Starting /dee2/code/volunteer_pipeline.sh SRR6958214 current disk space = 1550572990464 free memory = 1600510080 SRR6958214 SRAfilesize 9eb21143a8a2a82874e2266a4e0b520a SRR6958214.sra SRR6958214.sra file validated SRR6958214 is paired end SRR6958214 is conventional basespace SRR6958214 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958214_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.54 27.0 18.0 32.0 18.0 33.0 2 23.08675 18.0 18.0 28.0 18.0 31.0 3 27.56925 29.0 27.0 31.0 18.0 33.0 4 26.73575 29.0 25.0 31.0 15.0 33.0 5 31.89675 32.0 32.0 33.0 32.0 33.0 6 35.27175 37.0 35.0 38.0 31.0 38.0 7 36.5605 38.0 37.0 38.0 34.0 38.0 8 36.14425 38.0 37.0 38.0 33.0 38.0 9 37.0585 38.0 38.0 38.0 36.0 38.0 10-14 37.43 38.0 38.0 38.0 36.8 38.0 15-19 37.502500000000005 38.0 38.0 38.0 37.6 38.0 20-24 37.5192 38.0 38.0 38.0 37.8 38.0 25-29 37.4614 38.0 38.0 38.0 37.4 38.0 30-34 37.21345 38.0 38.0 38.0 36.6 38.0 35-39 37.5638 38.0 38.0 38.0 37.8 38.0 40-44 37.524899999999995 38.0 38.0 38.0 37.8 38.0 45-49 37.47685 38.0 38.0 38.0 37.6 38.0 50-54 37.28495 38.0 38.0 38.0 37.0 38.0 55-59 37.326649999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.47435 38.0 38.0 38.0 37.2 38.0 65-69 36.9581 38.0 38.0 38.0 35.4 38.0 70-74 36.705349999999996 38.0 37.8 38.0 33.8 38.0 75-79 37.24305 38.0 38.0 38.0 36.6 38.0 80-84 37.317449999999994 38.0 38.0 38.0 37.0 38.0 85-89 36.5543 38.0 37.6 38.0 33.6 38.0 90-94 34.7845 38.0 35.0 38.0 23.8 38.0 95-99 36.136250000000004 38.0 37.4 38.0 32.6 38.0 100-104 35.9104 38.0 37.2 38.0 30.2 38.0 105-109 36.04565 38.0 37.2 38.0 32.2 38.0 110-114 36.1087 38.0 37.6 38.0 32.6 38.0 115-119 36.462599999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.527750000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.5279 38.0 38.0 38.0 34.2 38.0 130-134 36.49374999999999 38.0 38.0 38.0 34.0 38.0 135-139 36.20590000000001 38.0 37.4 38.0 33.4 38.0 140-144 35.5176 38.0 36.2 38.0 31.0 38.0 145-149 35.017700000000005 38.0 35.8 38.0 30.2 38.0 150-151 30.995874999999998 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 3.0 19 1.0 20 2.0 21 0.0 22 2.0 23 2.0 24 4.0 25 3.0 26 7.0 27 15.0 28 17.0 29 22.0 30 46.0 31 53.0 32 87.0 33 113.0 34 170.0 35 334.0 36 992.0 37 2123.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.526232533614554 17.321381492222514 10.229369891906142 43.92301608225679 2 14.607303651825912 20.535267633816908 31.96598299149575 32.89144572286143 3 21.2 20.05 24.875 33.875 4 23.825 26.375 21.7 28.1 5 24.6 30.975 22.85 21.575 6 21.9 32.550000000000004 23.425 22.125 7 16.025 23.799999999999997 41.15 19.025 8 20.05 23.525 28.9 27.525 9 18.8 22.925 33.2 25.074999999999996 10-14 21.665 27.37 25.869999999999997 25.095 15-19 22.11 25.990000000000002 26.25 25.650000000000002 20-24 22.271681504451337 26.01780534160248 25.99779933980194 25.712713814144244 25-29 22.376118805940298 26.561328066403323 26.30131506575329 24.761238061903097 30-34 21.84 26.06 26.634999999999998 25.465 35-39 22.291114555727788 26.16630831541577 26.73133656682834 24.8112405620281 40-44 22.23111155557778 26.046302315115753 26.351317565878297 25.371268563428174 45-49 22.445 26.27 26.665 24.62 50-54 22.48 25.86 26.82 24.84 55-59 22.48612430621531 25.506275313765688 26.721336066803342 25.28626431321566 60-64 22.325 26.064999999999998 26.22 25.39 65-69 22.715 25.25 26.765 25.27 70-74 22.29 25.75 26.619999999999997 25.34 75-79 22.38 26.334999999999997 25.974999999999998 25.31 80-84 22.195 26.015 26.005 25.785000000000004 85-89 22.165000000000003 26.6 25.790000000000003 25.445 90-94 22.31 25.83 26.91 24.95 95-99 22.685 25.55 26.41 25.355 100-104 22.220000000000002 26.66 26.0 25.119999999999997 105-109 22.805 24.69 26.855 25.650000000000002 110-114 22.66 25.490000000000002 26.39 25.46 115-119 22.66 25.955000000000002 26.790000000000003 24.595 120-124 22.689999999999998 25.53 26.174999999999997 25.605 125-129 22.345000000000002 26.005 25.790000000000003 25.86 130-134 23.43 25.130000000000003 25.919999999999998 25.52 135-139 23.34 26.0 25.89 24.77 140-144 22.869999999999997 25.91 25.929999999999996 25.290000000000003 145-149 23.115 25.75 25.85 25.285000000000004 150-151 22.625 25.337500000000002 25.75 26.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 2.5 29 5.0 30 7.5 31 10.5 32 15.5 33 20.5 34 30.5 35 42.5 36 52.0 37 64.5 38 91.5 39 124.0 40 148.5 41 167.0 42 195.5 43 216.5 44 226.0 45 237.5 46 240.0 47 227.5 48 209.0 49 183.5 50 158.0 51 149.0 52 146.5 53 136.0 54 108.0 55 92.0 56 80.0 57 65.5 58 58.0 59 57.0 60 58.5 61 58.5 62 49.5 63 40.5 64 40.0 65 35.5 66 29.0 67 24.0 68 23.5 69 18.0 70 13.5 71 14.0 72 10.5 73 7.5 74 4.0 75 0.5 76 1.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.175 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.005 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.2374999999999998 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.6 0.0 0.0 0.0 0.0 134-135 3.8375 0.0 0.0 0.0 0.0 136-137 4.3 0.0 0.0 0.0 0.0 138-139 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTCCA 10 0.0068378756 144.95 4 >>END_MODULE SRR6958214 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958214_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9315 33.0 33.0 34.0 32.0 34.0 2 33.14525 34.0 33.0 34.0 33.0 34.0 3 33.14 34.0 33.0 34.0 32.0 34.0 4 33.09525 34.0 33.0 34.0 32.0 34.0 5 33.06325 34.0 33.0 34.0 33.0 34.0 6 37.24225 38.0 38.0 38.0 37.0 38.0 7 37.2395 38.0 38.0 38.0 37.0 38.0 8 37.28325 38.0 38.0 38.0 37.0 38.0 9 37.14275 38.0 38.0 38.0 37.0 38.0 10-14 37.1004 38.0 38.0 38.0 36.6 38.0 15-19 36.96605 38.0 38.0 38.0 36.4 38.0 20-24 36.6676 38.0 38.0 38.0 35.2 38.0 25-29 36.4723 38.0 37.8 38.0 33.8 38.0 30-34 36.7977 38.0 38.0 38.0 35.6 38.0 35-39 36.7759 38.0 37.8 38.0 35.0 38.0 40-44 35.7789 38.0 36.4 38.0 30.2 38.0 45-49 36.708400000000005 38.0 37.6 38.0 34.4 38.0 50-54 36.97975 38.0 38.0 38.0 36.4 38.0 55-59 36.98565 38.0 38.0 38.0 36.4 38.0 60-64 35.565 38.0 35.6 38.0 30.4 38.0 65-69 36.00595 38.0 37.0 38.0 31.2 38.0 70-74 35.4305 38.0 35.6 38.0 28.2 38.0 75-79 36.48864999999999 38.0 38.0 38.0 34.4 38.0 80-84 36.405 38.0 38.0 38.0 34.2 38.0 85-89 36.28725 38.0 38.0 38.0 33.8 38.0 90-94 36.50145 38.0 38.0 38.0 34.6 38.0 95-99 36.55765 38.0 38.0 38.0 35.0 38.0 100-104 36.6108 38.0 38.0 38.0 35.0 38.0 105-109 36.3622 38.0 38.0 38.0 34.2 38.0 110-114 36.32365 38.0 38.0 38.0 34.0 38.0 115-119 36.22324999999999 38.0 38.0 38.0 34.0 38.0 120-124 35.389050000000005 38.0 37.0 38.0 29.2 38.0 125-129 35.37275 38.0 36.0 38.0 30.0 38.0 130-134 35.69305 38.0 37.0 38.0 32.6 38.0 135-139 35.45555 38.0 36.6 38.0 31.0 38.0 140-144 35.169850000000004 38.0 36.0 38.0 30.6 38.0 145-149 34.87925 38.0 36.0 38.0 30.0 38.0 150-151 29.762499999999996 35.5 28.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 7.0 4 4.0 5 0.0 6 0.0 7 2.0 8 1.0 9 1.0 10 1.0 11 0.0 12 2.0 13 0.0 14 1.0 15 0.0 16 2.0 17 4.0 18 6.0 19 3.0 20 5.0 21 5.0 22 3.0 23 7.0 24 14.0 25 10.0 26 16.0 27 26.0 28 26.0 29 44.0 30 45.0 31 56.0 32 70.0 33 121.0 34 157.0 35 258.0 36 639.0 37 2456.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.7 19.875 12.1 29.325000000000003 2 30.75 24.3 27.700000000000003 17.25 3 22.475 27.875 27.3 22.35 4 25.05 33.925 20.4 20.625 5 27.325 32.5 20.025000000000002 20.150000000000002 6 23.45 35.625 20.65 20.275000000000002 7 22.925 19.8 35.05 22.225 8 24.05 24.65 23.35 27.950000000000003 9 23.3 24.125 26.6 25.974999999999998 10-14 25.795 26.169999999999998 23.985 24.05 15-19 25.595000000000002 25.724999999999998 25.385 23.294999999999998 20-24 25.605 26.200000000000003 25.074999999999996 23.119999999999997 25-29 25.165 26.695 25.014999999999997 23.125 30-34 25.575 25.85 25.330000000000002 23.244999999999997 35-39 25.95 26.51 24.16 23.380000000000003 40-44 25.295 25.825 25.35 23.53 45-49 25.295 26.22 24.85 23.635 50-54 25.074999999999996 26.369999999999997 25.06 23.494999999999997 55-59 25.7 25.985000000000003 25.040000000000003 23.275000000000002 60-64 25.275 25.825 25.7 23.200000000000003 65-69 25.685000000000002 25.955000000000002 25.430000000000003 22.93 70-74 25.405 26.009999999999998 25.5 23.085 75-79 25.174999999999997 26.290000000000003 25.900000000000002 22.634999999999998 80-84 25.215 26.419999999999998 25.314999999999998 23.05 85-89 25.47 26.405 24.87 23.255 90-94 26.02 26.465 25.115 22.400000000000002 95-99 25.759999999999998 26.490000000000002 25.34 22.41 100-104 25.790000000000003 26.06 25.2 22.95 105-109 25.679999999999996 26.35 25.385 22.585 110-114 25.55 26.529999999999998 24.89 23.03 115-119 25.790000000000003 26.805 25.16 22.245 120-124 26.16 26.235000000000003 25.11 22.495 125-129 25.53 26.66 24.945 22.865 130-134 25.965 26.755000000000003 24.86 22.42 135-139 26.005 26.284999999999997 25.540000000000003 22.17 140-144 26.685 26.345000000000002 25.324999999999996 21.645 145-149 26.25 26.72 24.955 22.075 150-151 26.187500000000004 26.075 25.6125 22.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.0 28 4.5 29 4.0 30 4.0 31 10.0 32 14.0 33 16.5 34 26.5 35 36.0 36 42.5 37 63.0 38 86.5 39 104.0 40 138.0 41 162.0 42 189.5 43 207.5 44 206.0 45 204.0 46 204.5 47 212.5 48 200.5 49 191.0 50 170.5 51 135.5 52 116.5 53 106.0 54 107.5 55 102.5 56 90.5 57 95.0 58 91.5 59 78.5 60 73.5 61 70.0 62 65.0 63 55.0 64 48.5 65 48.0 66 40.0 67 40.0 68 36.5 69 26.5 70 21.5 71 17.0 72 11.5 73 6.5 74 5.0 75 3.5 76 2.5 77 0.5 78 1.0 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21776431995963 98.3 2 0.6560686348725713 1.3 3 0.10093363613424174 0.3 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.2374999999999998 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.3125 0.0 0.0 0.0 0.0 124-125 2.6 0.0 0.0 0.0 0.0 126-127 2.9125 0.0 0.0 0.0 0.0 128-129 3.0999999999999996 0.0 0.0 0.0 0.0 130-131 3.3625 0.0 0.0 0.0 0.0 132-133 3.525 0.0 0.0 0.0 0.0 134-135 3.7625 0.0 0.0 0.0 0.0 136-137 4.2 0.0 0.0 0.0 0.0 138-139 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784049 spots for SRR6958214.sra Written 784049 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra Read 784037 spots for SRR6958214.sra Written 784037 spots for SRR6958214.sra SRR ids: ['SRR6958214.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q5sm8ibu SRR6958214.sra spots: 15680752 blocks: [[1, 784037], [784038, 1568074], [1568075, 2352111], [2352112, 3136148], [3136149, 3920185], [3920186, 4704222], [4704223, 5488259], [5488260, 6272296], [6272297, 7056333], [7056334, 7840370], [7840371, 8624407], [8624408, 9408444], [9408445, 10192481], [10192482, 10976518], [10976519, 11760555], [11760556, 12544592], [12544593, 13328629], [13328630, 14112666], [14112667, 14896703], [14896704, 15680752]] SRR6958214 file size 5291991 SRR6958214 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958214 SRR6958214_1.fastq SRR6958214_2.fastq Input file: SRR6958214_1.fastq Paired file: SRR6958214_2.fastq trimmed: SRR6958214-trimmed-pair1.fastq, SRR6958214-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:52:36 2024 >> started Fri Dec 6 16:52:55 2024 >> done (19.043s) 15680752 read pairs processed; of these: 13097 ( 0.08%) short read pairs filtered out after trimming by size control 11073 ( 0.07%) empty read pairs filtered out after trimming by size control 15656582 (99.85%) read pairs available; of these: 5677212 (36.26%) trimmed read pairs available after processing 9979370 (63.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 6 0.00% 23 0 0.00% 24 5 0.00% 25 6 0.00% 26 3 0.00% 27 4 0.00% 28 1 0.00% 29 3 0.00% 30 3 0.00% 31 5 0.00% 32 9 0.00% 33 5 0.00% 34 4 0.00% 35 4 0.00% 36 7 0.00% 37 8 0.00% 38 3 0.00% 39 6 0.00% 40 5 0.00% 41 10 0.00% 42 8 0.00% 43 6 0.00% 44 11 0.00% 45 5 0.00% 46 9 0.00% 47 15 0.00% 48 15 0.00% 49 20 0.00% 50 15 0.00% 51 23 0.00% 52 22 0.00% 53 35 0.00% 54 37 0.00% 55 44 0.00% 56 40 0.00% 57 41 0.00% 58 32 0.00% 59 53 0.00% 60 70 0.00% 61 83 0.00% 62 88 0.00% 63 107 0.00% 64 119 0.00% 65 124 0.00% 66 125 0.00% 67 154 0.00% 68 173 0.00% 69 205 0.00% 70 225 0.00% 71 313 0.00% 72 331 0.00% 73 367 0.00% 74 426 0.00% 75 432 0.00% 76 521 0.00% 77 575 0.00% 78 686 0.00% 79 761 0.00% 80 828 0.01% 81 967 0.01% 82 1151 0.01% 83 1341 0.01% 84 1991 0.01% 85 2474 0.02% 86 2608 0.02% 87 2679 0.02% 88 2800 0.02% 89 2961 0.02% 90 3226 0.02% 91 3342 0.02% 92 3648 0.02% 93 3966 0.03% 94 4406 0.03% 95 4795 0.03% 96 4954 0.03% 97 5284 0.03% 98 5516 0.04% 99 5829 0.04% 100 6244 0.04% 101 6668 0.04% 102 7415 0.05% 103 7928 0.05% 104 8525 0.05% 105 9097 0.06% 106 9374 0.06% 107 9762 0.06% 108 10240 0.07% 109 10665 0.07% 110 11135 0.07% 111 11890 0.08% 112 12837 0.08% 113 13607 0.09% 114 14258 0.09% 115 15561 0.10% 116 15901 0.10% 117 16587 0.11% 118 16838 0.11% 119 17326 0.11% 120 18124 0.12% 121 18882 0.12% 122 20084 0.13% 123 21570 0.14% 124 22699 0.14% 125 24286 0.16% 126 24947 0.16% 127 25658 0.16% 128 26666 0.17% 129 27299 0.17% 130 28610 0.18% 131 29983 0.19% 132 31672 0.20% 133 33671 0.22% 134 35128 0.22% 135 37399 0.24% 136 39978 0.26% 137 41398 0.26% 138 43585 0.28% 139 46773 0.30% 140 49481 0.32% 141 53248 0.34% 142 59087 0.38% 143 64964 0.41% 144 74367 0.47% 145 86679 0.55% 146 105412 0.67% 147 140121 0.89% 148 212794 1.36% 149 441801 2.82% 150 3487802 22.28% 151 9979370 63.74% 15656582 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=23 prefix-density=0.45 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=229.50 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=12.6 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=24 prefix-density=0.37 prefix-fanout=2.8 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=121.42 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=19.3 sequence=CAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGCGTCGCCAACGGAACCCTCAAGCT SRR6958214 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:53:39 Started mapping on | Dec 06 16:53:39 Finished on | Dec 06 16:55:18 Mapping speed, Million of reads per hour | 569.33 Number of input reads | 15656582 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15084814 Uniquely mapped reads % | 96.35% Average mapped length | 296.89 Number of splices: Total | 18417768 Number of splices: Annotated (sjdb) | 17369721 Number of splices: GT/AG | 18165564 Number of splices: GC/AG | 213111 Number of splices: AT/AC | 7512 Number of splices: Non-canonical | 31581 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 204313 % of reads mapped to multiple loci | 1.30% Number of reads mapped to too many loci | 11390 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.81% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 376508 376508 376508 N_multimapping 204313 204313 204313 N_noFeature 531348 14673364 626349 N_ambiguous 372983 1806 57445 UnstrandedReadsAssigned:14180483 PositiveStrandReadsAssigned:409644 NegativeStrandReadsAssigned:14401020 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958214 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958214-trimmed-pair1.fastq SRR6958214-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,656,582 reads, 14,393,098 reads pseudoaligned [quant] estimated average fragment length: 270.512 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52973 SRR6958214.ke.tsv 35125 SRR6958214.se.tsv 88098 total ==> SRR6958214.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.98 0 0 PNS24247 1044 774.488 41.906 5.58745 PNS24249 1928 1658.49 29.5868 1.84221 PNS24246 1044 774.488 41.906 5.58745 PNS24248 1044 774.488 41.906 5.58745 PNS24244 1471 1201.49 52.6952 4.52902 PNS24243 293 84.0428 0 0 KQK14069 1603 1333.49 2914.99 225.736 KQK14071 474 223.646 38.0492 17.5686 ==> SRR6958214.se.tsv <== BRADI_1g14170v3 3236 BRADI_1g53295v3 1156 BRADI_1g59795v3 114 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 364 BRADI_1g74790v3 96 BRADI_1g09890v3 0 BRADI_1g77505v3 258 BRADI_1g48960v3 0 SRR6958214 completed mapping pipeline successfully