Starting /dee2/code/volunteer_pipeline.sh SRR6958217 current disk space = 1550637694976 free memory = 1603266356 SRR6958217 SRAfilesize 541aee288184ccc0cce4086df8c1c98c SRR6958217.sra SRR6958217.sra file validated SRR6958217 is paired end SRR6958217 is conventional basespace SRR6958217 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958217_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.689 32.0 27.0 33.0 18.0 33.0 2 29.55525 31.0 28.0 33.0 18.0 33.0 3 31.26625 33.0 31.0 33.0 27.0 33.0 4 30.313 32.0 31.0 33.0 25.0 33.0 5 31.1245 33.0 32.0 33.0 27.0 33.0 6 35.96875 38.0 36.0 38.0 33.0 38.0 7 36.69075 38.0 37.0 38.0 34.0 38.0 8 37.175 38.0 38.0 38.0 36.0 38.0 9 37.223 38.0 38.0 38.0 36.0 38.0 10-14 37.22955 38.0 38.0 38.0 36.6 38.0 15-19 37.1683 38.0 38.0 38.0 36.0 38.0 20-24 37.29645000000001 38.0 38.0 38.0 36.8 38.0 25-29 37.1593 38.0 38.0 38.0 36.2 38.0 30-34 37.03235000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.9232 38.0 38.0 38.0 35.6 38.0 40-44 36.86475 38.0 38.0 38.0 35.2 38.0 45-49 36.97185 38.0 38.0 38.0 35.8 38.0 50-54 36.92410000000001 38.0 38.0 38.0 35.4 38.0 55-59 36.6673 38.0 38.0 38.0 34.2 38.0 60-64 36.6451 38.0 38.0 38.0 34.2 38.0 65-69 36.62975 38.0 38.0 38.0 34.2 38.0 70-74 36.7251 38.0 38.0 38.0 34.2 38.0 75-79 36.516149999999996 38.0 37.8 38.0 34.0 38.0 80-84 36.1851 38.0 37.2 38.0 33.2 38.0 85-89 36.03415 38.0 37.0 38.0 32.0 38.0 90-94 36.214099999999995 38.0 37.0 38.0 33.0 38.0 95-99 36.09895 38.0 37.0 38.0 32.8 38.0 100-104 35.91245 38.0 37.0 38.0 31.8 38.0 105-109 35.60925 38.0 36.0 38.0 30.8 38.0 110-114 35.4728 38.0 36.0 38.0 29.8 38.0 115-119 35.412 38.0 36.0 38.0 29.4 38.0 120-124 35.189800000000005 38.0 35.4 38.0 28.8 38.0 125-129 34.7206 38.0 35.0 38.0 27.0 38.0 130-134 34.4448 38.0 34.6 38.0 25.4 38.0 135-139 34.183350000000004 38.0 34.4 38.0 23.2 38.0 140-144 33.7386 38.0 33.8 38.0 21.0 38.0 145-149 32.5404 37.6 33.0 38.0 14.0 38.0 150-151 28.482750000000003 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 0.0 18 2.0 19 1.0 20 3.0 21 2.0 22 5.0 23 7.0 24 11.0 25 20.0 26 15.0 27 38.0 28 35.0 29 63.0 30 63.0 31 91.0 32 114.0 33 154.0 34 280.0 35 449.0 36 955.0 37 1687.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.05081248387929 9.491875161207119 9.05339179778179 42.403920557131805 2 23.625 11.225 35.475 29.675 3 20.3 14.674999999999999 25.95 39.074999999999996 4 25.45 21.4 24.325 28.825 5 26.875 25.7 25.174999999999997 22.25 6 22.225 31.6 24.6 21.575 7 17.849999999999998 23.225 40.6 18.325 8 19.725 23.375 30.575000000000003 26.325 9 19.775000000000002 21.525 34.449999999999996 24.25 10-14 22.82 26.5 26.035000000000004 24.645 15-19 22.770000000000003 24.895 26.745 25.590000000000003 20-24 22.725 25.765 26.085 25.424999999999997 25-29 22.57 25.2 26.43 25.8 30-34 22.52 25.205 26.700000000000003 25.575 35-39 23.275000000000002 25.259999999999998 26.090000000000003 25.374999999999996 40-44 22.465 25.814999999999998 26.369999999999997 25.35 45-49 22.564999999999998 25.330000000000002 26.47 25.635 50-54 22.79 24.884999999999998 26.44 25.885 55-59 23.544999999999998 25.224999999999998 26.02 25.21 60-64 22.8 25.195 26.295 25.71 65-69 23.485 25.09 26.450000000000003 24.975 70-74 23.265 25.629999999999995 25.869999999999997 25.235000000000003 75-79 23.25 25.840000000000003 25.77 25.14 80-84 23.02 25.395 26.14 25.445 85-89 23.405 25.275 25.715 25.605 90-94 23.52 24.93 26.235000000000003 25.314999999999998 95-99 23.369999999999997 24.815 26.205000000000002 25.61 100-104 23.75 24.915000000000003 26.169999999999998 25.165 105-109 23.615 24.560000000000002 26.19 25.635 110-114 23.845 24.605 26.0 25.55 115-119 23.3 24.795 26.095000000000002 25.81 120-124 23.005 24.965 25.94 26.090000000000003 125-129 23.745 25.85 24.79 25.615 130-134 23.695 24.845 25.745 25.715 135-139 23.674999999999997 25.019999999999996 25.715 25.590000000000003 140-144 23.375 25.82 25.130000000000003 25.674999999999997 145-149 23.86 25.215 25.245 25.679999999999996 150-151 23.40585146286572 24.431107776944234 26.44411102775694 25.71892973243311 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.5 27 3.0 28 1.5 29 4.5 30 5.5 31 4.5 32 9.5 33 15.0 34 19.0 35 27.5 36 45.0 37 62.0 38 88.0 39 119.0 40 135.0 41 159.5 42 180.0 43 194.5 44 209.5 45 221.5 46 223.0 47 218.0 48 210.0 49 192.5 50 176.5 51 158.5 52 141.0 53 122.5 54 103.0 55 90.0 56 79.5 57 69.5 58 66.0 59 65.0 60 67.0 61 66.0 62 60.0 63 52.5 64 53.5 65 48.5 66 42.0 67 39.5 68 29.0 69 22.0 70 18.0 71 18.5 72 16.0 73 10.5 74 11.5 75 12.0 76 6.0 77 1.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8619119878604 97.725 2 1.112797167425392 2.1999999999999997 3 0.025290844714213456 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.1375000000000002 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 1.9875 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.45 0.0 0.0 0.0 0.0 136-137 2.8875 0.0 0.0 0.0 0.0 138-139 3.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGAAT 10 0.0068343505 144.975 5 >>END_MODULE SRR6958217 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958217_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84125 33.0 33.0 34.0 32.0 34.0 2 32.7565 33.0 33.0 34.0 32.0 34.0 3 32.8025 33.0 33.0 34.0 32.0 34.0 4 32.73075 33.0 33.0 34.0 32.0 34.0 5 32.761 33.0 33.0 34.0 32.0 34.0 6 36.938 38.0 38.0 38.0 35.0 38.0 7 36.791 38.0 38.0 38.0 35.0 38.0 8 36.7385 38.0 38.0 38.0 35.0 38.0 9 36.63975 38.0 38.0 38.0 35.0 38.0 10-14 36.64019999999999 38.0 38.0 38.0 34.6 38.0 15-19 36.50664999999999 38.0 38.0 38.0 34.0 38.0 20-24 36.69505 38.0 38.0 38.0 34.6 38.0 25-29 36.791250000000005 38.0 38.0 38.0 35.2 38.0 30-34 36.834450000000004 38.0 38.0 38.0 35.6 38.0 35-39 36.78355 38.0 38.0 38.0 35.0 38.0 40-44 36.69455 38.0 38.0 38.0 34.8 38.0 45-49 36.54965 38.0 38.0 38.0 34.2 38.0 50-54 36.57619999999999 38.0 38.0 38.0 34.2 38.0 55-59 36.59465 38.0 38.0 38.0 34.0 38.0 60-64 36.58194999999999 38.0 38.0 38.0 34.0 38.0 65-69 36.343050000000005 38.0 38.0 38.0 33.4 38.0 70-74 36.21655 38.0 37.6 38.0 33.4 38.0 75-79 36.1111 38.0 37.4 38.0 33.0 38.0 80-84 35.9863 38.0 37.0 38.0 32.6 38.0 85-89 35.8894 38.0 37.0 38.0 32.0 38.0 90-94 35.73495 38.0 36.6 38.0 31.0 38.0 95-99 35.71125 38.0 37.0 38.0 31.0 38.0 100-104 35.51755 38.0 36.0 38.0 30.0 38.0 105-109 35.239650000000005 38.0 36.0 38.0 28.8 38.0 110-114 34.70975 38.0 35.0 38.0 26.0 38.0 115-119 34.74055 38.0 35.0 38.0 26.6 38.0 120-124 34.36305 38.0 35.0 38.0 24.2 38.0 125-129 34.153400000000005 38.0 34.4 38.0 23.4 38.0 130-134 33.8609 38.0 34.0 38.0 22.6 38.0 135-139 33.371300000000005 38.0 34.0 38.0 19.8 38.0 140-144 32.830400000000004 38.0 33.0 38.0 15.4 38.0 145-149 32.141200000000005 38.0 32.2 38.0 11.2 38.0 150-151 26.8005 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 3.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 2.0 14 0.0 15 2.0 16 7.0 17 2.0 18 3.0 19 4.0 20 13.0 21 5.0 22 11.0 23 6.0 24 15.0 25 21.0 26 34.0 27 41.0 28 55.0 29 74.0 30 76.0 31 98.0 32 115.0 33 179.0 34 254.0 35 373.0 36 764.0 37 1830.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.65 16.525000000000002 14.45 36.375 2 29.171878909181885 23.967975981986488 27.09532149111834 19.764823617713283 3 23.078848560700877 25.306633291614517 26.933667083854818 24.680851063829788 4 24.962443665498245 29.84476715072609 21.4321482223335 23.760640961442164 5 28.743114672008012 32.22333500250375 18.828242363545318 20.205307961942914 6 23.225 36.1 20.7 19.975 7 21.775 20.150000000000002 34.8 23.275000000000002 8 23.974999999999998 23.65 25.874999999999996 26.5 9 23.775 23.05 27.975 25.2 10-14 26.025 26.0 23.575 24.4 15-19 25.61 25.105 25.115 24.169999999999998 20-24 26.005 26.279999999999998 24.055 23.66 25-29 26.295 25.619999999999997 24.095 23.990000000000002 30-34 26.009999999999998 25.91 24.18 23.9 35-39 25.865 25.905 24.04 24.19 40-44 25.535000000000004 25.424999999999997 24.95 24.09 45-49 26.040000000000003 25.6 24.23 24.13 50-54 25.929999999999996 25.31 24.965 23.794999999999998 55-59 25.45 25.040000000000003 25.105 24.404999999999998 60-64 25.945 25.64 25.105 23.31 65-69 25.790000000000003 25.91 24.65 23.65 70-74 25.965 25.619999999999997 24.705 23.71 75-79 25.86 25.795 24.79 23.555 80-84 25.85 26.21 23.91 24.03 85-89 25.6 25.580000000000002 24.93 23.89 90-94 25.785000000000004 25.455 24.775 23.985 95-99 25.735000000000003 25.885 24.759999999999998 23.62 100-104 25.405 25.545 25.119999999999997 23.93 105-109 25.124999999999996 25.635 24.93 24.310000000000002 110-114 25.945 25.705 24.79 23.56 115-119 26.125 25.929999999999996 24.43 23.515 120-124 25.985000000000003 26.155 24.51 23.35 125-129 26.14 26.119999999999997 24.15 23.59 130-134 25.995 26.66 24.175 23.169999999999998 135-139 25.85 25.71 25.22 23.22 140-144 26.27 26.479999999999997 24.560000000000002 22.689999999999998 145-149 26.179999999999996 26.695 24.215 22.91 150-151 26.76919229807452 25.506376594148538 24.668667166791696 23.055763940985248 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 1.0 27 2.0 28 3.5 29 4.5 30 4.0 31 6.5 32 10.0 33 18.0 34 24.0 35 32.5 36 37.5 37 41.0 38 59.0 39 88.0 40 130.0 41 163.0 42 174.5 43 181.0 44 204.0 45 215.0 46 213.5 47 208.5 48 184.0 49 157.0 50 142.0 51 137.0 52 133.0 53 118.0 54 112.0 55 111.0 56 94.5 57 93.0 58 95.0 59 84.0 60 76.0 61 72.5 62 77.5 63 71.0 64 58.0 65 52.0 66 46.0 67 45.0 68 39.5 69 44.0 70 41.0 71 26.5 72 21.5 73 16.0 74 11.5 75 7.0 76 3.0 77 2.5 78 2.0 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.125 4 0.15 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98785425101214 97.8 2 0.9362348178137652 1.8499999999999999 3 0.05060728744939271 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025303643724696356 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.1124999999999998 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.5125 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.4 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119585 spots for SRR6958217.sra Written 1119585 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra Read 1119577 spots for SRR6958217.sra Written 1119577 spots for SRR6958217.sra SRR ids: ['SRR6958217.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fep6h975 SRR6958217.sra spots: 22391548 blocks: [[1, 1119577], [1119578, 2239154], [2239155, 3358731], [3358732, 4478308], [4478309, 5597885], [5597886, 6717462], [6717463, 7837039], [7837040, 8956616], [8956617, 10076193], [10076194, 11195770], [11195771, 12315347], [12315348, 13434924], [13434925, 14554501], [14554502, 15674078], [15674079, 16793655], [16793656, 17913232], [17913233, 19032809], [19032810, 20152386], [20152387, 21271963], [21271964, 22391548]] SRR6958217 file size 7566060 SRR6958217 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958217 SRR6958217_1.fastq SRR6958217_2.fastq Input file: SRR6958217_1.fastq Paired file: SRR6958217_2.fastq trimmed: SRR6958217-trimmed-pair1.fastq, SRR6958217-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:31:47 2024 >> started Fri Dec 6 16:32:10 2024 >> done (23.002s) 22391548 read pairs processed; of these: 13295 ( 0.06%) short read pairs filtered out after trimming by size control 10063 ( 0.04%) empty read pairs filtered out after trimming by size control 22368190 (99.90%) read pairs available; of these: 8371114 (37.42%) trimmed read pairs available after processing 13997076 (62.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 3 0.00% 24 3 0.00% 25 6 0.00% 26 5 0.00% 27 6 0.00% 28 9 0.00% 29 6 0.00% 30 8 0.00% 31 9 0.00% 32 10 0.00% 33 12 0.00% 34 11 0.00% 35 16 0.00% 36 8 0.00% 37 12 0.00% 38 10 0.00% 39 19 0.00% 40 11 0.00% 41 15 0.00% 42 18 0.00% 43 15 0.00% 44 19 0.00% 45 17 0.00% 46 18 0.00% 47 21 0.00% 48 25 0.00% 49 28 0.00% 50 35 0.00% 51 36 0.00% 52 42 0.00% 53 47 0.00% 54 60 0.00% 55 64 0.00% 56 66 0.00% 57 73 0.00% 58 75 0.00% 59 75 0.00% 60 107 0.00% 61 108 0.00% 62 114 0.00% 63 145 0.00% 64 164 0.00% 65 193 0.00% 66 178 0.00% 67 205 0.00% 68 241 0.00% 69 270 0.00% 70 265 0.00% 71 358 0.00% 72 360 0.00% 73 483 0.00% 74 502 0.00% 75 522 0.00% 76 600 0.00% 77 610 0.00% 78 735 0.00% 79 864 0.00% 80 941 0.00% 81 1056 0.00% 82 1153 0.01% 83 1337 0.01% 84 2063 0.01% 85 2586 0.01% 86 2780 0.01% 87 3037 0.01% 88 3075 0.01% 89 3359 0.02% 90 3422 0.02% 91 3543 0.02% 92 3860 0.02% 93 4072 0.02% 94 4602 0.02% 95 5278 0.02% 96 4860 0.02% 97 5551 0.02% 98 5797 0.03% 99 6298 0.03% 100 6677 0.03% 101 7104 0.03% 102 7613 0.03% 103 8155 0.04% 104 8571 0.04% 105 9137 0.04% 106 9981 0.04% 107 10674 0.05% 108 11068 0.05% 109 12069 0.05% 110 12622 0.06% 111 13456 0.06% 112 14567 0.07% 113 15696 0.07% 114 16272 0.07% 115 17257 0.08% 116 18140 0.08% 117 19195 0.09% 118 20658 0.09% 119 21275 0.10% 120 22393 0.10% 121 23586 0.11% 122 24504 0.11% 123 26398 0.12% 124 27438 0.12% 125 29213 0.13% 126 30488 0.14% 127 32574 0.15% 128 34389 0.15% 129 36405 0.16% 130 38201 0.17% 131 40573 0.18% 132 43288 0.19% 133 46919 0.21% 134 49462 0.22% 135 52799 0.24% 136 56489 0.25% 137 60942 0.27% 138 64823 0.29% 139 71469 0.32% 140 77353 0.35% 141 85547 0.38% 142 95935 0.43% 143 109796 0.49% 144 129209 0.58% 145 157909 0.71% 146 199285 0.89% 147 276252 1.24% 148 429018 1.92% 149 873171 3.90% 150 4788475 21.41% 151 13997076 62.58% 22368190 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=16 prefix-density=1.00 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=45.21 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=16 prefix-density=0.73 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=23.02 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958217 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:33:21 Started mapping on | Dec 06 16:33:23 Finished on | Dec 06 16:35:17 Mapping speed, Million of reads per hour | 706.36 Number of input reads | 22368190 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 21047314 Uniquely mapped reads % | 94.09% Average mapped length | 293.54 Number of splices: Total | 25625723 Number of splices: Annotated (sjdb) | 24239587 Number of splices: GT/AG | 25291740 Number of splices: GC/AG | 297131 Number of splices: AT/AC | 9272 Number of splices: Non-canonical | 27580 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.47 Insertion rate per base | 0.01% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 177091 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 36140 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.28% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1151141 1151141 1151141 N_multimapping 177091 177091 177091 N_noFeature 637891 20473418 793942 N_ambiguous 509504 2853 93350 UnstrandedReadsAssigned:19899919 PositiveStrandReadsAssigned:571043 NegativeStrandReadsAssigned:20160022 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=146 echo kmer=141 SRR6958217 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958217-trimmed-pair1.fastq SRR6958217-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,368,190 reads, 20,862,249 reads pseudoaligned [quant] estimated average fragment length: 266.387 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,284 rounds 52973 SRR6958217.ke.tsv 35125 SRR6958217.se.tsv 88098 total ==> SRR6958217.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.992 4.20469e-08 4.51233e-09 PNS24247 1044 778.613 60.1167 5.55979 PNS24249 1928 1662.61 57.3431 2.48356 PNS24246 1044 778.613 60.1167 5.55979 PNS24248 1044 778.613 60.1167 5.55979 PNS24244 1471 1205.61 20.3069 1.21289 PNS24243 293 80.2436 0 0 KQK14069 1603 1337.61 6024.42 324.317 KQK14071 474 221.835 62.8937 20.4156 ==> SRR6958217.se.tsv <== BRADI_1g14170v3 6172 BRADI_1g53295v3 212 BRADI_1g59795v3 176 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 234 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 215 BRADI_1g48960v3 1 SRR6958217 completed mapping pipeline successfully