Starting /dee2/code/volunteer_pipeline.sh SRR6958210 current disk space = 1550480023552 free memory = 1600559488 SRR6958210 SRAfilesize 176b5705c56fa05583aad9634e854f70 SRR6958210.sra SRR6958210.sra file validated SRR6958210 is paired end SRR6958210 is conventional basespace SRR6958210 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958210_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.248 18.0 18.0 25.0 18.0 32.0 2 21.6075 18.0 18.0 25.0 18.0 30.0 3 25.8375 27.0 25.0 29.0 18.0 31.0 4 27.1375 30.0 25.0 32.0 15.0 33.0 5 30.3535 32.0 30.0 33.0 25.0 33.0 6 35.168 37.0 35.0 38.0 30.0 38.0 7 36.33975 38.0 37.0 38.0 34.0 38.0 8 36.63225 38.0 37.0 38.0 34.0 38.0 9 36.93075 38.0 38.0 38.0 35.0 38.0 10-14 37.18895 38.0 38.0 38.0 36.0 38.0 15-19 37.23355 38.0 38.0 38.0 36.4 38.0 20-24 37.161950000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.96705 38.0 38.0 38.0 35.6 38.0 30-34 36.950599999999994 38.0 38.0 38.0 35.6 38.0 35-39 36.75575 38.0 38.0 38.0 34.4 38.0 40-44 36.76925 38.0 38.0 38.0 34.6 38.0 45-49 36.77365 38.0 38.0 38.0 34.4 38.0 50-54 36.307100000000005 38.0 37.4 38.0 33.2 38.0 55-59 36.21205 38.0 37.0 38.0 33.0 38.0 60-64 36.552800000000005 38.0 37.8 38.0 33.8 38.0 65-69 36.5509 38.0 38.0 38.0 34.0 38.0 70-74 36.433499999999995 38.0 37.8 38.0 33.6 38.0 75-79 35.8679 38.0 36.8 38.0 31.2 38.0 80-84 35.5169 38.0 36.0 38.0 30.0 38.0 85-89 35.92215 38.0 36.8 38.0 31.8 38.0 90-94 35.8697 38.0 36.6 38.0 31.8 38.0 95-99 35.2678 38.0 35.6 38.0 28.8 38.0 100-104 34.74515 38.0 35.0 38.0 26.6 38.0 105-109 34.374399999999994 38.0 34.2 38.0 24.2 38.0 110-114 34.19680000000001 38.0 34.0 38.0 23.4 38.0 115-119 34.005 38.0 34.0 38.0 23.6 38.0 120-124 33.4519 37.8 32.8 38.0 20.8 38.0 125-129 32.814750000000004 37.2 31.2 38.0 17.4 38.0 130-134 31.812900000000003 36.0 30.4 38.0 14.2 38.0 135-139 30.90345 36.0 28.0 38.0 13.0 38.0 140-144 29.5678 34.6 26.0 38.0 9.8 38.0 145-149 27.06875 33.2 16.0 38.0 2.0 38.0 150-151 20.296374999999998 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 3.0 17 2.0 18 7.0 19 4.0 20 6.0 21 11.0 22 9.0 23 19.0 24 22.0 25 27.0 26 46.0 27 52.0 28 67.0 29 107.0 30 113.0 31 150.0 32 214.0 33 302.0 34 450.0 35 699.0 36 1143.0 37 544.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.523908523908524 14.579002079002079 5.327442827442828 46.56964656964657 2 18.275 17.25 29.975 34.5 3 23.549999999999997 16.35 25.724999999999998 34.375 4 29.25 21.125 21.525 28.1 5 26.35 26.700000000000003 22.475 24.474999999999998 6 22.775000000000002 33.074999999999996 22.925 21.224999999999998 7 19.125 24.474999999999998 37.675 18.725 8 21.825 23.674999999999997 27.825 26.674999999999997 9 20.75 21.825 32.550000000000004 24.875 10-14 23.07 25.635 25.415 25.88 15-19 23.535 24.94 25.985000000000003 25.540000000000003 20-24 23.61 25.155 25.165 26.07 25-29 22.905 25.56 25.405 26.13 30-34 23.305 24.94 25.64 26.115 35-39 23.365 24.46 26.1 26.075 40-44 23.805 24.54 25.615 26.040000000000003 45-49 23.31 24.22 26.369999999999997 26.1 50-54 23.32 24.725 25.41 26.545 55-59 23.275000000000002 24.875 25.96 25.89 60-64 23.419999999999998 24.915000000000003 26.115 25.55 65-69 23.195 24.92 25.650000000000002 26.235000000000003 70-74 23.635 24.915000000000003 25.569999999999997 25.88 75-79 23.185 24.959999999999997 25.990000000000002 25.865 80-84 23.45 25.275 25.46 25.814999999999998 85-89 23.705000000000002 25.575 24.79 25.929999999999996 90-94 23.035 25.174999999999997 25.900000000000002 25.89 95-99 24.13 24.84 24.955 26.075 100-104 24.48 24.535 25.535000000000004 25.45 105-109 24.55 24.685000000000002 25.174999999999997 25.590000000000003 110-114 23.95 24.075 25.624999999999996 26.35 115-119 24.72 24.785 24.505 25.990000000000002 120-124 24.36 25.385 25.040000000000003 25.215 125-129 24.044999999999998 24.77 25.624999999999996 25.56 130-134 23.9 25.545 24.525 26.029999999999998 135-139 24.2 24.959999999999997 25.074999999999996 25.765 140-144 24.5 24.834999999999997 24.63 26.035000000000004 145-149 24.375 25.19 24.645 25.790000000000003 150-151 24.3625 24.712500000000002 25.2625 25.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 1.5 27 1.0 28 1.5 29 3.5 30 4.0 31 7.0 32 12.5 33 15.0 34 21.0 35 34.0 36 52.0 37 62.5 38 68.0 39 91.0 40 120.5 41 149.0 42 172.0 43 171.5 44 209.5 45 232.5 46 208.0 47 199.0 48 182.0 49 180.5 50 171.0 51 141.0 52 124.0 53 117.5 54 110.0 55 92.0 56 88.5 57 91.5 58 78.5 59 68.0 60 65.0 61 67.5 62 70.5 63 67.0 64 62.0 65 60.0 66 52.0 67 43.0 68 41.0 69 40.0 70 36.0 71 31.0 72 23.0 73 18.0 74 16.0 75 11.0 76 6.5 77 3.5 78 2.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.8 0.0 0.0 0.0 0.0 124-125 5.387499999999999 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.5 0.0 0.0 0.0 0.0 130-131 6.975 0.0 0.0 0.0 0.0 132-133 7.550000000000001 0.0 0.0 0.0 0.0 134-135 8.2 0.0 0.0 0.0 0.0 136-137 8.925 0.0 0.0 0.0 0.0 138-139 9.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958210 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958210_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.508 33.0 33.0 34.0 32.0 34.0 2 32.4035 33.0 33.0 34.0 31.0 34.0 3 32.47 33.0 33.0 34.0 31.0 34.0 4 32.388 33.0 33.0 34.0 32.0 34.0 5 32.4175 33.0 33.0 34.0 31.0 34.0 6 36.43575 38.0 38.0 38.0 34.0 38.0 7 36.331 38.0 38.0 38.0 34.0 38.0 8 36.20575 38.0 38.0 38.0 33.0 38.0 9 36.22275 38.0 38.0 38.0 33.0 38.0 10-14 36.15265 38.0 38.0 38.0 33.0 38.0 15-19 36.31750000000001 38.0 38.0 38.0 33.8 38.0 20-24 36.613600000000005 38.0 38.0 38.0 34.8 38.0 25-29 36.564800000000005 38.0 38.0 38.0 34.8 38.0 30-34 36.5808 38.0 38.0 38.0 34.8 38.0 35-39 36.44595 38.0 38.0 38.0 34.2 38.0 40-44 36.2185 38.0 38.0 38.0 33.8 38.0 45-49 36.23425 38.0 38.0 38.0 33.4 38.0 50-54 36.187200000000004 38.0 38.0 38.0 33.4 38.0 55-59 36.12805 38.0 38.0 38.0 33.2 38.0 60-64 35.990750000000006 38.0 37.6 38.0 32.6 38.0 65-69 35.63555 38.0 37.0 38.0 30.4 38.0 70-74 35.3507 38.0 36.6 38.0 29.4 38.0 75-79 35.593199999999996 38.0 37.0 38.0 30.8 38.0 80-84 35.39175 38.0 36.4 38.0 29.4 38.0 85-89 35.24680000000001 38.0 36.0 38.0 28.8 38.0 90-94 34.843849999999996 38.0 35.6 38.0 27.4 38.0 95-99 34.3472 38.0 34.8 38.0 23.2 38.0 100-104 33.6419 38.0 33.8 38.0 18.2 38.0 105-109 33.362700000000004 38.0 33.0 38.0 18.6 38.0 110-114 32.9251 38.0 32.2 38.0 15.0 38.0 115-119 32.4453 37.8 31.2 38.0 14.6 38.0 120-124 31.53185 37.0 29.0 38.0 13.0 38.0 125-129 30.8116 36.4 27.8 38.0 12.6 38.0 130-134 29.527800000000003 35.0 25.0 38.0 11.4 38.0 135-139 28.919050000000006 34.2 23.8 38.0 5.6 38.0 140-144 28.0163 33.2 21.0 38.0 2.0 38.0 145-149 25.50305 33.0 8.6 38.0 2.0 38.0 150-151 18.401375 17.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 4.0 4 2.0 5 2.0 6 3.0 7 0.0 8 1.0 9 6.0 10 5.0 11 1.0 12 4.0 13 0.0 14 5.0 15 9.0 16 9.0 17 10.0 18 11.0 19 19.0 20 16.0 21 21.0 22 22.0 23 28.0 24 35.0 25 55.0 26 44.0 27 73.0 28 86.0 29 67.0 30 113.0 31 147.0 32 195.0 33 272.0 34 380.0 35 593.0 36 939.0 37 805.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.224999999999994 18.45 11.924999999999999 31.4 2 28.975 23.25 26.400000000000002 21.375 3 22.05 24.3 28.4 25.25 4 24.9 32.0 20.775 22.325 5 29.15 31.324999999999996 18.425 21.099999999999998 6 23.3 35.099999999999994 20.225 21.375 7 21.45 20.25 35.775 22.525000000000002 8 23.45 23.25 24.15 29.15 9 23.825 22.975 26.400000000000002 26.8 10-14 25.525 25.945 23.41 25.119999999999997 15-19 25.405 25.155 24.545 24.895 20-24 25.674999999999997 24.59 24.36 25.374999999999996 25-29 24.995 25.430000000000003 24.779999999999998 24.795 30-34 25.835 25.624999999999996 24.165 24.375 35-39 25.915 25.445 24.044999999999998 24.595 40-44 25.64 26.05 23.655 24.654999999999998 45-49 25.540000000000003 25.6 24.415 24.445 50-54 25.674999999999997 25.905 24.205 24.215 55-59 26.179999999999996 25.474999999999998 23.695 24.65 60-64 25.52 25.395 24.64 24.445 65-69 25.97 25.72 24.26 24.05 70-74 26.355 24.69 24.735 24.22 75-79 25.779999999999998 24.945 24.895 24.38 80-84 26.02 25.28 24.335 24.365000000000002 85-89 26.69 25.41 24.3 23.599999999999998 90-94 26.619999999999997 25.285000000000004 24.145 23.95 95-99 26.32 25.085 24.44 24.154999999999998 100-104 26.265 25.06 24.385 24.29 105-109 26.075 25.695 24.435000000000002 23.794999999999998 110-114 26.009999999999998 25.380000000000003 24.205 24.404999999999998 115-119 27.150000000000002 25.974999999999998 23.375 23.5 120-124 27.405 25.319999999999997 23.885 23.39 125-129 27.52 25.840000000000003 23.595 23.044999999999998 130-134 27.47 25.445 24.315 22.770000000000003 135-139 27.115000000000002 25.71 24.12 23.055 140-144 27.85 25.75 24.12 22.28 145-149 28.375 25.36 23.565 22.7 150-151 29.5375 25.637500000000003 22.8625 21.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 1.5 26 1.5 27 0.0 28 2.5 29 4.5 30 4.0 31 6.0 32 10.0 33 11.5 34 13.5 35 17.0 36 29.0 37 51.0 38 73.5 39 98.0 40 119.0 41 131.0 42 162.0 43 181.5 44 169.5 45 192.0 46 203.5 47 201.0 48 199.5 49 189.5 50 173.5 51 148.5 52 130.0 53 115.0 54 109.5 55 103.0 56 94.5 57 87.0 58 87.0 59 86.0 60 83.5 61 79.0 62 76.5 63 71.5 64 65.5 65 58.5 66 54.0 67 55.5 68 51.0 69 43.0 70 30.5 71 27.5 72 27.5 73 19.0 74 15.0 75 12.5 76 6.5 77 3.0 78 3.5 79 3.5 80 2.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09044972208186 98.05 2 0.7579585649317837 1.5 3 0.15159171298635674 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 4.1125 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 5.1875 0.0 0.0 0.0 0.0 126-127 5.75 0.0 0.0 0.0 0.0 128-129 6.2125 0.0 0.0 0.0 0.0 130-131 6.6125 0.0 0.0 0.0 0.0 132-133 7.1375 0.0 0.0 0.0 0.0 134-135 7.637499999999999 0.0 0.0 0.0 0.0 136-137 8.325 0.0 0.0 0.0 0.0 138-139 9.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776955 spots for SRR6958210.sra Written 776955 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra Read 776943 spots for SRR6958210.sra Written 776943 spots for SRR6958210.sra SRR ids: ['SRR6958210.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vengyd0o SRR6958210.sra spots: 15538872 blocks: [[1, 776943], [776944, 1553886], [1553887, 2330829], [2330830, 3107772], [3107773, 3884715], [3884716, 4661658], [4661659, 5438601], [5438602, 6215544], [6215545, 6992487], [6992488, 7769430], [7769431, 8546373], [8546374, 9323316], [9323317, 10100259], [10100260, 10877202], [10877203, 11654145], [11654146, 12431088], [12431089, 13208031], [13208032, 13984974], [13984975, 14761917], [14761918, 15538872]] SRR6958210 file size 5243913 SRR6958210 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958210 SRR6958210_1.fastq SRR6958210_2.fastq Input file: SRR6958210_1.fastq Paired file: SRR6958210_2.fastq trimmed: SRR6958210-trimmed-pair1.fastq, SRR6958210-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:10:44 2024 >> started Fri Dec 6 16:11:01 2024 >> done (17.323s) 15538872 read pairs processed; of these: 23811 ( 0.15%) short read pairs filtered out after trimming by size control 19876 ( 0.13%) empty read pairs filtered out after trimming by size control 15495185 (99.72%) read pairs available; of these: 8924402 (57.59%) trimmed read pairs available after processing 6570783 (42.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 2 0.00% 25 5 0.00% 26 5 0.00% 27 4 0.00% 28 5 0.00% 29 9 0.00% 30 6 0.00% 31 7 0.00% 32 11 0.00% 33 6 0.00% 34 7 0.00% 35 9 0.00% 36 13 0.00% 37 10 0.00% 38 10 0.00% 39 17 0.00% 40 11 0.00% 41 17 0.00% 42 16 0.00% 43 22 0.00% 44 28 0.00% 45 31 0.00% 46 40 0.00% 47 37 0.00% 48 36 0.00% 49 37 0.00% 50 56 0.00% 51 45 0.00% 52 64 0.00% 53 69 0.00% 54 99 0.00% 55 92 0.00% 56 109 0.00% 57 125 0.00% 58 138 0.00% 59 181 0.00% 60 162 0.00% 61 208 0.00% 62 181 0.00% 63 258 0.00% 64 276 0.00% 65 366 0.00% 66 361 0.00% 67 407 0.00% 68 455 0.00% 69 514 0.00% 70 623 0.00% 71 706 0.00% 72 861 0.01% 73 973 0.01% 74 1110 0.01% 75 1251 0.01% 76 1334 0.01% 77 1639 0.01% 78 1787 0.01% 79 2029 0.01% 80 2355 0.02% 81 2797 0.02% 82 3281 0.02% 83 3674 0.02% 84 4978 0.03% 85 5627 0.04% 86 6062 0.04% 87 6324 0.04% 88 6901 0.04% 89 7373 0.05% 90 7879 0.05% 91 8748 0.06% 92 9508 0.06% 93 10417 0.07% 94 11563 0.07% 95 12605 0.08% 96 13265 0.09% 97 14299 0.09% 98 15021 0.10% 99 16148 0.10% 100 17633 0.11% 101 18653 0.12% 102 20370 0.13% 103 21651 0.14% 104 23436 0.15% 105 24585 0.16% 106 26283 0.17% 107 27099 0.17% 108 28531 0.18% 109 30102 0.19% 110 31349 0.20% 111 32785 0.21% 112 34966 0.23% 113 36814 0.24% 114 38628 0.25% 115 40755 0.26% 116 42919 0.28% 117 44060 0.28% 118 45874 0.30% 119 46661 0.30% 120 48221 0.31% 121 50058 0.32% 122 52582 0.34% 123 54741 0.35% 124 57716 0.37% 125 60113 0.39% 126 62116 0.40% 127 64748 0.42% 128 66345 0.43% 129 68879 0.44% 130 71226 0.46% 131 73967 0.48% 132 77692 0.50% 133 81614 0.53% 134 84443 0.54% 135 89799 0.58% 136 94156 0.61% 137 98452 0.64% 138 102194 0.66% 139 109317 0.71% 140 116179 0.75% 141 123960 0.80% 142 136826 0.88% 143 151817 0.98% 144 172001 1.11% 145 202265 1.31% 146 245733 1.59% 147 323313 2.09% 148 484627 3.13% 149 945073 6.10% 150 3735361 24.11% 151 6570783 42.41% 15495185 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=16 prefix-density=0.70 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=165.22 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.8 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=16 prefix-density=0.42 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=60.19 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=4.5 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958210 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:11:48 Started mapping on | Dec 06 16:11:48 Finished on | Dec 06 16:13:31 Mapping speed, Million of reads per hour | 541.58 Number of input reads | 15495185 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14933511 Uniquely mapped reads % | 96.38% Average mapped length | 290.63 Number of splices: Total | 16552300 Number of splices: Annotated (sjdb) | 15538429 Number of splices: GT/AG | 16321405 Number of splices: GC/AG | 191912 Number of splices: AT/AC | 5922 Number of splices: Non-canonical | 33061 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 163818 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 10479 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411078 411078 411078 N_multimapping 163818 163818 163818 N_noFeature 482699 14496890 593857 N_ambiguous 379106 1873 54166 UnstrandedReadsAssigned:14071706 PositiveStrandReadsAssigned:434748 NegativeStrandReadsAssigned:14285488 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR6958210 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958210-trimmed-pair1.fastq SRR6958210-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,495,185 reads, 14,289,715 reads pseudoaligned [quant] estimated average fragment length: 230.781 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR6958210.ke.tsv 35125 SRR6958210.se.tsv 88098 total ==> SRR6958210.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 706.661 0 0 PNS24247 1044 814.219 39.9511 5.14952 PNS24249 1928 1698.22 43.8973 2.71283 PNS24246 1044 814.219 39.9511 5.14952 PNS24248 1044 814.219 39.9511 5.14952 PNS24244 1471 1241.22 31.2494 2.64225 PNS24243 293 102.396 0 0 KQK14069 1603 1373.22 2639.94 201.759 KQK14071 474 253.293 47.0912 19.5118 ==> SRR6958210.se.tsv <== BRADI_1g14170v3 2986 BRADI_1g53295v3 1042 BRADI_1g59795v3 89 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 276 BRADI_1g74790v3 79 BRADI_1g09890v3 0 BRADI_1g77505v3 213 BRADI_1g48960v3 0 SRR6958210 completed mapping pipeline successfully