Starting /dee2/code/volunteer_pipeline.sh SRR6958213 current disk space = 1550584225792 free memory = 1598923496 SRR6958213 SRAfilesize f2bfbfb4c2c4bea5c12a8715caf1b2a5 SRR6958213.sra SRR6958213.sra file validated SRR6958213 is paired end SRR6958213 is conventional basespace SRR6958213 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958213_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.663 31.0 18.0 33.0 18.0 33.0 2 24.507 25.0 18.0 29.0 18.0 31.0 3 30.1505 31.0 28.0 33.0 27.0 33.0 4 30.961 33.0 30.0 33.0 28.0 33.0 5 32.0565 33.0 31.0 33.0 30.0 33.0 6 36.365 37.0 36.0 38.0 34.0 38.0 7 37.343 38.0 38.0 38.0 36.0 38.0 8 37.4545 38.0 38.0 38.0 37.0 38.0 9 37.609 38.0 38.0 38.0 38.0 38.0 10-14 37.59785000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.637600000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.572900000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.3322 38.0 38.0 38.0 37.0 38.0 30-34 37.61395 38.0 38.0 38.0 38.0 38.0 35-39 37.5714 38.0 38.0 38.0 37.8 38.0 40-44 37.31935 38.0 38.0 38.0 37.0 38.0 45-49 37.4268 38.0 38.0 38.0 37.4 38.0 50-54 37.3224 38.0 38.0 38.0 36.8 38.0 55-59 37.221000000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.282000000000004 38.0 38.0 38.0 36.6 38.0 65-69 37.27705 38.0 38.0 38.0 36.6 38.0 70-74 36.92829999999999 38.0 38.0 38.0 35.4 38.0 75-79 37.124900000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.0769 38.0 38.0 38.0 35.8 38.0 85-89 36.9119 38.0 38.0 38.0 35.0 38.0 90-94 36.80414999999999 38.0 38.0 38.0 34.8 38.0 95-99 36.770849999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.6438 38.0 38.0 38.0 34.0 38.0 105-109 36.51965 38.0 38.0 38.0 34.0 38.0 110-114 36.274150000000006 38.0 37.6 38.0 33.6 38.0 115-119 36.148900000000005 38.0 37.0 38.0 33.2 38.0 120-124 36.01725 38.0 37.0 38.0 33.2 38.0 125-129 35.60735 38.0 36.2 38.0 31.6 38.0 130-134 35.357150000000004 38.0 35.8 38.0 30.4 38.0 135-139 35.19535 38.0 35.4 38.0 29.8 38.0 140-144 34.83795 38.0 34.4 38.0 28.8 38.0 145-149 33.67145 38.0 33.0 38.0 23.6 38.0 150-151 29.06725 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 3.0 19 1.0 20 1.0 21 2.0 22 2.0 23 7.0 24 5.0 25 10.0 26 11.0 27 8.0 28 13.0 29 23.0 30 47.0 31 45.0 32 85.0 33 108.0 34 188.0 35 359.0 36 920.0 37 2161.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.248371123273387 14.777169663799844 10.424811050299713 43.54964816262705 2 19.875 13.65 37.175000000000004 29.299999999999997 3 19.3 15.725 24.625 40.35 4 24.099999999999998 24.05 21.95 29.9 5 25.85 29.525000000000002 24.025 20.599999999999998 6 21.6 34.625 23.5 20.275000000000002 7 19.325 25.2 38.475 17.0 8 20.525 24.0 30.925000000000004 24.55 9 19.775000000000002 23.275000000000002 33.324999999999996 23.625 10-14 21.32 27.634999999999998 27.215 23.830000000000002 15-19 22.025 26.435 26.895000000000003 24.645 20-24 21.84609230461523 27.02135106755338 26.466323316165806 24.666233311665582 25-29 21.815 26.96 27.07 24.154999999999998 30-34 22.68 26.715 26.63 23.974999999999998 35-39 22.255 26.810000000000002 26.490000000000002 24.445 40-44 21.61 26.82 27.025 24.545 45-49 22.564999999999998 26.245 26.495 24.695 50-54 21.240000000000002 26.83 26.484999999999996 25.445 55-59 22.155 26.895000000000003 26.215 24.735 60-64 22.22111105555278 26.536326816340818 26.19130956547827 25.05125256262813 65-69 22.013301995299294 26.608991348702304 26.523978596789515 24.853728059208883 70-74 22.53063265816454 26.68667166791698 26.206551637909474 24.576144036009 75-79 22.21 26.52 26.900000000000002 24.37 80-84 22.485 26.490000000000002 26.345000000000002 24.68 85-89 22.035 27.034999999999997 26.255 24.675 90-94 22.555 26.075 27.034999999999997 24.335 95-99 21.995 26.290000000000003 26.805 24.91 100-104 21.811543463038912 26.212863859157746 26.778033410023006 25.197559267780335 105-109 22.17 26.155 26.724999999999998 24.95 110-114 22.797693657558284 26.051642015542743 26.327400350965153 24.82326397593382 115-119 22.73318654923939 26.556244995996796 26.546236989591677 24.164331465172136 120-124 22.644719067393808 26.817431330364737 25.64667033571822 24.89117926652324 125-129 22.417339822387238 26.014750890572476 26.48637800411419 25.081531282926093 130-134 22.67607748911248 26.905941833108077 25.709566000901034 24.70841467687841 135-139 22.2 26.340000000000003 26.419999999999998 25.040000000000003 140-144 22.314999999999998 26.58 25.91 25.195 145-149 22.91 26.495 26.055 24.54 150-151 22.6 26.55 26.5875 24.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.5 28 3.5 29 5.5 30 7.5 31 10.0 32 17.5 33 26.5 34 35.5 35 45.5 36 64.5 37 84.0 38 101.0 39 124.0 40 155.5 41 188.5 42 218.5 43 236.0 44 245.5 45 237.5 46 219.5 47 226.5 48 216.5 49 192.0 50 170.5 51 145.0 52 130.0 53 108.0 54 85.0 55 78.0 56 88.0 57 75.0 58 51.5 59 53.0 60 46.5 61 40.0 62 41.0 63 36.0 64 28.0 65 26.0 66 25.5 67 22.5 68 20.5 69 16.5 70 12.5 71 10.5 72 8.0 73 6.0 74 4.5 75 3.0 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.015 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.27499999999999997 115-119 0.08 120-124 0.065 125-129 0.345 130-134 0.11499999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.3875 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.7 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.3875 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 2.8875 0.0 0.0 0.0 0.0 136-137 3.2125 0.0 0.0 0.0 0.0 138-139 3.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958213 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958213_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0785 33.0 33.0 34.0 33.0 34.0 2 33.28775 34.0 33.0 34.0 33.0 34.0 3 33.2295 34.0 33.0 34.0 33.0 34.0 4 33.27 34.0 33.0 34.0 33.0 34.0 5 32.97725 34.0 33.0 34.0 32.0 34.0 6 37.29675 38.0 38.0 38.0 37.0 38.0 7 37.48575 38.0 38.0 38.0 38.0 38.0 8 37.4335 38.0 38.0 38.0 38.0 38.0 9 37.3175 38.0 38.0 38.0 37.0 38.0 10-14 36.579 38.0 36.6 38.0 33.6 38.0 15-19 37.042899999999996 38.0 37.8 38.0 35.8 38.0 20-24 37.429449999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.4754 38.0 38.0 38.0 38.0 38.0 30-34 37.4958 38.0 38.0 38.0 38.0 38.0 35-39 37.40945 38.0 38.0 38.0 38.0 38.0 40-44 36.6135 38.0 37.4 38.0 32.2 38.0 45-49 36.96015 38.0 38.0 38.0 35.2 38.0 50-54 37.32465 38.0 38.0 38.0 37.6 38.0 55-59 37.3781 38.0 38.0 38.0 37.4 38.0 60-64 37.32965 38.0 38.0 38.0 37.8 38.0 65-69 37.2989 38.0 38.0 38.0 37.4 38.0 70-74 37.2337 38.0 38.0 38.0 37.0 38.0 75-79 36.7667 38.0 38.0 38.0 34.4 38.0 80-84 36.27295 38.0 37.2 38.0 30.8 38.0 85-89 35.88655 38.0 37.0 38.0 28.6 38.0 90-94 36.6683 38.0 37.8 38.0 34.4 38.0 95-99 37.06945 38.0 38.0 38.0 36.2 38.0 100-104 36.94885 38.0 38.0 38.0 35.8 38.0 105-109 36.756550000000004 38.0 38.0 38.0 35.0 38.0 110-114 36.79715 38.0 38.0 38.0 35.2 38.0 115-119 36.71045 38.0 38.0 38.0 35.0 38.0 120-124 36.72085 38.0 38.0 38.0 35.0 38.0 125-129 36.54595 38.0 38.0 38.0 34.8 38.0 130-134 36.43875 38.0 38.0 38.0 34.6 38.0 135-139 33.35125000000001 37.0 29.6 38.0 24.6 38.0 140-144 34.93195 38.0 35.8 38.0 29.6 38.0 145-149 34.447500000000005 38.0 35.6 38.0 28.2 38.0 150-151 30.137499999999996 35.5 28.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 1.0 15 1.0 16 0.0 17 2.0 18 2.0 19 3.0 20 2.0 21 4.0 22 2.0 23 3.0 24 4.0 25 11.0 26 8.0 27 14.0 28 25.0 29 18.0 30 23.0 31 41.0 32 51.0 33 101.0 34 122.0 35 241.0 36 711.0 37 2596.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.074999999999996 16.325 14.2 36.4 2 30.875000000000004 22.0 28.675 18.45 3 21.975 26.25 28.199999999999996 23.575 4 25.724999999999998 30.85 21.099999999999998 22.325 5 27.400000000000002 32.725 20.75 19.125 6 21.125 35.3 23.200000000000003 20.375 7 20.525 20.5 36.825 22.15 8 24.4 23.95 25.624999999999996 26.025 9 24.25 22.925 30.325000000000003 22.5 10-14 25.41 26.915 24.415 23.26 15-19 24.560000000000002 26.77 25.580000000000002 23.09 20-24 24.95 26.25 25.645 23.155 25-29 24.985 26.66 25.624999999999996 22.73 30-34 24.715 26.865 25.56 22.86 35-39 25.0 26.584999999999997 25.645 22.770000000000003 40-44 25.09 26.525 25.86 22.525000000000002 45-49 25.045 26.615 25.88 22.46 50-54 24.87 26.490000000000002 25.91 22.73 55-59 24.645 26.005 25.874999999999996 23.474999999999998 60-64 25.09 26.61 25.895000000000003 22.405 65-69 25.28 26.505000000000003 25.635 22.58 70-74 25.31 25.75 26.08 22.86 75-79 24.51 26.229999999999997 26.02 23.24 80-84 25.095 26.009999999999998 26.3 22.595000000000002 85-89 24.995 26.82 25.14 23.044999999999998 90-94 25.045 26.525 25.685000000000002 22.745 95-99 25.009999999999998 26.400000000000002 26.465 22.125 100-104 25.415 26.135 25.81 22.64 105-109 24.68 27.005000000000003 25.755 22.56 110-114 25.365 26.784999999999997 25.71 22.14 115-119 25.465 26.674999999999997 25.505 22.355 120-124 25.35 26.939999999999998 25.480000000000004 22.23 125-129 25.28 26.775 26.06 21.884999999999998 130-134 25.580000000000002 26.115 26.22 22.085 135-139 25.480000000000004 26.889999999999997 25.83 21.8 140-144 25.845000000000002 26.924999999999997 25.324999999999996 21.905 145-149 25.35 27.235 25.795 21.62 150-151 25.587500000000002 26.9625 25.7375 21.712500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 0.5 27 2.0 28 4.5 29 4.5 30 6.5 31 9.5 32 14.0 33 20.0 34 26.5 35 34.0 36 49.5 37 68.5 38 83.5 39 115.5 40 156.0 41 173.5 42 187.5 43 215.0 44 257.0 45 252.0 46 223.0 47 206.5 48 183.5 49 174.0 50 162.5 51 151.0 52 131.0 53 119.5 54 111.5 55 88.5 56 79.0 57 74.0 58 74.5 59 73.0 60 66.5 61 65.5 62 58.0 63 47.5 64 41.0 65 33.5 66 27.5 67 28.0 68 24.5 69 21.0 70 16.0 71 13.5 72 8.0 73 3.5 74 3.5 75 2.0 76 1.0 77 0.5 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.3625 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.825 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.7125000000000004 0.0 0.0 0.0 0.0 136-137 3.025 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATGCA 10 0.006830828 145.0 8 >>END_MODULE Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911473 spots for SRR6958213.sra Written 911473 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra Read 911454 spots for SRR6958213.sra Written 911454 spots for SRR6958213.sra SRR ids: ['SRR6958213.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kly1hh_u SRR6958213.sra spots: 18229099 blocks: [[1, 911454], [911455, 1822908], [1822909, 2734362], [2734363, 3645816], [3645817, 4557270], [4557271, 5468724], [5468725, 6380178], [6380179, 7291632], [7291633, 8203086], [8203087, 9114540], [9114541, 10025994], [10025995, 10937448], [10937449, 11848902], [11848903, 12760356], [12760357, 13671810], [13671811, 14583264], [14583265, 15494718], [15494719, 16406172], [16406173, 17317626], [17317627, 18229099]] SRR6958213 file size 6155543 SRR6958213 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958213 SRR6958213_1.fastq SRR6958213_2.fastq Input file: SRR6958213_1.fastq Paired file: SRR6958213_2.fastq trimmed: SRR6958213-trimmed-pair1.fastq, SRR6958213-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:21:27 2024 >> started Fri Dec 6 16:21:51 2024 >> done (24.122s) 18229099 read pairs processed; of these: 12001 ( 0.07%) short read pairs filtered out after trimming by size control 13491 ( 0.07%) empty read pairs filtered out after trimming by size control 18203607 (99.86%) read pairs available; of these: 6204046 (34.08%) trimmed read pairs available after processing 11999561 (65.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 5 0.00% 21 4 0.00% 22 3 0.00% 23 3 0.00% 24 5 0.00% 25 4 0.00% 26 2 0.00% 27 3 0.00% 28 8 0.00% 29 7 0.00% 30 4 0.00% 31 8 0.00% 32 8 0.00% 33 8 0.00% 34 10 0.00% 35 3 0.00% 36 14 0.00% 37 7 0.00% 38 10 0.00% 39 16 0.00% 40 13 0.00% 41 13 0.00% 42 17 0.00% 43 17 0.00% 44 16 0.00% 45 19 0.00% 46 28 0.00% 47 20 0.00% 48 29 0.00% 49 27 0.00% 50 39 0.00% 51 40 0.00% 52 34 0.00% 53 43 0.00% 54 49 0.00% 55 66 0.00% 56 64 0.00% 57 54 0.00% 58 69 0.00% 59 83 0.00% 60 76 0.00% 61 115 0.00% 62 115 0.00% 63 136 0.00% 64 135 0.00% 65 189 0.00% 66 189 0.00% 67 203 0.00% 68 267 0.00% 69 280 0.00% 70 286 0.00% 71 374 0.00% 72 427 0.00% 73 461 0.00% 74 550 0.00% 75 590 0.00% 76 672 0.00% 77 763 0.00% 78 838 0.00% 79 891 0.00% 80 1036 0.01% 81 1175 0.01% 82 1432 0.01% 83 1553 0.01% 84 2150 0.01% 85 2414 0.01% 86 2538 0.01% 87 2640 0.01% 88 2953 0.02% 89 3145 0.02% 90 3287 0.02% 91 3697 0.02% 92 3874 0.02% 93 4183 0.02% 94 4724 0.03% 95 5184 0.03% 96 5299 0.03% 97 5785 0.03% 98 6273 0.03% 99 6538 0.04% 100 7102 0.04% 101 7562 0.04% 102 7960 0.04% 103 8502 0.05% 104 9061 0.05% 105 9484 0.05% 106 10414 0.06% 107 10882 0.06% 108 11631 0.06% 109 12140 0.07% 110 12773 0.07% 111 13189 0.07% 112 13835 0.08% 113 14402 0.08% 114 15232 0.08% 115 16348 0.09% 116 17118 0.09% 117 17864 0.10% 118 18638 0.10% 119 19254 0.11% 120 19838 0.11% 121 20951 0.12% 122 21892 0.12% 123 22559 0.12% 124 23849 0.13% 125 25199 0.14% 126 26278 0.14% 127 27353 0.15% 128 28313 0.16% 129 30042 0.17% 130 31688 0.17% 131 31954 0.18% 132 33882 0.19% 133 35359 0.19% 134 37167 0.20% 135 39397 0.22% 136 41856 0.23% 137 44378 0.24% 138 45682 0.25% 139 49324 0.27% 140 52921 0.29% 141 57092 0.31% 142 63314 0.35% 143 70949 0.39% 144 81434 0.45% 145 96491 0.53% 146 120045 0.66% 147 162339 0.89% 148 252958 1.39% 149 535511 2.94% 150 3742325 20.56% 151 11999561 65.92% 18203607 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=20 prefix-density=0.86 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=56.28 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=14 prefix-density=0.65 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=24.26 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958213 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:22:41 Started mapping on | Dec 06 16:22:41 Finished on | Dec 06 16:24:03 Mapping speed, Million of reads per hour | 799.18 Number of input reads | 18203607 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17988447 Uniquely mapped reads % | 98.82% Average mapped length | 297.69 Number of splices: Total | 21284773 Number of splices: Annotated (sjdb) | 20063700 Number of splices: GT/AG | 21016329 Number of splices: GC/AG | 245550 Number of splices: AT/AC | 8503 Number of splices: Non-canonical | 14391 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 110280 % of reads mapped to multiple loci | 0.61% Number of reads mapped to too many loci | 8902 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.21% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 110209 110209 110209 N_multimapping 110280 110280 110280 N_noFeature 686393 17458303 849251 N_ambiguous 432753 2292 66911 UnstrandedReadsAssigned:16869301 PositiveStrandReadsAssigned:527852 NegativeStrandReadsAssigned:17072285 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958213 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958213-trimmed-pair1.fastq SRR6958213-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,203,607 reads, 17,090,037 reads pseudoaligned [quant] estimated average fragment length: 247.171 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR6958213.ke.tsv 35125 SRR6958213.se.tsv 88098 total ==> SRR6958213.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.283 0 0 PNS24247 1044 797.829 51.7662 5.94513 PNS24249 1928 1681.83 18.66 1.01661 PNS24246 1044 797.829 51.7662 5.94513 PNS24248 1044 797.829 51.7662 5.94513 PNS24244 1471 1224.83 38.0415 2.84582 PNS24243 293 83.6721 0 0 KQK14069 1603 1356.83 4552.78 307.452 KQK14071 474 233.622 64.1921 25.1764 ==> SRR6958213.se.tsv <== BRADI_1g14170v3 5083 BRADI_1g53295v3 199 BRADI_1g59795v3 251 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 278 BRADI_1g74790v3 63 BRADI_1g09890v3 1 BRADI_1g77505v3 185 BRADI_1g48960v3 0 SRR6958213 completed mapping pipeline successfully