Starting /dee2/code/volunteer_pipeline.sh SRR6958215 current disk space = 1550633496576 free memory = 1323923596 SRR6958215 SRAfilesize b3185694c4235aa24f8c53493f4e4288 SRR6958215.sra SRR6958215.sra file validated SRR6958215 is paired end SRR6958215 is conventional basespace SRR6958215 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958215_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.9445 18.0 18.0 30.0 18.0 33.0 2 24.9885 25.0 18.0 32.0 18.0 33.0 3 29.2785 30.0 27.0 33.0 25.0 33.0 4 28.4595 31.0 27.0 33.0 15.0 33.0 5 30.2615 32.0 31.0 33.0 25.0 33.0 6 33.97025 36.0 33.0 38.0 27.0 38.0 7 35.89075 38.0 36.0 38.0 32.0 38.0 8 36.6155 38.0 37.0 38.0 34.0 38.0 9 36.95625 38.0 38.0 38.0 35.0 38.0 10-14 37.21 38.0 38.0 38.0 36.0 38.0 15-19 37.14125 38.0 38.0 38.0 36.0 38.0 20-24 37.17725 38.0 38.0 38.0 36.2 38.0 25-29 36.99585 38.0 38.0 38.0 35.8 38.0 30-34 36.8076 38.0 38.0 38.0 35.2 38.0 35-39 36.891200000000005 38.0 38.0 38.0 35.4 38.0 40-44 36.8612 38.0 38.0 38.0 35.2 38.0 45-49 36.753550000000004 38.0 38.0 38.0 34.8 38.0 50-54 36.42215 38.0 37.8 38.0 33.8 38.0 55-59 36.39365 38.0 37.8 38.0 33.4 38.0 60-64 36.70925 38.0 38.0 38.0 34.4 38.0 65-69 36.741600000000005 38.0 38.0 38.0 34.4 38.0 70-74 36.3745 38.0 37.6 38.0 33.6 38.0 75-79 36.0637 38.0 37.0 38.0 32.2 38.0 80-84 35.83515 38.0 36.8 38.0 30.8 38.0 85-89 36.1592 38.0 37.0 38.0 32.8 38.0 90-94 35.85695 38.0 36.8 38.0 31.6 38.0 95-99 35.567499999999995 38.0 35.8 38.0 29.8 38.0 100-104 34.89235 38.0 35.0 38.0 26.8 38.0 105-109 34.5686 38.0 34.6 38.0 25.6 38.0 110-114 34.2612 38.0 34.0 38.0 23.8 38.0 115-119 34.2902 38.0 34.0 38.0 24.4 38.0 120-124 34.069500000000005 38.0 34.0 38.0 23.2 38.0 125-129 34.088800000000006 38.0 34.0 38.0 23.6 38.0 130-134 33.85965 38.0 34.0 38.0 22.6 38.0 135-139 33.12949999999999 37.4 33.2 38.0 18.8 38.0 140-144 31.88605 35.8 30.8 38.0 13.8 38.0 145-149 30.3513 35.0 29.4 38.0 8.8 38.0 150-151 26.335250000000002 34.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 0.0 17 1.0 18 2.0 19 2.0 20 0.0 21 7.0 22 7.0 23 11.0 24 11.0 25 22.0 26 36.0 27 54.0 28 63.0 29 80.0 30 93.0 31 101.0 32 173.0 33 228.0 34 336.0 35 595.0 36 1204.0 37 968.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.2478813559322 12.473516949152543 4.872881355932203 43.40572033898305 2 21.625 14.625 26.724999999999998 37.025000000000006 3 22.2 14.625 24.975 38.2 4 29.65 18.85 21.025 30.475 5 25.974999999999998 26.625 23.3 24.099999999999998 6 23.45 32.324999999999996 23.175 21.05 7 19.225 22.95 37.45 20.375 8 20.25 24.175 29.599999999999998 25.974999999999998 9 20.125 20.95 33.425 25.5 10-14 23.47 26.265 25.405 24.86 15-19 22.745 24.625 26.31 26.32 20-24 22.985 24.75 26.150000000000002 26.115 25-29 22.79 25.290000000000003 25.705 26.215 30-34 23.405 24.745 25.91 25.94 35-39 23.255 24.84 25.715 26.19 40-44 23.205000000000002 24.145 26.245 26.405 45-49 23.34 24.625 25.39 26.645000000000003 50-54 23.74 23.865 26.35 26.045 55-59 23.615 24.709999999999997 25.585 26.090000000000003 60-64 23.64 24.54 25.945 25.874999999999996 65-69 23.72 25.5 25.11 25.669999999999998 70-74 23.544999999999998 25.305 25.295 25.855 75-79 23.445 24.44 25.455 26.66 80-84 23.825 24.349999999999998 26.340000000000003 25.485000000000003 85-89 24.025 24.125 26.174999999999997 25.674999999999997 90-94 23.905 24.18 25.535000000000004 26.38 95-99 23.345 25.009999999999998 26.029999999999998 25.615 100-104 24.315 24.01 25.555 26.119999999999997 105-109 24.154999999999998 24.505 25.535000000000004 25.805 110-114 23.75 24.490000000000002 25.845000000000002 25.915 115-119 23.369999999999997 24.169999999999998 25.52 26.939999999999998 120-124 24.185000000000002 24.75 25.224999999999998 25.840000000000003 125-129 23.849999999999998 24.865000000000002 25.435000000000002 25.85 130-134 23.72 24.55 25.845000000000002 25.885 135-139 23.995 24.495 24.97 26.540000000000003 140-144 23.625 24.349999999999998 25.835 26.19 145-149 24.145 24.635 24.935 26.284999999999997 150-151 23.674999999999997 25.074999999999996 25.3125 25.937500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 1.5 28 3.0 29 2.0 30 3.5 31 4.5 32 8.0 33 13.0 34 17.5 35 25.5 36 40.5 37 53.5 38 65.5 39 91.5 40 113.5 41 138.5 42 170.5 43 202.5 44 205.0 45 189.5 46 204.0 47 210.0 48 194.5 49 173.0 50 156.5 51 149.0 52 145.0 53 138.0 54 117.0 55 111.0 56 108.0 57 86.5 58 71.0 59 83.0 60 88.0 61 78.5 62 68.5 63 62.0 64 61.0 65 53.0 66 47.0 67 40.5 68 42.0 69 38.0 70 24.5 71 20.5 72 21.5 73 19.0 74 15.5 75 11.5 76 5.5 77 1.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.6000000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98913318170331 97.925 2 0.9350518069244376 1.8499999999999999 3 0.0758150113722517 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.1749999999999998 0.0 0.0 0.0 0.0 120-121 1.325 0.0 0.0 0.0 0.0 122-123 1.5499999999999998 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 2.125 0.0 0.0 0.0 0.0 128-129 2.4749999999999996 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.9875 0.0 0.0 0.0 0.0 138-139 4.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958215 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958215_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.353 33.0 33.0 34.0 32.0 34.0 2 32.45275 33.0 33.0 34.0 31.0 34.0 3 32.266 33.0 33.0 34.0 31.0 34.0 4 32.197 33.0 33.0 34.0 31.0 34.0 5 32.3815 33.0 33.0 34.0 31.0 34.0 6 36.296 38.0 38.0 38.0 33.0 38.0 7 36.30625 38.0 38.0 38.0 33.0 38.0 8 36.0895 38.0 38.0 38.0 33.0 38.0 9 35.892 38.0 38.0 38.0 31.0 38.0 10-14 36.21169999999999 38.0 38.0 38.0 33.2 38.0 15-19 36.35549999999999 38.0 38.0 38.0 33.8 38.0 20-24 36.4596 38.0 38.0 38.0 34.2 38.0 25-29 36.3389 38.0 38.0 38.0 34.0 38.0 30-34 36.4246 38.0 38.0 38.0 34.6 38.0 35-39 36.2479 38.0 38.0 38.0 33.6 38.0 40-44 36.0091 38.0 37.8 38.0 32.8 38.0 45-49 36.1113 38.0 38.0 38.0 33.2 38.0 50-54 36.07505 38.0 37.8 38.0 32.6 38.0 55-59 36.217600000000004 38.0 38.0 38.0 33.6 38.0 60-64 35.8823 38.0 37.4 38.0 32.0 38.0 65-69 35.6278 38.0 37.0 38.0 30.2 38.0 70-74 35.475350000000006 38.0 37.0 38.0 29.4 38.0 75-79 35.458349999999996 38.0 36.8 38.0 29.8 38.0 80-84 35.3449 38.0 36.6 38.0 29.2 38.0 85-89 35.35765 38.0 36.6 38.0 29.6 38.0 90-94 34.953250000000004 38.0 35.8 38.0 27.8 38.0 95-99 34.4794 38.0 34.8 38.0 25.0 38.0 100-104 34.0519 38.0 34.6 38.0 21.4 38.0 105-109 34.123200000000004 38.0 34.6 38.0 23.2 38.0 110-114 33.74380000000001 38.0 34.0 38.0 21.8 38.0 115-119 32.959199999999996 37.6 32.4 38.0 17.6 38.0 120-124 32.876149999999996 37.8 33.0 38.0 16.2 38.0 125-129 32.15745 37.0 31.6 38.0 14.0 38.0 130-134 31.464099999999995 36.6 30.6 38.0 13.2 38.0 135-139 30.58945 36.0 28.2 38.0 13.0 38.0 140-144 29.850299999999997 35.2 27.0 38.0 8.4 38.0 145-149 27.870399999999997 33.6 20.8 38.0 2.0 38.0 150-151 21.718875 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 11.0 4 4.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 4.0 11 2.0 12 4.0 13 1.0 14 4.0 15 10.0 16 5.0 17 8.0 18 13.0 19 13.0 20 16.0 21 12.0 22 29.0 23 33.0 24 25.0 25 31.0 26 58.0 27 54.0 28 52.0 29 80.0 30 86.0 31 126.0 32 153.0 33 215.0 34 336.0 35 525.0 36 908.0 37 1158.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.59479739869935 18.55927963981991 11.455727863931967 30.390195097548773 2 29.225 23.65 26.125 21.0 3 23.125 27.500000000000004 26.950000000000003 22.425 4 26.35 31.1 19.400000000000002 23.150000000000002 5 27.875 31.574999999999996 19.650000000000002 20.9 6 24.025 35.699999999999996 20.65 19.625 7 23.150000000000002 19.775000000000002 32.15 24.925 8 22.75 23.825 24.9 28.525 9 23.825 23.150000000000002 26.35 26.674999999999997 10-14 25.715 25.645 23.265 25.374999999999996 15-19 25.419999999999998 25.080000000000002 24.610000000000003 24.89 20-24 25.96 26.06 24.044999999999998 23.935000000000002 25-29 26.634999999999998 25.355 24.095 23.915 30-34 26.275 25.674999999999997 23.494999999999997 24.555 35-39 25.874999999999996 26.035000000000004 23.72 24.37 40-44 25.83 25.4 24.404999999999998 24.365000000000002 45-49 26.265 25.355 23.695 24.685000000000002 50-54 26.584999999999997 25.41 24.285 23.72 55-59 26.715 25.115 23.96 24.21 60-64 26.375 25.009999999999998 24.33 24.285 65-69 27.365000000000002 25.005 24.145 23.485 70-74 26.895000000000003 24.81 23.89 24.404999999999998 75-79 26.279999999999998 24.91 24.735 24.075 80-84 26.555 25.27 24.51 23.665 85-89 25.419999999999998 25.19 25.145 24.245 90-94 25.825 24.995 24.565 24.615000000000002 95-99 26.005 25.555 24.585 23.855 100-104 25.655 25.655 24.04 24.65 105-109 25.85 25.85 24.395 23.905 110-114 26.66 26.255 23.635 23.45 115-119 26.555 25.669999999999998 23.544999999999998 24.23 120-124 26.295 25.4 24.93 23.375 125-129 26.755000000000003 25.729999999999997 24.11 23.405 130-134 27.35 25.490000000000002 24.04 23.119999999999997 135-139 27.37 25.650000000000002 24.075 22.905 140-144 26.75 26.040000000000003 24.135 23.075000000000003 145-149 27.61 25.380000000000003 23.73 23.28 150-151 27.175 25.8625 24.125 22.8375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 2.0 27 3.5 28 2.5 29 3.0 30 5.5 31 6.5 32 10.5 33 15.5 34 15.5 35 21.0 36 29.0 37 43.5 38 66.5 39 89.5 40 111.5 41 137.5 42 158.5 43 157.0 44 172.5 45 200.0 46 200.5 47 187.0 48 184.0 49 181.5 50 177.5 51 157.5 52 129.0 53 120.5 54 107.0 55 93.5 56 93.0 57 111.5 58 121.0 59 100.5 60 86.5 61 81.5 62 74.5 63 69.0 64 64.5 65 61.5 66 56.5 67 52.0 68 45.0 69 43.0 70 39.0 71 28.5 72 17.5 73 15.0 74 18.0 75 9.5 76 7.5 77 7.0 78 1.5 79 1.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9873417721519 97.75 2 0.8607594936708861 1.7000000000000002 3 0.0759493670886076 0.22499999999999998 4 0.05063291139240507 0.2 5 0.025316455696202535 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.9874999999999999 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 2.1 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.9124999999999996 0.0 0.0 0.0 0.0 138-139 4.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATGCT 10 0.006830828 145.0 8 >>END_MODULE Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972568 spots for SRR6958215.sra Written 972568 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra Read 972561 spots for SRR6958215.sra Written 972561 spots for SRR6958215.sra SRR ids: ['SRR6958215.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k4_l8sge SRR6958215.sra spots: 19451227 blocks: [[1, 972561], [972562, 1945122], [1945123, 2917683], [2917684, 3890244], [3890245, 4862805], [4862806, 5835366], [5835367, 6807927], [6807928, 7780488], [7780489, 8753049], [8753050, 9725610], [9725611, 10698171], [10698172, 11670732], [11670733, 12643293], [12643294, 13615854], [13615855, 14588415], [14588416, 15560976], [15560977, 16533537], [16533538, 17506098], [17506099, 18478659], [18478660, 19451227]] SRR6958215 file size 6569682 SRR6958215 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958215 SRR6958215_1.fastq SRR6958215_2.fastq Input file: SRR6958215_1.fastq Paired file: SRR6958215_2.fastq trimmed: SRR6958215-trimmed-pair1.fastq, SRR6958215-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:29:30 2024 >> started Fri Dec 6 16:29:55 2024 >> done (24.695s) 19451227 read pairs processed; of these: 26986 ( 0.14%) short read pairs filtered out after trimming by size control 22319 ( 0.11%) empty read pairs filtered out after trimming by size control 19401922 (99.75%) read pairs available; of these: 8540860 (44.02%) trimmed read pairs available after processing 10861062 (55.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 1 0.00% 25 0 0.00% 26 2 0.00% 27 7 0.00% 28 6 0.00% 29 5 0.00% 30 4 0.00% 31 3 0.00% 32 6 0.00% 33 9 0.00% 34 8 0.00% 35 9 0.00% 36 8 0.00% 37 8 0.00% 38 16 0.00% 39 21 0.00% 40 20 0.00% 41 9 0.00% 42 16 0.00% 43 18 0.00% 44 24 0.00% 45 31 0.00% 46 23 0.00% 47 26 0.00% 48 36 0.00% 49 26 0.00% 50 41 0.00% 51 38 0.00% 52 47 0.00% 53 56 0.00% 54 62 0.00% 55 68 0.00% 56 61 0.00% 57 77 0.00% 58 84 0.00% 59 100 0.00% 60 110 0.00% 61 115 0.00% 62 122 0.00% 63 137 0.00% 64 161 0.00% 65 179 0.00% 66 191 0.00% 67 217 0.00% 68 251 0.00% 69 240 0.00% 70 284 0.00% 71 352 0.00% 72 358 0.00% 73 469 0.00% 74 482 0.00% 75 481 0.00% 76 621 0.00% 77 653 0.00% 78 778 0.00% 79 885 0.00% 80 1016 0.01% 81 1153 0.01% 82 1354 0.01% 83 1596 0.01% 84 2600 0.01% 85 3330 0.02% 86 3563 0.02% 87 3511 0.02% 88 3698 0.02% 89 3888 0.02% 90 4140 0.02% 91 4149 0.02% 92 4518 0.02% 93 4957 0.03% 94 5447 0.03% 95 5818 0.03% 96 6103 0.03% 97 6835 0.04% 98 7064 0.04% 99 7699 0.04% 100 8203 0.04% 101 8648 0.04% 102 9411 0.05% 103 10388 0.05% 104 11000 0.06% 105 11662 0.06% 106 12608 0.06% 107 13296 0.07% 108 14130 0.07% 109 15095 0.08% 110 15675 0.08% 111 16750 0.09% 112 18163 0.09% 113 19432 0.10% 114 20522 0.11% 115 22166 0.11% 116 23226 0.12% 117 24498 0.13% 118 25795 0.13% 119 26890 0.14% 120 28097 0.14% 121 29515 0.15% 122 31109 0.16% 123 33136 0.17% 124 35363 0.18% 125 36980 0.19% 126 38964 0.20% 127 41145 0.21% 128 43323 0.22% 129 45609 0.24% 130 47255 0.24% 131 50217 0.26% 132 53479 0.28% 133 56607 0.29% 134 59795 0.31% 135 63107 0.33% 136 67079 0.35% 137 71441 0.37% 138 76471 0.39% 139 81840 0.42% 140 87802 0.45% 141 96539 0.50% 142 107275 0.55% 143 120997 0.62% 144 140633 0.72% 145 168383 0.87% 146 210901 1.09% 147 285096 1.47% 148 433846 2.24% 149 866858 4.47% 150 4613923 23.78% 151 10861062 55.98% 19401922 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=17 prefix-density=0.75 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=144.95 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.2 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=20 prefix-density=0.57 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=74.70 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.8 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958215 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:30:49 Started mapping on | Dec 06 16:30:50 Finished on | Dec 06 16:32:59 Mapping speed, Million of reads per hour | 541.45 Number of input reads | 19401922 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18335577 Uniquely mapped reads % | 94.50% Average mapped length | 295.85 Number of splices: Total | 21240488 Number of splices: Annotated (sjdb) | 19959603 Number of splices: GT/AG | 20944865 Number of splices: GC/AG | 250472 Number of splices: AT/AC | 7430 Number of splices: Non-canonical | 37721 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320958 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 42085 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 1.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 760690 760690 760690 N_multimapping 320958 320958 320958 N_noFeature 632656 17814292 760880 N_ambiguous 461069 2229 68591 UnstrandedReadsAssigned:17241852 PositiveStrandReadsAssigned:519056 NegativeStrandReadsAssigned:17506106 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958215 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958215-trimmed-pair1.fastq SRR6958215-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,401,922 reads, 17,549,017 reads pseudoaligned [quant] estimated average fragment length: 250.149 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR6958215.ke.tsv 35125 SRR6958215.se.tsv 88098 total ==> SRR6958215.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.335 0 0 PNS24247 1044 794.851 55.0401 5.78633 PNS24249 1928 1678.85 54.6276 2.719 PNS24246 1044 794.851 55.0401 5.78633 PNS24248 1044 794.851 55.0401 5.78633 PNS24244 1471 1221.85 27.2522 1.86377 PNS24243 293 86.9313 0 0 KQK14069 1603 1353.85 4939.52 304.876 KQK14071 474 235.022 71.438 25.3998 ==> SRR6958215.se.tsv <== BRADI_1g14170v3 5531 BRADI_1g53295v3 925 BRADI_1g59795v3 65 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 264 BRADI_1g74790v3 91 BRADI_1g09890v3 0 BRADI_1g77505v3 206 BRADI_1g48960v3 0 SRR6958215 completed mapping pipeline successfully