Starting /dee2/code/volunteer_pipeline.sh SRR6958218 current disk space = 1550640402432 free memory = 1600107552 SRR6958218 SRAfilesize 5e9cc516a30c5530aaac0606f334af51 SRR6958218.sra SRR6958218.sra file validated SRR6958218 is paired end SRR6958218 is conventional basespace SRR6958218 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958218_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.783 32.0 27.0 33.0 18.0 33.0 2 29.91875 31.0 29.0 33.0 25.0 34.0 3 30.4145 31.0 29.0 33.0 27.0 33.0 4 30.15475 31.0 29.0 33.0 25.0 33.0 5 30.9465 33.0 31.0 33.0 27.0 33.0 6 35.52575 37.0 35.0 38.0 31.0 38.0 7 35.66025 38.0 36.0 38.0 31.0 38.0 8 36.30975 38.0 37.0 38.0 33.0 38.0 9 37.13075 38.0 38.0 38.0 36.0 38.0 10-14 37.2753 38.0 38.0 38.0 36.4 38.0 15-19 37.3525 38.0 38.0 38.0 37.0 38.0 20-24 37.428549999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.2892 38.0 38.0 38.0 36.8 38.0 30-34 37.136449999999996 38.0 38.0 38.0 36.2 38.0 35-39 37.064249999999994 38.0 38.0 38.0 36.0 38.0 40-44 36.98805 38.0 38.0 38.0 35.8 38.0 45-49 37.08075 38.0 38.0 38.0 36.0 38.0 50-54 37.069900000000004 38.0 38.0 38.0 35.8 38.0 55-59 36.80925 38.0 38.0 38.0 35.0 38.0 60-64 36.89555 38.0 38.0 38.0 35.2 38.0 65-69 36.929500000000004 38.0 38.0 38.0 35.2 38.0 70-74 36.8763 38.0 38.0 38.0 35.0 38.0 75-79 36.70145000000001 38.0 38.0 38.0 34.6 38.0 80-84 36.33395 38.0 37.6 38.0 33.4 38.0 85-89 36.2025 38.0 37.0 38.0 33.0 38.0 90-94 36.3437 38.0 37.6 38.0 33.4 38.0 95-99 36.249649999999995 38.0 37.0 38.0 33.2 38.0 100-104 36.2199 38.0 37.0 38.0 33.2 38.0 105-109 35.898849999999996 38.0 36.6 38.0 32.0 38.0 110-114 35.51095 38.0 35.8 38.0 29.8 38.0 115-119 35.408550000000005 38.0 36.0 38.0 29.6 38.0 120-124 35.1685 38.0 35.4 38.0 28.6 38.0 125-129 34.9388 38.0 35.0 38.0 28.0 38.0 130-134 34.67594999999999 38.0 35.0 38.0 27.2 38.0 135-139 34.6253 38.0 35.0 38.0 26.8 38.0 140-144 33.93615 38.0 34.0 38.0 23.8 38.0 145-149 32.37645 37.0 33.0 38.0 15.2 38.0 150-151 28.179000000000002 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 2.0 16 0.0 17 1.0 18 2.0 19 1.0 20 2.0 21 3.0 22 3.0 23 7.0 24 8.0 25 15.0 26 15.0 27 28.0 28 35.0 29 45.0 30 59.0 31 66.0 32 117.0 33 167.0 34 256.0 35 444.0 36 936.0 37 1783.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.39016736401673 9.440376569037658 7.0345188284518825 41.13493723849373 2 23.974999999999998 11.15 37.8 27.075 3 20.175 18.275 24.7 36.85 4 24.05 25.575 22.225 28.15 5 27.25681420355089 28.907226806701676 23.20580145036259 20.630157539384847 6 20.575 34.375 24.025 21.025 7 16.900000000000002 25.724999999999998 39.1 18.275 8 19.275000000000002 23.05 30.575000000000003 27.1 9 19.025 22.775000000000002 32.975 25.224999999999998 10-14 22.175 26.97 26.565 24.29 15-19 22.27 26.415 26.025 25.290000000000003 20-24 21.59 26.265 27.21 24.935 25-29 21.485000000000003 26.205000000000002 27.02 25.290000000000003 30-34 22.259999999999998 26.105 26.474999999999998 25.16 35-39 22.905 26.045 25.81 25.240000000000002 40-44 22.175 26.179999999999996 26.229999999999997 25.415 45-49 22.355 26.015 26.545 25.085 50-54 22.185 25.995 26.945000000000004 24.875 55-59 22.485 25.929999999999996 26.27 25.314999999999998 60-64 22.305 25.88 26.185000000000002 25.629999999999995 65-69 22.2 26.35 26.615 24.834999999999997 70-74 22.125 25.580000000000002 26.700000000000003 25.595000000000002 75-79 22.535 26.11 26.275 25.080000000000002 80-84 22.225 26.474999999999998 25.86 25.44 85-89 22.585 25.724999999999998 25.885 25.805 90-94 22.285 26.035000000000004 26.634999999999998 25.045 95-99 22.295 25.985000000000003 25.915 25.805 100-104 22.720000000000002 26.36 26.025 24.895 105-109 22.08 25.61 26.729999999999997 25.580000000000002 110-114 22.955000000000002 25.495 26.384999999999998 25.165 115-119 22.939999999999998 26.165 26.090000000000003 24.805 120-124 22.82 25.8 26.265 25.115 125-129 22.384999999999998 25.995 26.3 25.319999999999997 130-134 22.595000000000002 25.840000000000003 26.02 25.545 135-139 22.34 25.91 26.295 25.455 140-144 22.43 26.715 25.840000000000003 25.014999999999997 145-149 22.785 25.900000000000002 26.07 25.245 150-151 22.095785919719894 26.147305239464803 26.034763036138553 25.722145804676757 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 2.0 28 5.0 29 7.0 30 8.0 31 11.0 32 17.0 33 22.0 34 31.0 35 40.0 36 53.5 37 73.5 38 89.5 39 118.0 40 156.0 41 178.5 42 189.5 43 210.0 44 227.0 45 222.5 46 237.5 47 229.5 48 202.5 49 206.0 50 179.0 51 143.5 52 126.5 53 114.5 54 100.5 55 79.0 56 73.0 57 69.0 58 58.5 59 57.0 60 52.0 61 49.5 62 50.5 63 42.0 64 40.0 65 40.0 66 32.5 67 30.0 68 23.5 69 18.5 70 21.0 71 17.5 72 14.5 73 11.0 74 4.5 75 2.5 76 2.0 77 3.0 78 3.5 79 2.0 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3999999999999995 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.7999999999999998 0.0 0.0 0.0 0.0 126-127 1.9874999999999998 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.7 0.0 0.0 0.0 0.0 134-135 3.05 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958218 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958218_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93725 33.0 33.0 34.0 32.0 34.0 2 32.94775 34.0 33.0 34.0 32.0 34.0 3 32.87925 34.0 33.0 34.0 32.0 34.0 4 32.91625 34.0 33.0 34.0 32.0 34.0 5 33.0265 34.0 33.0 34.0 32.0 34.0 6 37.14375 38.0 38.0 38.0 37.0 38.0 7 36.889 38.0 38.0 38.0 36.0 38.0 8 36.98575 38.0 38.0 38.0 36.0 38.0 9 36.9155 38.0 38.0 38.0 36.0 38.0 10-14 36.9094 38.0 38.0 38.0 35.8 38.0 15-19 36.87055 38.0 38.0 38.0 35.6 38.0 20-24 36.859500000000004 38.0 38.0 38.0 35.8 38.0 25-29 36.957 38.0 38.0 38.0 35.8 38.0 30-34 36.981100000000005 38.0 38.0 38.0 35.8 38.0 35-39 36.8636 38.0 38.0 38.0 35.6 38.0 40-44 36.7906 38.0 38.0 38.0 35.2 38.0 45-49 36.7963 38.0 38.0 38.0 35.4 38.0 50-54 36.77230000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.72485 38.0 38.0 38.0 35.0 38.0 60-64 36.7115 38.0 38.0 38.0 34.8 38.0 65-69 36.4649 38.0 38.0 38.0 34.0 38.0 70-74 36.3774 38.0 38.0 38.0 34.0 38.0 75-79 36.240750000000006 38.0 37.8 38.0 33.4 38.0 80-84 36.0765 38.0 37.6 38.0 32.6 38.0 85-89 35.9557 38.0 37.0 38.0 32.6 38.0 90-94 35.880399999999995 38.0 37.0 38.0 32.2 38.0 95-99 35.782050000000005 38.0 37.0 38.0 31.6 38.0 100-104 35.642399999999995 38.0 37.0 38.0 31.0 38.0 105-109 35.323750000000004 38.0 36.2 38.0 29.6 38.0 110-114 35.0972 38.0 35.8 38.0 27.8 38.0 115-119 34.82535 38.0 35.2 38.0 27.2 38.0 120-124 34.6595 38.0 35.0 38.0 26.4 38.0 125-129 34.40135 38.0 34.6 38.0 24.4 38.0 130-134 34.025 38.0 34.6 38.0 22.0 38.0 135-139 33.365 38.0 33.8 38.0 18.6 38.0 140-144 32.9366 38.0 33.0 38.0 15.4 38.0 145-149 32.1169 38.0 32.0 38.0 13.2 38.0 150-151 27.7485 35.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 0.0 10 0.0 11 1.0 12 2.0 13 5.0 14 3.0 15 2.0 16 3.0 17 4.0 18 4.0 19 5.0 20 9.0 21 6.0 22 17.0 23 9.0 24 13.0 25 23.0 26 24.0 27 33.0 28 39.0 29 44.0 30 76.0 31 82.0 32 122.0 33 159.0 34 222.0 35 390.0 36 784.0 37 1909.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.68367091772943 17.129282320580145 11.47786946736684 36.70917729432358 2 28.199999999999996 23.45 30.425 17.925 3 21.630407601900476 26.406601650412604 29.057264316079017 22.9057264316079 4 25.55 30.175 21.45 22.825 5 28.40710177544386 32.883220805201304 20.68017004251063 18.02950737684421 6 22.925 37.65 19.950000000000003 19.475 7 21.775 20.125 36.7 21.4 8 23.05 22.875 27.150000000000002 26.924999999999997 9 24.425 22.45 29.175 23.95 10-14 25.69 26.765 24.175 23.369999999999997 15-19 24.985 26.450000000000003 25.595000000000002 22.97 20-24 25.424999999999997 26.445 25.845000000000002 22.285 25-29 25.264999999999997 26.145000000000003 25.355 23.235 30-34 25.055 26.325 25.264999999999997 23.355 35-39 25.259999999999998 26.47 25.27 23.0 40-44 25.490000000000002 26.484999999999996 25.41 22.615 45-49 25.1 26.419999999999998 25.465 23.015 50-54 25.525 26.645000000000003 25.195 22.634999999999998 55-59 25.555 25.935000000000002 25.96 22.55 60-64 25.624999999999996 26.064999999999998 25.650000000000002 22.66 65-69 25.295 26.155 25.615 22.935 70-74 25.285000000000004 26.575 25.21 22.93 75-79 25.009999999999998 26.045 25.369999999999997 23.575 80-84 25.495 26.590000000000003 25.45 22.465 85-89 25.869999999999997 25.695 25.955000000000002 22.48 90-94 25.314999999999998 26.21 25.755 22.720000000000002 95-99 25.285000000000004 26.66 25.385 22.67 100-104 25.855 26.25 25.480000000000004 22.415 105-109 25.230000000000004 26.57 25.665 22.535 110-114 25.47 26.950000000000003 25.155 22.425 115-119 24.995 26.3 25.445 23.26 120-124 25.365 26.169999999999998 25.69 22.775000000000002 125-129 25.590000000000003 26.575 25.324999999999996 22.509999999999998 130-134 25.715 26.395000000000003 26.08 21.81 135-139 25.835 27.134999999999998 25.405 21.625 140-144 26.384999999999998 26.015 25.564999999999998 22.035 145-149 26.0 26.1 25.345000000000002 22.555 150-151 26.13480055020633 26.15980992872327 24.946855070651495 22.758534450418907 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 3.0 27 2.5 28 3.5 29 5.5 30 7.5 31 8.5 32 10.5 33 18.5 34 28.0 35 40.0 36 50.0 37 62.0 38 92.0 39 122.5 40 139.0 41 148.5 42 171.5 43 199.0 44 224.0 45 240.5 46 232.0 47 229.0 48 215.0 49 187.5 50 171.0 51 142.0 52 124.5 53 114.0 54 94.0 55 86.0 56 84.0 57 88.5 58 79.5 59 62.0 60 61.0 61 57.5 62 46.5 63 44.0 64 46.5 65 47.5 66 39.0 67 25.0 68 24.0 69 27.0 70 24.0 71 20.5 72 14.5 73 10.0 74 7.5 75 7.5 76 5.0 77 0.5 78 0.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.7999999999999998 0.0 0.0 0.0 0.0 126-127 1.9874999999999998 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.7 0.0 0.0 0.0 0.0 134-135 3.05 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTGCC 10 0.006830828 145.0 9 >>END_MODULE Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183422 spots for SRR6958218.sra Written 1183422 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra Read 1183415 spots for SRR6958218.sra Written 1183415 spots for SRR6958218.sra SRR ids: ['SRR6958218.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uau90wjo SRR6958218.sra spots: 23668307 blocks: [[1, 1183415], [1183416, 2366830], [2366831, 3550245], [3550246, 4733660], [4733661, 5917075], [5917076, 7100490], [7100491, 8283905], [8283906, 9467320], [9467321, 10650735], [10650736, 11834150], [11834151, 13017565], [13017566, 14200980], [14200981, 15384395], [15384396, 16567810], [16567811, 17751225], [17751226, 18934640], [18934641, 20118055], [20118056, 21301470], [21301471, 22484885], [22484886, 23668307]] SRR6958218 file size 7998712 SRR6958218 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958218 SRR6958218_1.fastq SRR6958218_2.fastq Input file: SRR6958218_1.fastq Paired file: SRR6958218_2.fastq trimmed: SRR6958218-trimmed-pair1.fastq, SRR6958218-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:30:21 2024 >> started Fri Dec 6 16:30:53 2024 >> done (31.176s) 23668307 read pairs processed; of these: 9679 ( 0.04%) short read pairs filtered out after trimming by size control 6364 ( 0.03%) empty read pairs filtered out after trimming by size control 23652264 (99.93%) read pairs available; of these: 8409419 (35.55%) trimmed read pairs available after processing 15242845 (64.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 5 0.00% 22 13 0.00% 23 0 0.00% 24 2 0.00% 25 4 0.00% 26 4 0.00% 27 6 0.00% 28 2 0.00% 29 5 0.00% 30 3 0.00% 31 6 0.00% 32 3 0.00% 33 3 0.00% 34 6 0.00% 35 9 0.00% 36 16 0.00% 37 10 0.00% 38 7 0.00% 39 16 0.00% 40 13 0.00% 41 10 0.00% 42 12 0.00% 43 12 0.00% 44 13 0.00% 45 21 0.00% 46 20 0.00% 47 27 0.00% 48 26 0.00% 49 26 0.00% 50 34 0.00% 51 33 0.00% 52 27 0.00% 53 42 0.00% 54 48 0.00% 55 53 0.00% 56 64 0.00% 57 66 0.00% 58 85 0.00% 59 93 0.00% 60 106 0.00% 61 143 0.00% 62 141 0.00% 63 176 0.00% 64 272 0.00% 65 189 0.00% 66 205 0.00% 67 223 0.00% 68 264 0.00% 69 343 0.00% 70 409 0.00% 71 481 0.00% 72 479 0.00% 73 505 0.00% 74 559 0.00% 75 622 0.00% 76 695 0.00% 77 809 0.00% 78 929 0.00% 79 1086 0.00% 80 1129 0.00% 81 1341 0.01% 82 1516 0.01% 83 1779 0.01% 84 2358 0.01% 85 2876 0.01% 86 3003 0.01% 87 3227 0.01% 88 3504 0.01% 89 3760 0.02% 90 4382 0.02% 91 4638 0.02% 92 4595 0.02% 93 4950 0.02% 94 5553 0.02% 95 5977 0.03% 96 6317 0.03% 97 6896 0.03% 98 7118 0.03% 99 7652 0.03% 100 7915 0.03% 101 8617 0.04% 102 9057 0.04% 103 9819 0.04% 104 10386 0.04% 105 10891 0.05% 106 11751 0.05% 107 12161 0.05% 108 13011 0.06% 109 13797 0.06% 110 14373 0.06% 111 15193 0.06% 112 16230 0.07% 113 17287 0.07% 114 17824 0.08% 115 19623 0.08% 116 20129 0.09% 117 20969 0.09% 118 22333 0.09% 119 23485 0.10% 120 24410 0.10% 121 25517 0.11% 122 26744 0.11% 123 27915 0.12% 124 29954 0.13% 125 31514 0.13% 126 32741 0.14% 127 34665 0.15% 128 36518 0.15% 129 38098 0.16% 130 40397 0.17% 131 42194 0.18% 132 45270 0.19% 133 47653 0.20% 134 50981 0.22% 135 53820 0.23% 136 58069 0.25% 137 62037 0.26% 138 66228 0.28% 139 71505 0.30% 140 77605 0.33% 141 84128 0.36% 142 94572 0.40% 143 107376 0.45% 144 125155 0.53% 145 152953 0.65% 146 196669 0.83% 147 259854 1.10% 148 407556 1.72% 149 864146 3.65% 150 4806265 20.32% 151 15242845 64.45% 23652264 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=6.34 fanout-score-rank=21 prefix-density=0.39 prefix-fanout=4.1 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=178.54 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=8.1 sequence=GGCGGCGGCGAACCGCCCCCGTCGCCGCGATCCGAACACTTCACCGGACCATTCAATCGGTAGGAGCGACGGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCTATATACTCGTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCATCAC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.24 fanout-score-rank=24 prefix-density=0.28 prefix-fanout=3.5 sequence=GGCAAGACCATCACCCTTGAGGTGGAGTCATCTGACACCATCGACAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=170.85 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=21.3 sequence=CAAGAAGAAGGT SRR6958218 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:31:38 Started mapping on | Dec 06 16:31:38 Finished on | Dec 06 16:33:36 Mapping speed, Million of reads per hour | 721.59 Number of input reads | 23652264 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23152701 Uniquely mapped reads % | 97.89% Average mapped length | 297.48 Number of splices: Total | 28087715 Number of splices: Annotated (sjdb) | 26573812 Number of splices: GT/AG | 27723588 Number of splices: GC/AG | 316802 Number of splices: AT/AC | 11892 Number of splices: Non-canonical | 35433 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.01% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 216268 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 16972 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.69% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 290092 290092 290092 N_multimapping 216268 216268 216268 N_noFeature 919058 22561031 1090245 N_ambiguous 500742 2983 81607 UnstrandedReadsAssigned:21732901 PositiveStrandReadsAssigned:588687 NegativeStrandReadsAssigned:21980849 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958218 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958218-trimmed-pair1.fastq SRR6958218-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,652,264 reads, 21,981,500 reads pseudoaligned [quant] estimated average fragment length: 267.631 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52973 SRR6958218.ke.tsv 35125 SRR6958218.se.tsv 88098 total ==> SRR6958218.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.797 0 0 PNS24247 1044 777.369 72.4439 6.60463 PNS24249 1928 1661.37 54.1183 2.30862 PNS24246 1044 777.369 72.4439 6.60463 PNS24248 1044 777.369 72.4439 6.60463 PNS24244 1471 1204.37 46.5501 2.73927 PNS24243 293 80.4649 0 0 KQK14069 1603 1336.37 2217.53 117.603 KQK14071 474 221.672 41.8269 13.3727 ==> SRR6958218.se.tsv <== BRADI_1g14170v3 2547 BRADI_1g53295v3 597 BRADI_1g59795v3 400 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 457 BRADI_1g74790v3 245 BRADI_1g09890v3 0 BRADI_1g77505v3 372 BRADI_1g48960v3 0 SRR6958218 completed mapping pipeline successfully