10 0.006830828 145.0 8 CCCCCCC 20 0.00593511 29.0 75-79 >>END_MODULE Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra Read 1235696 spots for SRR6958209.sra Written 1235696 spots for SRR6958209.sra SRR ids: ['SRR6958209.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yi9vhqhc SRR6958209.sra spots: 24713920 blocks: [[1, 1235696], [1235697, 2471392], [2471393, 3707088], [3707089, 4942784], [4942785, 6178480], [6178481, 7414176], [7414177, 8649872], [8649873, 9885568], [9885569, 11121264], [11121265, 12356960], [12356961, 13592656], [13592657, 14828352], [14828353, 16064048], [16064049, 17299744], [17299745, 18535440], [18535441, 19771136], [19771137, 21006832], [21006833, 22242528], [22242529, 23478224], [23478225, 24713920]] SRR6958209 file size 8353036 SRR6958209 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958209 SRR6958209_1.fastq SRR6958209_2.fastq Input file: SRR6958209_1.fastq Paired file: SRR6958209_2.fastq trimmed: SRR6958209-trimmed-pair1.fastq, SRR6958209-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:10:34 2024 >> started Fri Dec 6 16:11:00 2024 >> done (26.161s) 24713920 read pairs processed; of these: 38346 ( 0.16%) short read pairs filtered out after trimming by size control 35903 ( 0.15%) empty read pairs filtered out after trimming by size control 24639671 (99.70%) read pairs available; of these: 9110554 (36.98%) trimmed read pairs available after processing 15529117 (63.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 4 0.00% 23 4 0.00% 24 4 0.00% 25 6 0.00% 26 6 0.00% 27 6 0.00% 28 11 0.00% 29 4 0.00% 30 4 0.00% 31 18 0.00% 32 5 0.00% 33 6 0.00% 34 7 0.00% 35 6 0.00% 36 10 0.00% 37 9 0.00% 38 5 0.00% 39 9 0.00% 40 17 0.00% 41 12 0.00% 42 15 0.00% 43 10 0.00% 44 9 0.00% 45 21 0.00% 46 18 0.00% 47 24 0.00% 48 23 0.00% 49 27 0.00% 50 33 0.00% 51 33 0.00% 52 30 0.00% 53 45 0.00% 54 39 0.00% 55 47 0.00% 56 48 0.00% 57 62 0.00% 58 69 0.00% 59 79 0.00% 60 81 0.00% 61 95 0.00% 62 93 0.00% 63 98 0.00% 64 114 0.00% 65 112 0.00% 66 137 0.00% 67 164 0.00% 68 183 0.00% 69 183 0.00% 70 218 0.00% 71 229 0.00% 72 290 0.00% 73 319 0.00% 74 396 0.00% 75 421 0.00% 76 513 0.00% 77 549 0.00% 78 633 0.00% 79 681 0.00% 80 803 0.00% 81 934 0.00% 82 1052 0.00% 83 1222 0.00% 84 2293 0.01% 85 3046 0.01% 86 2966 0.01% 87 3293 0.01% 88 3237 0.01% 89 3439 0.01% 90 3689 0.01% 91 3752 0.02% 92 4074 0.02% 93 4256 0.02% 94 4410 0.02% 95 4878 0.02% 96 5186 0.02% 97 5583 0.02% 98 5821 0.02% 99 6170 0.03% 100 6498 0.03% 101 6922 0.03% 102 7544 0.03% 103 8141 0.03% 104 8610 0.03% 105 9496 0.04% 106 10069 0.04% 107 10622 0.04% 108 10994 0.04% 109 11839 0.05% 110 12729 0.05% 111 13476 0.05% 112 14187 0.06% 113 14948 0.06% 114 16059 0.07% 115 17348 0.07% 116 18591 0.08% 117 19213 0.08% 118 20168 0.08% 119 20982 0.09% 120 22163 0.09% 121 22876 0.09% 122 24467 0.10% 123 25671 0.10% 124 26854 0.11% 125 28344 0.12% 126 29695 0.12% 127 31313 0.13% 128 32312 0.13% 129 34073 0.14% 130 35632 0.14% 131 37878 0.15% 132 40262 0.16% 133 42768 0.17% 134 45017 0.18% 135 48083 0.20% 136 51111 0.21% 137 54075 0.22% 138 57486 0.23% 139 62379 0.25% 140 66901 0.27% 141 73177 0.30% 142 80789 0.33% 143 90669 0.37% 144 105741 0.43% 145 127371 0.52% 146 161990 0.66% 147 241187 0.98% 148 334601 1.36% 149 748725 3.04% 150 5992095 24.32% 151 15529117 63.02% 24639671 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=16 prefix-density=0.81 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=38.00 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=4.20 fanout-score-rank=11 prefix-density=0.57 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=20.85 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=4.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958209 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:11:50 Started mapping on | Dec 06 16:11:50 Finished on | Dec 06 16:14:12 Mapping speed, Million of reads per hour | 624.67 Number of input reads | 24639671 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23880298 Uniquely mapped reads % | 96.92% Average mapped length | 298.01 Number of splices: Total | 27408703 Number of splices: Annotated (sjdb) | 25796133 Number of splices: GT/AG | 27038665 Number of splices: GC/AG | 322268 Number of splices: AT/AC | 10033 Number of splices: Non-canonical | 37737 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.52 Insertion rate per base | 0.01% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 193234 % of reads mapped to multiple loci | 0.78% Number of reads mapped to too many loci | 22296 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.60% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 582462 582462 582462 N_multimapping 193234 193234 193234 N_noFeature 670476 23224512 840060 N_ambiguous 578897 3271 93639 UnstrandedReadsAssigned:22630925 PositiveStrandReadsAssigned:652515 NegativeStrandReadsAssigned:22946599 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958209 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958209-trimmed-pair1.fastq SRR6958209-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,639,671 reads, 22,923,564 reads pseudoaligned [quant] estimated average fragment length: 269.779 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR6958209.ke.tsv 35125 SRR6958209.se.tsv 88098 total ==> SRR6958209.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.663 1.11012e-08 1.0312e-09 PNS24247 1044 775.221 74.0597 5.92497 PNS24249 1928 1659.22 89.9338 3.36162 PNS24246 1044 775.221 74.0597 5.92497 PNS24248 1044 775.221 74.0597 5.92497 PNS24244 1471 1202.22 33.8871 1.74816 PNS24243 293 78.7675 0 0 KQK14069 1603 1334.22 6016.96 279.692 KQK14071 474 219.518 91.2636 25.7844 ==> SRR6958209.se.tsv <== BRADI_1g14170v3 6701 BRADI_1g53295v3 412 BRADI_1g59795v3 324 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 404 BRADI_1g74790v3 208 BRADI_1g09890v3 0 BRADI_1g77505v3 276 BRADI_1g48960v3 0 SRR6958209 completed mapping pipeline successfully