Starting /dee2/code/volunteer_pipeline.sh SRR6958211 current disk space = 1550448672768 free memory = 1596737768 SRR6958211 SRAfilesize f1e118bd6bc47145e7d77229eaf9e0a6 SRR6958211.sra SRR6958211.sra file validated SRR6958211 is paired end SRR6958211 is conventional basespace SRR6958211 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958211_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5215 33.0 33.0 34.0 32.0 34.0 2 32.581 33.0 33.0 34.0 31.0 34.0 3 31.64725 33.0 31.0 33.0 29.0 34.0 4 32.04025 33.0 31.0 33.0 31.0 34.0 5 32.8505 33.0 33.0 34.0 32.0 34.0 6 36.72675 38.0 37.0 38.0 34.0 38.0 7 37.122 38.0 38.0 38.0 36.0 38.0 8 37.36675 38.0 38.0 38.0 37.0 38.0 9 37.5075 38.0 38.0 38.0 37.0 38.0 10-14 37.575399999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.625949999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.607 38.0 38.0 38.0 38.0 38.0 25-29 37.549 38.0 38.0 38.0 38.0 38.0 30-34 37.5537 38.0 38.0 38.0 38.0 38.0 35-39 37.502449999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.48245 38.0 38.0 38.0 37.4 38.0 45-49 37.49355 38.0 38.0 38.0 37.4 38.0 50-54 37.44855 38.0 38.0 38.0 37.0 38.0 55-59 37.37859999999999 38.0 38.0 38.0 37.0 38.0 60-64 36.899350000000005 38.0 38.0 38.0 36.4 38.0 65-69 37.2043 38.0 38.0 38.0 36.4 38.0 70-74 37.2961 38.0 38.0 38.0 36.8 38.0 75-79 37.2419 38.0 38.0 38.0 36.4 38.0 80-84 37.1662 38.0 38.0 38.0 36.0 38.0 85-89 37.1315 38.0 38.0 38.0 36.0 38.0 90-94 37.019549999999995 38.0 38.0 38.0 35.4 38.0 95-99 36.931650000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.88375 38.0 38.0 38.0 35.0 38.0 105-109 36.7472 38.0 38.0 38.0 34.8 38.0 110-114 36.5778 38.0 38.0 38.0 34.2 38.0 115-119 36.5347 38.0 38.0 38.0 34.0 38.0 120-124 36.3329 38.0 38.0 38.0 33.6 38.0 125-129 35.9649 38.0 37.6 38.0 32.2 38.0 130-134 35.3823 38.0 36.0 38.0 31.0 38.0 135-139 35.12895 38.0 36.0 38.0 30.0 38.0 140-144 34.65245 38.0 35.6 38.0 27.4 38.0 145-149 34.155699999999996 38.0 35.2 38.0 26.2 38.0 150-151 29.398500000000002 35.5 26.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 1.0 22 7.0 23 7.0 24 7.0 25 10.0 26 9.0 27 13.0 28 19.0 29 23.0 30 42.0 31 48.0 32 45.0 33 80.0 34 134.0 35 231.0 36 725.0 37 2592.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.824999999999996 9.975000000000001 8.525 35.675000000000004 2 24.575 11.325000000000001 33.45 30.65 3 22.1 15.2 25.55 37.15 4 25.25 21.825 22.075 30.85 5 27.275 26.724999999999998 23.674999999999997 22.325 6 25.7 29.975 22.275 22.05 7 18.275 22.975 39.025 19.725 8 22.375 22.325 28.975 26.325 9 21.075 20.8 32.375 25.75 10-14 24.173626043906584 24.823723558533782 25.6888533279992 25.313797069560433 15-19 24.07 23.665 26.46 25.805 20-24 23.985 24.3 25.965 25.75 25-29 23.86 24.415 25.235000000000003 26.490000000000002 30-34 23.645 24.19 25.605 26.56 35-39 24.175 24.175 25.855 25.795 40-44 24.33 23.945 25.480000000000004 26.245 45-49 23.865 24.455 25.105 26.575 50-54 24.47 24.245 25.264999999999997 26.02 55-59 24.312431243124312 24.842484248424842 24.98249824982498 25.862586258625864 60-64 23.88180530257033 24.058894960534303 26.04735883424408 26.011940902651286 65-69 23.96255694048155 24.393052009811285 25.409220603694248 26.23517044601292 70-74 24.22 24.41 24.884999999999998 26.484999999999996 75-79 24.33 24.205 25.155 26.31 80-84 24.3 24.34 25.185000000000002 26.174999999999997 85-89 24.224999999999998 23.345 25.685000000000002 26.745 90-94 24.79 23.544999999999998 25.729999999999997 25.935000000000002 95-99 24.265 24.135 25.040000000000003 26.56 100-104 23.674999999999997 24.625 25.615 26.085 105-109 24.86 23.89 24.935 26.314999999999998 110-114 24.2 24.84 24.93 26.029999999999998 115-119 24.154999999999998 24.29 24.740000000000002 26.815 120-124 24.915000000000003 24.175 25.305 25.605 125-129 24.315 23.355 25.615 26.715 130-134 24.735 24.29 24.725 26.25 135-139 24.51 24.785 24.765 25.94 140-144 24.779999999999998 24.18 24.68 26.36 145-149 24.68 24.995 24.104999999999997 26.22 150-151 24.9375 24.587500000000002 24.2875 26.187500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 1.5 28 3.0 29 2.5 30 3.5 31 5.0 32 7.5 33 17.0 34 19.0 35 20.5 36 33.0 37 49.0 38 68.0 39 87.5 40 101.0 41 126.5 42 152.0 43 164.5 44 184.5 45 203.0 46 210.5 47 198.0 48 185.5 49 175.0 50 157.5 51 139.0 52 126.5 53 128.0 54 121.5 55 112.5 56 107.5 57 98.0 58 80.5 59 83.5 60 91.0 61 81.5 62 79.5 63 82.0 64 79.0 65 68.5 66 59.0 67 45.0 68 43.0 69 46.0 70 37.5 71 28.0 72 22.0 73 20.5 74 15.0 75 10.5 76 8.0 77 4.0 78 2.0 79 0.5 80 0.0 81 1.0 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 1.18 65-69 0.11499999999999999 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.6 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138-139 7.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958211 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958211_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8815 33.0 33.0 34.0 32.0 34.0 2 33.00075 34.0 33.0 34.0 32.0 34.0 3 32.986 34.0 33.0 34.0 32.0 34.0 4 32.99575 34.0 33.0 34.0 32.0 34.0 5 33.074 34.0 33.0 34.0 33.0 34.0 6 37.29425 38.0 38.0 38.0 37.0 38.0 7 37.32525 38.0 38.0 38.0 37.0 38.0 8 37.32325 38.0 38.0 38.0 37.0 38.0 9 37.33675 38.0 38.0 38.0 37.0 38.0 10-14 37.269099999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.2952 38.0 38.0 38.0 37.0 38.0 20-24 37.30695 38.0 38.0 38.0 37.0 38.0 25-29 37.2473 38.0 38.0 38.0 37.0 38.0 30-34 37.26375 38.0 38.0 38.0 37.0 38.0 35-39 37.25045 38.0 38.0 38.0 37.0 38.0 40-44 37.25555 38.0 38.0 38.0 37.0 38.0 45-49 37.215050000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.1225 38.0 38.0 38.0 36.8 38.0 55-59 37.083000000000006 38.0 38.0 38.0 36.2 38.0 60-64 37.0788 38.0 38.0 38.0 36.2 38.0 65-69 36.987700000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.9779 38.0 38.0 38.0 36.0 38.0 75-79 36.99175 38.0 38.0 38.0 36.0 38.0 80-84 36.917399999999994 38.0 38.0 38.0 35.6 38.0 85-89 36.8296 38.0 38.0 38.0 35.2 38.0 90-94 36.78455 38.0 38.0 38.0 35.0 38.0 95-99 36.64005 38.0 38.0 38.0 34.8 38.0 100-104 36.560500000000005 38.0 38.0 38.0 34.6 38.0 105-109 36.340199999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.15605 38.0 38.0 38.0 34.0 38.0 115-119 36.004 38.0 38.0 38.0 33.0 38.0 120-124 36.01295 38.0 38.0 38.0 33.2 38.0 125-129 35.949949999999994 38.0 38.0 38.0 33.2 38.0 130-134 35.682900000000004 38.0 36.4 38.0 32.4 38.0 135-139 35.359950000000005 38.0 36.0 38.0 31.0 38.0 140-144 35.12915 38.0 36.0 38.0 30.6 38.0 145-149 34.46655 38.0 35.4 38.0 28.0 38.0 150-151 30.10025 35.5 28.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 3.0 12 3.0 13 4.0 14 1.0 15 0.0 16 2.0 17 4.0 18 1.0 19 2.0 20 3.0 21 2.0 22 9.0 23 3.0 24 11.0 25 13.0 26 18.0 27 22.0 28 26.0 29 21.0 30 34.0 31 40.0 32 71.0 33 83.0 34 112.0 35 188.0 36 503.0 37 2810.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.041572752316554 17.781116954670672 12.572001001753069 31.605309291259704 2 29.87957852483693 21.851480180632212 26.467636728549927 21.801304565980935 3 24.47955856533735 25.859041886129923 25.658389766741912 24.003009781790823 4 26.529588766298893 30.992978936810434 19.78435305917753 22.69307923771314 5 28.517682468021064 31.42713819914723 19.362929520943066 20.692249811888637 6 25.2 33.900000000000006 19.45 21.45 7 23.425 19.8 33.75 23.025000000000002 8 22.925 23.325000000000003 24.05 29.7 9 24.65 22.05 25.974999999999998 27.325 10-14 26.246312315615782 26.00630031501575 22.091104555227762 25.656282814140706 15-19 25.916662498124154 24.501025461457658 23.93076884598069 25.651543194437497 20-24 26.305 25.259999999999998 23.29 25.145 25-29 26.333950092513874 25.15877381607241 23.3485022753413 25.15877381607241 30-34 25.869999999999997 24.86 24.45 24.82 35-39 26.532653265326534 25.38253825382538 23.17731773177318 24.907490749074906 40-44 25.979999999999997 25.22 23.580000000000002 25.22 45-49 26.591329566478322 25.316265813290666 23.42117105855293 24.671233561678083 50-54 26.568985347802172 25.06375956393459 23.63854578186728 24.72870930639596 55-59 26.511325566278316 24.8062403120156 23.61618080904045 25.06625331266563 60-64 26.21131056552828 24.486224311215558 24.381219060953047 24.921246062303116 65-69 26.405 25.025 23.53 25.040000000000003 70-74 26.597979393818143 24.652395718715614 23.592077623286986 25.157547264179254 75-79 26.279999999999998 24.165 24.415 25.14 80-84 26.015 25.645 23.395 24.945 85-89 26.21 25.169999999999998 24.09 24.529999999999998 90-94 26.284999999999997 25.224999999999998 23.82 24.67 95-99 26.393959093864076 25.15877381607241 24.00860129019353 24.43866579986998 100-104 26.34263426342634 25.12251225122512 23.547354735473547 24.987498749874987 105-109 26.368955343301497 25.028754313146973 23.983597539630942 24.618692803920588 110-114 26.134146951433003 25.568949132196266 23.808332916520783 24.488570999849948 115-119 27.336834208552137 24.841210302575647 24.111027756939237 23.710927731932983 120-124 27.065413082616523 25.20504100820164 23.654730946189236 24.0748149629926 125-129 26.398959843976595 25.288793318997847 23.883582537380608 24.428664299644947 130-134 27.69276927692769 25.217521752175216 23.237323732373238 23.85238523852385 135-139 27.57 25.259999999999998 23.615 23.555 140-144 27.587758775877585 25.74757475747575 23.54235423542354 23.122312231223123 145-149 27.589999999999996 25.595000000000002 23.555 23.26 150-151 27.35 26.2625 22.5875 23.799999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 4.0 29 5.5 30 4.5 31 5.0 32 7.5 33 10.5 34 13.0 35 22.0 36 31.5 37 44.0 38 56.0 39 70.0 40 99.0 41 136.0 42 153.5 43 156.0 44 168.5 45 180.0 46 182.5 47 169.5 48 156.5 49 166.0 50 170.5 51 169.5 52 150.5 53 127.5 54 112.0 55 107.0 56 109.0 57 93.0 58 92.5 59 94.5 60 82.0 61 80.5 62 94.0 63 92.5 64 81.0 65 73.0 66 66.0 67 61.5 68 63.0 69 60.5 70 51.5 71 37.0 72 27.5 73 22.0 74 14.5 75 9.5 76 6.0 77 3.0 78 1.5 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.35000000000000003 3 0.325 4 0.3 5 0.325 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.045 20-24 0.0 25-29 0.015 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.005 50-54 0.015 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.03 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.01 105-109 0.015 110-114 0.034999999999999996 115-119 0.025 120-124 0.02 125-129 0.015 130-134 0.01 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18966827044822 97.925 2 0.531780197518359 1.05 3 0.17726006583945303 0.525 4 0.05064573309698658 0.2 5 0.0 0.0 6 0.05064573309698658 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.9 0.0 0.0 0.0 0.0 124-125 3.4124999999999996 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.2875 0.0 0.0 0.0 0.0 130-131 4.987500000000001 0.0 0.0 0.0 0.0 132-133 5.625 0.0 0.0 0.0 0.0 134-135 6.2375 0.0 0.0 0.0 0.0 136-137 6.675 0.0 0.0 0.0 0.0 138-139 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTCT 10 0.006830828 145.0 8 >>END_MODULE Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255074 spots for SRR6958211.sra Written 1255074 spots for SRR6958211.sra Read 1255081 spots for SRR6958211.sra Written 1255081 spots for SRR6958211.sra SRR ids: ['SRR6958211.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_25xdz1wl SRR6958211.sra spots: 25101487 blocks: [[1, 1255074], [1255075, 2510148], [2510149, 3765222], [3765223, 5020296], [5020297, 6275370], [6275371, 7530444], [7530445, 8785518], [8785519, 10040592], [10040593, 11295666], [11295667, 12550740], [12550741, 13805814], [13805815, 15060888], [15060889, 16315962], [16315963, 17571036], [17571037, 18826110], [18826111, 20081184], [20081185, 21336258], [21336259, 22591332], [22591333, 23846406], [23846407, 25101487]] SRR6958211 file size 8484369 SRR6958211 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958211 SRR6958211_1.fastq SRR6958211_2.fastq Input file: SRR6958211_1.fastq Paired file: SRR6958211_2.fastq trimmed: SRR6958211-trimmed-pair1.fastq, SRR6958211-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:18:07 2024 >> started Fri Dec 6 16:18:33 2024 >> done (25.194s) 25101487 read pairs processed; of these: 21426 ( 0.09%) short read pairs filtered out after trimming by size control 35069 ( 0.14%) empty read pairs filtered out after trimming by size control 25044992 (99.77%) read pairs available; of these: 9818187 (39.20%) trimmed read pairs available after processing 15226805 (60.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 4 0.00% 23 6 0.00% 24 2 0.00% 25 7 0.00% 26 5 0.00% 27 5 0.00% 28 4 0.00% 29 6 0.00% 30 3 0.00% 31 3 0.00% 32 8 0.00% 33 5 0.00% 34 4 0.00% 35 9 0.00% 36 10 0.00% 37 4 0.00% 38 12 0.00% 39 14 0.00% 40 11 0.00% 41 11 0.00% 42 9 0.00% 43 11 0.00% 44 11 0.00% 45 20 0.00% 46 24 0.00% 47 32 0.00% 48 34 0.00% 49 34 0.00% 50 35 0.00% 51 52 0.00% 52 44 0.00% 53 41 0.00% 54 66 0.00% 55 73 0.00% 56 64 0.00% 57 71 0.00% 58 104 0.00% 59 119 0.00% 60 118 0.00% 61 141 0.00% 62 170 0.00% 63 210 0.00% 64 225 0.00% 65 229 0.00% 66 252 0.00% 67 328 0.00% 68 371 0.00% 69 400 0.00% 70 526 0.00% 71 544 0.00% 72 672 0.00% 73 773 0.00% 74 908 0.00% 75 992 0.00% 76 1141 0.00% 77 1286 0.01% 78 1479 0.01% 79 1634 0.01% 80 1811 0.01% 81 2085 0.01% 82 2524 0.01% 83 2859 0.01% 84 4053 0.02% 85 4845 0.02% 86 5274 0.02% 87 5403 0.02% 88 6025 0.02% 89 6386 0.03% 90 6930 0.03% 91 7717 0.03% 92 8480 0.03% 93 9506 0.04% 94 10318 0.04% 95 11105 0.04% 96 11876 0.05% 97 12831 0.05% 98 13755 0.05% 99 14819 0.06% 100 15938 0.06% 101 17143 0.07% 102 18685 0.07% 103 20201 0.08% 104 21757 0.09% 105 23091 0.09% 106 24670 0.10% 107 25969 0.10% 108 27331 0.11% 109 28862 0.12% 110 30195 0.12% 111 31889 0.13% 112 34162 0.14% 113 36078 0.14% 114 38812 0.15% 115 41352 0.17% 116 42773 0.17% 117 44414 0.18% 118 46291 0.18% 119 47683 0.19% 120 49475 0.20% 121 50872 0.20% 122 53558 0.21% 123 56631 0.23% 124 58894 0.24% 125 61402 0.25% 126 63656 0.25% 127 66040 0.26% 128 66877 0.27% 129 69207 0.28% 130 71742 0.29% 131 73899 0.30% 132 77349 0.31% 133 80676 0.32% 134 83781 0.33% 135 88445 0.35% 136 91436 0.37% 137 94426 0.38% 138 97110 0.39% 139 101720 0.41% 140 106488 0.43% 141 112681 0.45% 142 121218 0.48% 143 131306 0.52% 144 145819 0.58% 145 166857 0.67% 146 197616 0.79% 147 247027 0.99% 148 356355 1.42% 149 715463 2.86% 150 5280868 21.09% 151 15226805 60.80% 25044992 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=18 prefix-density=0.89 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=87.46 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.1 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=15 prefix-density=0.54 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=64.19 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=4.1 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958211 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:19:20 Started mapping on | Dec 06 16:19:20 Finished on | Dec 06 16:21:36 Mapping speed, Million of reads per hour | 662.96 Number of input reads | 25044992 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 23579625 Uniquely mapped reads % | 94.15% Average mapped length | 294.97 Number of splices: Total | 26694119 Number of splices: Annotated (sjdb) | 25073233 Number of splices: GT/AG | 26318889 Number of splices: GC/AG | 314649 Number of splices: AT/AC | 9032 Number of splices: Non-canonical | 51549 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437848 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 76199 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.03% % of reads unmapped: other | 1.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1039277 1039277 1039277 N_multimapping 437848 437848 437848 N_noFeature 809040 22902447 976053 N_ambiguous 596911 2935 87708 UnstrandedReadsAssigned:22173674 PositiveStrandReadsAssigned:674243 NegativeStrandReadsAssigned:22515864 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958211 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958211-trimmed-pair1.fastq SRR6958211-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,044,992 reads, 22,570,884 reads pseudoaligned [quant] estimated average fragment length: 249.627 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR6958211.ke.tsv 35125 SRR6958211.se.tsv 88098 total ==> SRR6958211.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.905 63.943 5.96548 PNS24247 1044 795.373 41.1135 3.31737 PNS24249 1928 1679.37 76.6544 2.92935 PNS24246 1044 795.373 41.1135 3.31737 PNS24248 1044 795.373 41.1135 3.31737 PNS24244 1471 1222.37 39.062 2.05084 PNS24243 293 93.994 0 0 KQK14069 1603 1354.37 9438.61 447.25 KQK14071 474 239.635 148.599 39.7968 ==> SRR6958211.se.tsv <== BRADI_1g14170v3 10393 BRADI_1g53295v3 1119 BRADI_1g59795v3 107 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 373 BRADI_1g74790v3 96 BRADI_1g09890v3 0 BRADI_1g77505v3 262 BRADI_1g48960v3 0 SRR6958211 completed mapping pipeline successfully