Starting /dee2/code/volunteer_pipeline.sh SRR6958212 current disk space = 1550469922816 free memory = 1601805108 SRR6958212 SRAfilesize 605548e9f670663e8f846ce3ca4d3d6e SRR6958212.sra SRR6958212.sra file validated SRR6958212 is paired end SRR6958212 is conventional basespace SRR6958212 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958212_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09725 34.0 33.0 34.0 32.0 34.0 2 33.32925 34.0 33.0 34.0 33.0 34.0 3 33.336 34.0 33.0 34.0 33.0 34.0 4 33.3155 34.0 33.0 34.0 33.0 34.0 5 33.41675 34.0 33.0 34.0 33.0 34.0 6 36.80575 38.0 37.0 38.0 34.0 38.0 7 37.311 38.0 38.0 38.0 36.0 38.0 8 37.36 38.0 38.0 38.0 37.0 38.0 9 37.5705 38.0 38.0 38.0 38.0 38.0 10-14 37.57005 38.0 38.0 38.0 38.0 38.0 15-19 37.50215000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.6015 38.0 38.0 38.0 38.0 38.0 25-29 37.56215 38.0 38.0 38.0 38.0 38.0 30-34 37.53445 38.0 38.0 38.0 37.8 38.0 35-39 37.5019 38.0 38.0 38.0 38.0 38.0 40-44 37.474849999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.4734 38.0 38.0 38.0 37.4 38.0 50-54 37.4043 38.0 38.0 38.0 37.4 38.0 55-59 37.25945 38.0 38.0 38.0 37.0 38.0 60-64 37.1057 38.0 38.0 38.0 36.6 38.0 65-69 37.2231 38.0 38.0 38.0 36.8 38.0 70-74 37.15545 38.0 38.0 38.0 36.0 38.0 75-79 37.06985 38.0 38.0 38.0 36.0 38.0 80-84 37.0471 38.0 38.0 38.0 35.8 38.0 85-89 36.89045 38.0 38.0 38.0 35.2 38.0 90-94 36.84595 38.0 38.0 38.0 35.0 38.0 95-99 36.6893 38.0 38.0 38.0 34.4 38.0 100-104 36.28105000000001 38.0 38.0 38.0 32.8 38.0 105-109 36.2151 38.0 38.0 38.0 33.0 38.0 110-114 35.987049999999996 38.0 38.0 38.0 33.0 38.0 115-119 35.61285 38.0 37.0 38.0 30.6 38.0 120-124 35.4814 38.0 36.8 38.0 30.4 38.0 125-129 35.33395 38.0 36.4 38.0 29.4 38.0 130-134 34.91275 38.0 35.6 38.0 27.6 38.0 135-139 34.148450000000004 38.0 33.8 38.0 25.2 38.0 140-144 33.8524 38.0 33.2 38.0 24.4 38.0 145-149 33.29135 38.0 33.0 38.0 20.6 38.0 150-151 27.0515 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 3.0 18 3.0 19 5.0 20 9.0 21 5.0 22 10.0 23 7.0 24 6.0 25 2.0 26 22.0 27 21.0 28 11.0 29 24.0 30 54.0 31 49.0 32 62.0 33 98.0 34 157.0 35 268.0 36 749.0 37 2427.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.6 10.525 8.075000000000001 32.800000000000004 2 24.775 11.35 33.125 30.75 3 21.5 14.524999999999999 24.85 39.125 4 25.85 20.875 22.5 30.775000000000002 5 26.85 25.424999999999997 23.150000000000002 24.575 6 26.525 28.475 22.475 22.525000000000002 7 20.125 24.75 35.9 19.225 8 22.25 25.3 27.525 24.925 9 21.05 22.025 31.95 24.975 10-14 23.95 25.445 25.374999999999996 25.230000000000004 15-19 24.35583129033872 24.110671936758894 25.491569520188122 26.041927252714263 20-24 23.98 24.035 25.665 26.32 25-29 24.605 24.945 24.75 25.7 30-34 24.2 24.279999999999998 24.975 26.545 35-39 24.25 24.709999999999997 25.180000000000003 25.86 40-44 24.295 24.175 25.035 26.495 45-49 24.47 24.175 25.224999999999998 26.13 50-54 24.91 24.29 24.615000000000002 26.185000000000002 55-59 24.990000000000002 23.880000000000003 25.124999999999996 26.005 60-64 24.506801867376137 23.69358967923297 25.400331308669244 26.39927714472165 65-69 24.685000000000002 23.945 24.404999999999998 26.965 70-74 24.68 23.765 24.81 26.745 75-79 24.60361126394238 24.538588505977092 24.408542990046517 26.44925724003401 80-84 24.365000000000002 24.065 25.014999999999997 26.555 85-89 24.874974994999 23.929785957191438 24.259851970394077 26.935387077415484 90-94 25.605 23.5 24.81 26.085 95-99 25.081254062703135 23.646182309115456 24.766238311915593 26.506325316265812 100-104 24.86 24.005000000000003 24.63 26.505000000000003 105-109 25.192557767330197 24.01220366109833 24.377313193958187 26.417925377613283 110-114 24.805 23.7 24.485 27.01 115-119 25.228784317647644 23.68855328299245 24.68370255538331 26.398959843976595 120-124 24.779999999999998 24.16 24.485 26.575 125-129 24.879927956774065 24.034420652391436 24.354612767660598 26.7310386231739 130-134 25.765 23.985 24.05 26.200000000000003 135-139 25.28379256888533 24.493674051107668 23.39850977646647 26.82402360354053 140-144 25.34 24.59 24.0 26.07 145-149 24.82 23.985 23.880000000000003 27.315 150-151 25.5 24.5125 24.3 25.687500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 1.0 28 2.0 29 4.0 30 9.0 31 9.0 32 11.0 33 20.5 34 25.5 35 31.5 36 39.5 37 49.5 38 64.5 39 75.0 40 90.5 41 108.0 42 135.0 43 149.0 44 180.0 45 194.0 46 173.0 47 181.0 48 177.0 49 156.5 50 149.5 51 153.0 52 135.5 53 123.5 54 116.5 55 100.0 56 106.0 57 115.0 58 101.5 59 95.5 60 94.0 61 91.5 62 84.0 63 80.5 64 82.5 65 73.0 66 61.5 67 53.5 68 50.0 69 42.0 70 33.0 71 36.5 72 39.0 73 30.0 74 20.5 75 11.5 76 7.5 77 6.5 78 7.0 79 5.5 80 2.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.065 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.395 65-69 0.0 70-74 0.0 75-79 0.034999999999999996 80-84 0.0 85-89 0.02 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.03 110-114 0.0 115-119 0.015 120-124 0.0 125-129 0.06 130-134 0.0 135-139 0.015 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96333754740834 97.85000000000001 2 0.9355246523388117 1.8499999999999999 3 0.1011378002528445 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.9125 0.0 0.0 0.0 0.0 128-129 5.425 0.0 0.0 0.0 0.0 130-131 6.1 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 6.9 0.0 0.0 0.0 0.0 136-137 7.5 0.0 0.0 0.0 0.0 138-139 8.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCGCG 10 0.006843168 144.91249 3 >>END_MODULE SRR6958212 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958212_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87525 33.0 33.0 34.0 32.0 34.0 2 32.97575 34.0 33.0 34.0 32.0 34.0 3 32.991 34.0 33.0 34.0 33.0 34.0 4 32.992 34.0 33.0 34.0 33.0 34.0 5 33.0425 34.0 33.0 34.0 33.0 34.0 6 37.1665 38.0 38.0 38.0 37.0 38.0 7 37.23125 38.0 38.0 38.0 37.0 38.0 8 37.2375 38.0 38.0 38.0 38.0 38.0 9 37.2535 38.0 38.0 38.0 37.0 38.0 10-14 37.150600000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.158950000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.09815 38.0 38.0 38.0 37.2 38.0 25-29 37.0158 38.0 38.0 38.0 37.0 38.0 30-34 37.0271 38.0 38.0 38.0 37.0 38.0 35-39 37.060050000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.0545 38.0 38.0 38.0 37.0 38.0 45-49 37.03425 38.0 38.0 38.0 37.0 38.0 50-54 36.9221 38.0 38.0 38.0 36.6 38.0 55-59 36.886750000000006 38.0 38.0 38.0 36.4 38.0 60-64 36.91675 38.0 38.0 38.0 36.6 38.0 65-69 36.84115 38.0 38.0 38.0 36.2 38.0 70-74 36.815 38.0 38.0 38.0 36.2 38.0 75-79 36.8436 38.0 38.0 38.0 36.0 38.0 80-84 36.78575 38.0 38.0 38.0 36.0 38.0 85-89 36.645849999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.57385000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.45455 38.0 38.0 38.0 35.0 38.0 100-104 36.3981 38.0 38.0 38.0 34.2 38.0 105-109 36.2626 38.0 38.0 38.0 34.0 38.0 110-114 36.13125000000001 38.0 38.0 38.0 34.0 38.0 115-119 35.8625 38.0 38.0 38.0 33.0 38.0 120-124 35.8629 38.0 38.0 38.0 33.0 38.0 125-129 35.7392 38.0 37.6 38.0 32.6 38.0 130-134 35.5099 38.0 36.6 38.0 31.6 38.0 135-139 35.42605 38.0 36.4 38.0 31.8 38.0 140-144 35.0392 38.0 36.0 38.0 30.6 38.0 145-149 34.1871 38.0 35.0 38.0 27.0 38.0 150-151 30.265500000000003 35.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 3.0 4 5.0 5 3.0 6 3.0 7 2.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 3.0 14 2.0 15 2.0 16 2.0 17 1.0 18 0.0 19 2.0 20 1.0 21 5.0 22 5.0 23 8.0 24 7.0 25 9.0 26 14.0 27 16.0 28 17.0 29 22.0 30 32.0 31 38.0 32 47.0 33 84.0 34 135.0 35 194.0 36 500.0 37 2810.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.300000000000004 19.400000000000002 10.225 31.075000000000003 2 29.08816880180859 23.637277066063803 25.69706103993971 21.577493092187893 3 24.77386934673367 25.95477386934673 25.829145728643216 23.44221105527638 4 26.224566691785984 30.042702838482793 19.44235116804823 24.290379301682993 5 27.021597187343044 32.87292817679558 17.805123053741838 22.30035158211954 6 23.982923154193873 34.630838774485184 19.38724259166248 21.99899547965846 7 22.199899547965845 19.588146659969865 31.893520843797084 26.3184329482672 8 26.029116465863456 22.991967871485944 21.86244979919679 29.116465863453815 9 25.113008538422903 23.0286288297338 24.736313410346558 27.122049221496734 10-14 25.91420534458509 25.718304199316854 22.03134418324292 26.33614627285513 15-19 26.180904522613062 24.92462311557789 22.396984924623116 26.497487437185928 20-24 26.626475759859332 24.928409947249435 23.004270283848278 25.440844009042955 25-29 27.341237942122188 25.010048231511256 22.2467845659164 25.401929260450164 30-34 26.14241237320478 25.208396103243945 22.908506578286634 25.740684945264636 35-39 26.465417650308904 25.310161233612938 22.607865789341503 25.616555326736652 40-44 27.1285140562249 24.38755020080321 23.17269076305221 25.311244979919678 45-49 26.485943775100402 24.442771084337352 23.067269076305223 26.00401606425703 50-54 26.608407412987795 24.73507106624479 22.982271106423585 25.67425041434383 55-59 27.419273841209264 24.83302365289007 22.533018631045046 25.21468387485562 60-64 26.500276201476424 24.140009039321047 23.497212876010646 25.862501883191886 65-69 26.955910414783567 24.84684141809782 22.501757557497235 25.695490609621373 70-74 27.103320106484503 23.78321362198001 23.326133909287257 25.78733236224823 75-79 26.747979721929426 24.20820157606786 23.902022787732772 25.141795914269938 80-84 27.031775513277445 24.17047336981075 23.417499121530046 25.38025199538176 85-89 26.638212402711524 24.35350238513683 23.499874466482552 25.508410745669092 90-94 26.762402088772845 24.06607752560755 23.3329985940952 25.838521791524403 95-99 26.53440482169764 24.992466097438474 23.576092415871422 24.897036664992466 100-104 27.57823881046868 24.368312653840356 23.10744964082986 24.945998894861106 105-109 26.514010244049413 24.98242442502762 23.50105453449834 25.002510796424627 110-114 27.416114124974882 24.869399236487844 23.342374924653406 24.372111713883864 115-119 26.87923675621391 25.081596786341954 23.193572683906602 24.845593773537534 120-124 27.162664523259316 25.243645132120967 23.354767406812016 24.238922937807697 125-129 27.405994276821126 24.92092976555048 22.757166524423916 24.91590943320448 130-134 28.42078835048958 25.177002259603317 22.545819733868942 23.856389656038164 135-139 28.07008735816849 24.856913344713323 23.38588211667838 23.687117180439802 140-144 27.54256441163176 25.3980211943147 23.399126111194818 23.660288282858723 145-149 28.133005173539605 25.827515194133305 22.979556984278467 23.059922648048623 150-151 28.688010043942246 25.73760200878845 23.050847457627118 22.523540489642187 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 7.5 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 1.5 29 1.5 30 2.5 31 4.0 32 5.5 33 8.0 34 13.0 35 20.0 36 29.5 37 38.5 38 45.5 39 63.5 40 87.0 41 112.0 42 122.5 43 131.0 44 164.0 45 173.0 46 170.5 47 169.0 48 168.0 49 174.5 50 161.0 51 155.0 52 144.0 53 119.0 54 104.0 55 106.5 56 106.5 57 103.0 58 108.0 59 105.5 60 97.5 61 102.0 62 100.5 63 92.5 64 89.0 65 77.5 66 77.0 67 68.0 68 67.0 69 64.0 70 49.5 71 45.5 72 37.0 73 29.0 74 23.0 75 15.5 76 7.5 77 5.5 78 5.5 79 3.5 80 2.5 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.5 4 0.475 5 0.44999999999999996 6 0.44999999999999996 7 0.44999999999999996 8 0.4 9 0.44999999999999996 10-14 0.45999999999999996 15-19 0.5 20-24 0.475 25-29 0.48 30-34 0.43 35-39 0.455 40-44 0.4 45-49 0.4 50-54 0.445 55-59 0.43499999999999994 60-64 0.43499999999999994 65-69 0.43 70-74 0.455 75-79 0.385 80-84 0.395 85-89 0.42500000000000004 90-94 0.42 95-99 0.44999999999999996 100-104 0.46499999999999997 105-109 0.43 110-114 0.45999999999999996 115-119 0.42500000000000004 120-124 0.47000000000000003 125-129 0.40499999999999997 130-134 0.42500000000000004 135-139 0.41000000000000003 140-144 0.445 145-149 0.455 150-151 0.43750000000000006 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57361181864493 96.75 2 1.1716760061130922 2.3 3 0.10188487009679062 0.3 4 0.1273560876209883 0.5 5 0.0 0.0 6 0.025471217524197655 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.725 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.8875 0.0 0.0 0.0 0.0 128-129 5.4 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.375 0.0 0.0 0.0 0.0 134-135 6.800000000000001 0.0 0.0 0.0 0.0 136-137 7.375 0.0 0.0 0.0 0.0 138-139 7.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGGT 10 0.006830828 145.0 5 >>END_MODULE Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066829 spots for SRR6958212.sra Written 1066829 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra Read 1066827 spots for SRR6958212.sra Written 1066827 spots for SRR6958212.sra SRR ids: ['SRR6958212.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nhni5pag SRR6958212.sra spots: 21336542 blocks: [[1, 1066827], [1066828, 2133654], [2133655, 3200481], [3200482, 4267308], [4267309, 5334135], [5334136, 6400962], [6400963, 7467789], [7467790, 8534616], [8534617, 9601443], [9601444, 10668270], [10668271, 11735097], [11735098, 12801924], [12801925, 13868751], [13868752, 14935578], [14935579, 16002405], [16002406, 17069232], [17069233, 18136059], [18136060, 19202886], [19202887, 20269713], [20269714, 21336542]] SRR6958212 file size 7208553 SRR6958212 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958212 SRR6958212_1.fastq SRR6958212_2.fastq Input file: SRR6958212_1.fastq Paired file: SRR6958212_2.fastq trimmed: SRR6958212-trimmed-pair1.fastq, SRR6958212-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:16:47 2024 >> started Fri Dec 6 16:17:15 2024 >> done (28.522s) 21336542 read pairs processed; of these: 28793 ( 0.13%) short read pairs filtered out after trimming by size control 74349 ( 0.35%) empty read pairs filtered out after trimming by size control 21233400 (99.52%) read pairs available; of these: 10261358 (48.33%) trimmed read pairs available after processing 10972042 (51.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 6 0.00% 21 6 0.00% 22 2 0.00% 23 10 0.00% 24 6 0.00% 25 6 0.00% 26 6 0.00% 27 14 0.00% 28 15 0.00% 29 10 0.00% 30 12 0.00% 31 9 0.00% 32 7 0.00% 33 6 0.00% 34 13 0.00% 35 13 0.00% 36 9 0.00% 37 17 0.00% 38 7 0.00% 39 13 0.00% 40 19 0.00% 41 18 0.00% 42 15 0.00% 43 12 0.00% 44 12 0.00% 45 25 0.00% 46 28 0.00% 47 22 0.00% 48 25 0.00% 49 39 0.00% 50 31 0.00% 51 46 0.00% 52 45 0.00% 53 49 0.00% 54 53 0.00% 55 61 0.00% 56 93 0.00% 57 89 0.00% 58 91 0.00% 59 112 0.00% 60 131 0.00% 61 159 0.00% 62 160 0.00% 63 209 0.00% 64 214 0.00% 65 231 0.00% 66 276 0.00% 67 320 0.00% 68 385 0.00% 69 416 0.00% 70 470 0.00% 71 549 0.00% 72 678 0.00% 73 735 0.00% 74 908 0.00% 75 1012 0.00% 76 1124 0.01% 77 1308 0.01% 78 1485 0.01% 79 1659 0.01% 80 1910 0.01% 81 2092 0.01% 82 2618 0.01% 83 2974 0.01% 84 4291 0.02% 85 5031 0.02% 86 5585 0.03% 87 6153 0.03% 88 6519 0.03% 89 6829 0.03% 90 7614 0.04% 91 7957 0.04% 92 9056 0.04% 93 9580 0.05% 94 10638 0.05% 95 11436 0.05% 96 12174 0.06% 97 13033 0.06% 98 14042 0.07% 99 14874 0.07% 100 16332 0.08% 101 17461 0.08% 102 18965 0.09% 103 20569 0.10% 104 21998 0.10% 105 23476 0.11% 106 24936 0.12% 107 25952 0.12% 108 26944 0.13% 109 29183 0.14% 110 30408 0.14% 111 31897 0.15% 112 33955 0.16% 113 36018 0.17% 114 38194 0.18% 115 40439 0.19% 116 42359 0.20% 117 44118 0.21% 118 46147 0.22% 119 47203 0.22% 120 49396 0.23% 121 51655 0.24% 122 53171 0.25% 123 55663 0.26% 124 59003 0.28% 125 61849 0.29% 126 64335 0.30% 127 66616 0.31% 128 68000 0.32% 129 69899 0.33% 130 72062 0.34% 131 74982 0.35% 132 77911 0.37% 133 81513 0.38% 134 84726 0.40% 135 88551 0.42% 136 90745 0.43% 137 93642 0.44% 138 97051 0.46% 139 101084 0.48% 140 105218 0.50% 141 111130 0.52% 142 119623 0.56% 143 128323 0.60% 144 142156 0.67% 145 160986 0.76% 146 190199 0.90% 147 245233 1.15% 148 358123 1.69% 149 739888 3.48% 150 5714153 26.91% 151 10972042 51.67% 21233400 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=15 prefix-density=0.68 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=26.42 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=17 prefix-density=0.67 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=67.79 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=4.6 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958212 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:18:03 Started mapping on | Dec 06 16:18:03 Finished on | Dec 06 16:19:57 Mapping speed, Million of reads per hour | 670.53 Number of input reads | 21233400 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 20580161 Uniquely mapped reads % | 96.92% Average mapped length | 293.76 Number of splices: Total | 22266352 Number of splices: Annotated (sjdb) | 20961026 Number of splices: GT/AG | 21951855 Number of splices: GC/AG | 261994 Number of splices: AT/AC | 7084 Number of splices: Non-canonical | 45419 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 3.08 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231858 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 17338 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.49% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 438058 438058 438058 N_multimapping 231858 231858 231858 N_noFeature 497020 19954696 643406 N_ambiguous 555090 2438 76802 UnstrandedReadsAssigned:19528051 PositiveStrandReadsAssigned:623027 NegativeStrandReadsAssigned:19859953 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958212 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958212-trimmed-pair1.fastq SRR6958212-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,233,400 reads, 19,846,389 reads pseudoaligned [quant] estimated average fragment length: 237.869 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52973 SRR6958212.ke.tsv 35125 SRR6958212.se.tsv 88098 total ==> SRR6958212.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.459 0 0 PNS24247 1044 807.131 49.4392 4.20712 PNS24249 1928 1691.13 83.9654 3.41021 PNS24246 1044 807.131 49.4392 4.20712 PNS24248 1044 807.131 49.4392 4.20712 PNS24244 1471 1234.13 29.7171 1.65388 PNS24243 293 97.4344 0 0 KQK14069 1603 1366.13 4523.68 227.435 KQK14071 474 247.023 60.1431 16.7227 ==> SRR6958212.se.tsv <== BRADI_1g14170v3 4926 BRADI_1g53295v3 718 BRADI_1g59795v3 98 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 416 BRADI_1g74790v3 138 BRADI_1g09890v3 1 BRADI_1g77505v3 322 BRADI_1g48960v3 0 SRR6958212 completed mapping pipeline successfully