Starting /dee2/code/volunteer_pipeline.sh SRR6958216 current disk space = 1550635888640 free memory = 1603936812 SRR6958216 SRAfilesize 1cb2b079124952ac81eae70b53f05dc3 SRR6958216.sra SRR6958216.sra file validated SRR6958216 is paired end SRR6958216 is conventional basespace SRR6958216 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958216_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.14275 18.0 18.0 25.0 18.0 32.0 2 24.99425 27.0 18.0 29.0 18.0 31.0 3 27.26325 29.0 25.0 31.0 18.0 33.0 4 28.60725 30.0 27.0 33.0 15.0 33.0 5 30.21275 31.0 29.0 33.0 27.0 33.0 6 36.36825 38.0 36.0 38.0 34.0 38.0 7 37.0125 38.0 38.0 38.0 36.0 38.0 8 37.13 38.0 38.0 38.0 36.0 38.0 9 37.25175 38.0 38.0 38.0 36.0 38.0 10-14 37.26395000000001 38.0 38.0 38.0 36.4 38.0 15-19 37.250150000000005 38.0 38.0 38.0 36.6 38.0 20-24 37.3925 38.0 38.0 38.0 37.0 38.0 25-29 37.34115 38.0 38.0 38.0 36.8 38.0 30-34 37.10765 38.0 38.0 38.0 36.0 38.0 35-39 37.1298 38.0 38.0 38.0 36.2 38.0 40-44 36.937200000000004 38.0 38.0 38.0 35.4 38.0 45-49 37.23695 38.0 38.0 38.0 36.2 38.0 50-54 37.103550000000006 38.0 38.0 38.0 35.8 38.0 55-59 36.6088 38.0 37.8 38.0 34.4 38.0 60-64 36.326100000000004 38.0 37.4 38.0 33.4 38.0 65-69 36.060649999999995 38.0 37.0 38.0 31.8 38.0 70-74 36.05355 38.0 37.0 38.0 32.4 38.0 75-79 36.33415000000001 38.0 37.0 38.0 33.6 38.0 80-84 36.325199999999995 38.0 37.4 38.0 33.2 38.0 85-89 35.893550000000005 38.0 36.6 38.0 31.0 38.0 90-94 36.1806 38.0 37.0 38.0 33.2 38.0 95-99 36.02415 38.0 36.6 38.0 32.2 38.0 100-104 35.5004 38.0 36.0 38.0 29.8 38.0 105-109 35.13215 38.0 35.6 38.0 28.2 38.0 110-114 34.4865 38.0 34.6 38.0 25.2 38.0 115-119 33.58055 38.0 33.4 38.0 20.2 38.0 120-124 33.7328 37.8 34.0 38.0 22.2 38.0 125-129 34.155350000000006 38.0 34.0 38.0 24.0 38.0 130-134 34.415800000000004 38.0 34.6 38.0 25.2 38.0 135-139 34.1765 38.0 34.0 38.0 23.8 38.0 140-144 33.45245 38.0 33.8 38.0 20.2 38.0 145-149 31.760550000000002 36.8 32.0 38.0 11.4 38.0 150-151 26.770125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 2.0 18 1.0 19 3.0 20 4.0 21 4.0 22 5.0 23 6.0 24 14.0 25 16.0 26 19.0 27 25.0 28 39.0 29 52.0 30 86.0 31 121.0 32 170.0 33 216.0 34 330.0 35 631.0 36 1194.0 37 1061.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.2420591456736 17.332968236582694 7.0098576122672505 42.41511500547645 2 21.099999999999998 15.125 29.925 33.85 3 20.674999999999997 20.025000000000002 23.175 36.125 4 24.125 26.900000000000002 20.325 28.65 5 23.71056584877316 29.894842263395095 23.460190285428144 22.934401602403607 6 22.375 32.75 23.925 20.95 7 17.599999999999998 23.275000000000002 39.725 19.400000000000002 8 19.900000000000002 23.549999999999997 28.449999999999996 28.1 9 18.9 21.224999999999998 34.075 25.8 10-14 22.73 25.95 26.0 25.319999999999997 15-19 22.5 25.61 26.375 25.515 20-24 22.384999999999998 25.569999999999997 26.88 25.165 25-29 22.52 25.885 26.435 25.16 30-34 22.075 26.009999999999998 25.990000000000002 25.924999999999997 35-39 22.395 26.415 25.83 25.36 40-44 22.91 26.115 25.695 25.28 45-49 22.134999999999998 25.779999999999998 26.515 25.569999999999997 50-54 23.205000000000002 25.495 26.105 25.195 55-59 22.355 25.595000000000002 26.35 25.7 60-64 22.49 25.915 26.085 25.509999999999998 65-69 22.689999999999998 25.779999999999998 25.83 25.7 70-74 22.98 25.09 26.41 25.52 75-79 22.884999999999998 25.15 26.355 25.61 80-84 23.16 25.83 26.305 24.705 85-89 22.48 25.53 26.279999999999998 25.71 90-94 23.28 25.790000000000003 26.115 24.815 95-99 22.81 25.174999999999997 25.88 26.135 100-104 22.91 25.355 26.415 25.319999999999997 105-109 22.765 25.695 26.419999999999998 25.119999999999997 110-114 23.150000000000002 25.115 26.36 25.374999999999996 115-119 22.935 25.615 25.635 25.814999999999998 120-124 23.13 25.735000000000003 25.430000000000003 25.705 125-129 22.845 25.619999999999997 25.974999999999998 25.56 130-134 23.74 25.695 25.97 24.595 135-139 23.244999999999997 25.235000000000003 26.340000000000003 25.180000000000003 140-144 22.830000000000002 25.655 26.009999999999998 25.505 145-149 23.405 25.165 25.96 25.47 150-151 23.5125 25.15 26.05 25.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.0 28 3.0 29 4.5 30 9.0 31 13.0 32 11.0 33 18.0 34 24.5 35 30.0 36 45.0 37 60.0 38 86.0 39 116.0 40 135.5 41 162.0 42 181.0 43 200.5 44 224.0 45 231.5 46 228.0 47 220.0 48 219.5 49 203.5 50 183.5 51 156.0 52 121.5 53 109.5 54 104.0 55 103.0 56 90.5 57 72.0 58 66.5 59 62.0 60 57.0 61 63.5 62 56.5 63 40.5 64 38.0 65 37.0 66 37.0 67 42.5 68 36.0 69 21.0 70 19.0 71 17.0 72 13.0 73 9.5 74 5.0 75 3.0 76 2.5 77 1.0 78 1.0 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.7 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.65 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.4625 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.0250000000000004 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCAGG 10 0.0051850425 158.80821 1 >>END_MODULE SRR6958216 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958216_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.882 33.0 33.0 34.0 32.0 34.0 2 32.89775 33.0 33.0 34.0 32.0 34.0 3 32.85975 34.0 33.0 34.0 32.0 34.0 4 32.8295 34.0 33.0 34.0 32.0 34.0 5 32.96325 34.0 33.0 34.0 32.0 34.0 6 37.116 38.0 38.0 38.0 36.0 38.0 7 36.77275 38.0 38.0 38.0 35.0 38.0 8 36.87975 38.0 38.0 38.0 35.0 38.0 9 36.869 38.0 38.0 38.0 36.0 38.0 10-14 36.8795 38.0 38.0 38.0 35.6 38.0 15-19 36.98125 38.0 38.0 38.0 36.0 38.0 20-24 37.00945 38.0 38.0 38.0 36.0 38.0 25-29 36.92735 38.0 38.0 38.0 36.0 38.0 30-34 36.7244 38.0 38.0 38.0 35.2 38.0 35-39 36.7546 38.0 38.0 38.0 35.0 38.0 40-44 36.6327 38.0 38.0 38.0 34.8 38.0 45-49 36.6946 38.0 38.0 38.0 35.0 38.0 50-54 36.484 38.0 38.0 38.0 34.2 38.0 55-59 36.6657 38.0 38.0 38.0 34.8 38.0 60-64 36.5007 38.0 38.0 38.0 34.0 38.0 65-69 36.5107 38.0 38.0 38.0 34.0 38.0 70-74 36.412099999999995 38.0 38.0 38.0 34.0 38.0 75-79 36.2545 38.0 37.6 38.0 33.6 38.0 80-84 36.058400000000006 38.0 37.2 38.0 33.0 38.0 85-89 36.07505 38.0 37.4 38.0 33.4 38.0 90-94 36.152100000000004 38.0 37.4 38.0 33.8 38.0 95-99 35.90605 38.0 37.0 38.0 32.2 38.0 100-104 35.40095 38.0 36.2 38.0 30.2 38.0 105-109 34.92505 38.0 35.6 38.0 27.4 38.0 110-114 34.420550000000006 38.0 35.0 38.0 24.0 38.0 115-119 34.29115 38.0 34.4 38.0 24.0 38.0 120-124 34.153549999999996 38.0 34.4 38.0 23.2 38.0 125-129 33.3032 38.0 33.4 38.0 17.8 38.0 130-134 32.5179 37.0 32.2 38.0 14.8 38.0 135-139 31.3858 35.8 29.0 38.0 14.0 38.0 140-144 30.94715 35.4 29.2 38.0 13.6 38.0 145-149 30.602700000000006 36.0 30.4 38.0 8.6 38.0 150-151 25.864125 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 2.0 5 1.0 6 1.0 7 1.0 8 0.0 9 2.0 10 2.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 12.0 17 4.0 18 5.0 19 4.0 20 12.0 21 8.0 22 11.0 23 9.0 24 25.0 25 18.0 26 29.0 27 37.0 28 45.0 29 70.0 30 81.0 31 86.0 32 151.0 33 194.0 34 257.0 35 514.0 36 921.0 37 1486.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.375 18.15 12.325 32.15 2 29.45 24.325 26.75 19.475 3 23.325000000000003 26.924999999999997 26.825 22.925 4 25.874999999999996 32.15 18.975 23.0 5 26.900000000000002 33.800000000000004 19.55 19.75 6 23.075000000000003 36.475 19.325 21.125 7 22.625 19.3 35.3 22.775000000000002 8 24.9 23.7 23.1 28.299999999999997 9 23.3 23.3 27.925 25.474999999999998 10-14 25.52 26.58 23.715 24.185000000000002 15-19 25.705 25.580000000000002 25.115 23.599999999999998 20-24 26.16 25.840000000000003 24.64 23.36 25-29 25.735000000000003 26.450000000000003 24.345 23.47 30-34 25.15 25.874999999999996 24.975 24.0 35-39 25.505 25.89 24.92 23.685000000000002 40-44 25.929999999999996 25.929999999999996 24.525 23.615 45-49 25.115 25.865 25.505 23.515 50-54 25.564999999999998 25.915 24.785 23.735 55-59 25.655 25.895000000000003 25.15 23.3 60-64 25.755 25.765 25.285000000000004 23.195 65-69 25.380000000000003 25.990000000000002 25.245 23.385 70-74 26.200000000000003 25.85 24.7 23.25 75-79 25.45 26.150000000000002 25.069999999999997 23.330000000000002 80-84 25.19 26.195 25.35 23.265 85-89 25.89 25.874999999999996 24.925 23.31 90-94 25.52 26.25 25.335 22.895 95-99 25.735000000000003 25.96 25.135 23.169999999999998 100-104 26.07 26.0 25.1 22.830000000000002 105-109 25.259999999999998 26.384999999999998 24.985 23.369999999999997 110-114 26.35 26.174999999999997 24.525 22.95 115-119 25.91 26.279999999999998 24.34 23.47 120-124 25.805 26.26 25.28 22.655 125-129 25.735000000000003 26.55 24.82 22.895 130-134 26.105 26.135 25.595000000000002 22.165000000000003 135-139 25.865 26.284999999999997 25.2 22.650000000000002 140-144 26.724999999999998 26.640000000000004 24.66 21.975 145-149 26.505000000000003 26.205000000000002 25.14 22.15 150-151 27.1125 25.4625 25.1 22.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.0 27 4.5 28 6.0 29 4.0 30 7.0 31 10.5 32 13.0 33 16.5 34 17.5 35 33.0 36 48.0 37 56.5 38 66.5 39 91.5 40 126.5 41 149.5 42 171.5 43 191.5 44 214.0 45 222.5 46 211.0 47 201.0 48 192.0 49 190.0 50 172.5 51 142.5 52 131.0 53 126.5 54 122.0 55 107.5 56 95.0 57 95.0 58 76.5 59 55.5 60 58.5 61 70.0 62 72.0 63 66.5 64 57.0 65 46.5 66 42.0 67 39.0 68 35.5 69 30.5 70 28.0 71 24.5 72 18.5 73 14.0 74 11.5 75 6.5 76 2.5 77 2.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19253091092607 98.275 2 0.6813020439061317 1.35 3 0.12616704516780217 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.6000000000000001 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.3250000000000002 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.6375000000000002 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 3.0250000000000004 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTAC 10 0.006830828 145.0 5 TCATGCA 10 0.006830828 145.0 8 >>END_MODULE Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925338 spots for SRR6958216.sra Written 925338 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra Read 925334 spots for SRR6958216.sra Written 925334 spots for SRR6958216.sra SRR ids: ['SRR6958216.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zd_uwv50 SRR6958216.sra spots: 18506684 blocks: [[1, 925334], [925335, 1850668], [1850669, 2776002], [2776003, 3701336], [3701337, 4626670], [4626671, 5552004], [5552005, 6477338], [6477339, 7402672], [7402673, 8328006], [8328007, 9253340], [9253341, 10178674], [10178675, 11104008], [11104009, 12029342], [12029343, 12954676], [12954677, 13880010], [13880011, 14805344], [14805345, 15730678], [15730679, 16656012], [16656013, 17581346], [17581347, 18506684]] SRR6958216 file size 6249607 SRR6958216 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958216 SRR6958216_1.fastq SRR6958216_2.fastq Input file: SRR6958216_1.fastq Paired file: SRR6958216_2.fastq trimmed: SRR6958216-trimmed-pair1.fastq, SRR6958216-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:30:37 2024 >> started Fri Dec 6 16:31:00 2024 >> done (22.470s) 18506684 read pairs processed; of these: 16169 ( 0.09%) short read pairs filtered out after trimming by size control 12701 ( 0.07%) empty read pairs filtered out after trimming by size control 18477814 (99.84%) read pairs available; of these: 7557098 (40.90%) trimmed read pairs available after processing 10920716 (59.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 5 0.00% 21 1 0.00% 22 3 0.00% 23 4 0.00% 24 5 0.00% 25 6 0.00% 26 3 0.00% 27 5 0.00% 28 2 0.00% 29 5 0.00% 30 9 0.00% 31 4 0.00% 32 8 0.00% 33 3 0.00% 34 8 0.00% 35 13 0.00% 36 8 0.00% 37 9 0.00% 38 7 0.00% 39 12 0.00% 40 17 0.00% 41 17 0.00% 42 10 0.00% 43 15 0.00% 44 20 0.00% 45 18 0.00% 46 19 0.00% 47 23 0.00% 48 24 0.00% 49 19 0.00% 50 27 0.00% 51 33 0.00% 52 32 0.00% 53 36 0.00% 54 40 0.00% 55 56 0.00% 56 44 0.00% 57 52 0.00% 58 78 0.00% 59 70 0.00% 60 91 0.00% 61 84 0.00% 62 106 0.00% 63 136 0.00% 64 131 0.00% 65 136 0.00% 66 150 0.00% 67 182 0.00% 68 191 0.00% 69 226 0.00% 70 256 0.00% 71 319 0.00% 72 339 0.00% 73 381 0.00% 74 435 0.00% 75 510 0.00% 76 612 0.00% 77 630 0.00% 78 716 0.00% 79 762 0.00% 80 858 0.00% 81 993 0.01% 82 1193 0.01% 83 1399 0.01% 84 2172 0.01% 85 2634 0.01% 86 2679 0.01% 87 2959 0.02% 88 2984 0.02% 89 3166 0.02% 90 3444 0.02% 91 3603 0.02% 92 3898 0.02% 93 4287 0.02% 94 4624 0.03% 95 4954 0.03% 96 5295 0.03% 97 5662 0.03% 98 5940 0.03% 99 6232 0.03% 100 6893 0.04% 101 7410 0.04% 102 8086 0.04% 103 8862 0.05% 104 9159 0.05% 105 9994 0.05% 106 10460 0.06% 107 11051 0.06% 108 11578 0.06% 109 12328 0.07% 110 12659 0.07% 111 13918 0.08% 112 14851 0.08% 113 15583 0.08% 114 16939 0.09% 115 18224 0.10% 116 18808 0.10% 117 20087 0.11% 118 20647 0.11% 119 21610 0.12% 120 22463 0.12% 121 23895 0.13% 122 25337 0.14% 123 27202 0.15% 124 28801 0.16% 125 30610 0.17% 126 32192 0.17% 127 34000 0.18% 128 35257 0.19% 129 36804 0.20% 130 39301 0.21% 131 41453 0.22% 132 45085 0.24% 133 48294 0.26% 134 52365 0.28% 135 56801 0.31% 136 61855 0.33% 137 65997 0.36% 138 71899 0.39% 139 78816 0.43% 140 87105 0.47% 141 94770 0.51% 142 105931 0.57% 143 114868 0.62% 144 124695 0.67% 145 142881 0.77% 146 168468 0.91% 147 233230 1.26% 148 376356 2.04% 149 802485 4.34% 150 4102590 22.20% 151 10920716 59.10% 18477814 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=38.52 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=23 prefix-density=0.41 prefix-fanout=3.0 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=34.96 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=6.9 sequence=CAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCACATTAGTGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGACTTTGGGCCGGGTCGGCCGGTCCGCCTCACGGCGAGCACCGACCTACTCGACCCTTCAGCCGGCGATGCGCTCCTAGCCTTAATTGGCCGGGTCGTGCCTCCGGCATCGTTACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCATCGCTCTGGATACATTAGCATGGGATAACATCATAGGATTCCGGTCCTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTAATAGGGACAGTCGGGGGCATTCGTATTTCATAGTCAGAGGTGAAATTCTTGGATTTATGAAA SRR6958216 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:31:45 Started mapping on | Dec 06 16:31:45 Finished on | Dec 06 16:33:22 Mapping speed, Million of reads per hour | 685.77 Number of input reads | 18477814 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17563144 Uniquely mapped reads % | 95.05% Average mapped length | 296.64 Number of splices: Total | 20928727 Number of splices: Annotated (sjdb) | 19784326 Number of splices: GT/AG | 20648873 Number of splices: GC/AG | 246711 Number of splices: AT/AC | 8555 Number of splices: Non-canonical | 24588 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291297 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 55150 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 1.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 633294 633294 633294 N_multimapping 291297 291297 291297 N_noFeature 659987 17103147 784444 N_ambiguous 402646 2161 68894 UnstrandedReadsAssigned:16500511 PositiveStrandReadsAssigned:457836 NegativeStrandReadsAssigned:16709806 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958216 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958216-trimmed-pair1.fastq SRR6958216-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,477,814 reads, 16,776,614 reads pseudoaligned [quant] estimated average fragment length: 267.386 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR6958216.ke.tsv 35125 SRR6958216.se.tsv 88098 total ==> SRR6958216.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.172 0 0 PNS24247 1044 777.614 54.3778 6.226 PNS24249 1928 1661.61 34.7853 1.86388 PNS24246 1044 777.614 54.3778 6.226 PNS24248 1044 777.614 54.3778 6.226 PNS24244 1471 1204.61 32.0813 2.37113 PNS24243 293 81.9657 0 0 KQK14069 1603 1336.61 2966.18 197.58 KQK14071 474 222.33 57.3609 22.9704 ==> SRR6958216.se.tsv <== BRADI_1g14170v3 3355 BRADI_1g53295v3 260 BRADI_1g59795v3 227 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 303 BRADI_1g74790v3 98 BRADI_1g09890v3 0 BRADI_1g77505v3 254 BRADI_1g48960v3 0 SRR6958216 completed mapping pipeline successfully