Starting /dee2/code/volunteer_pipeline.sh SRR6958219 current disk space = 1550621294592 free memory = 1597986552 SRR6958219 SRAfilesize d0f3e23be2cc52aa686097307f749689 SRR6958219.sra SRR6958219.sra file validated SRR6958219 is paired end SRR6958219 is conventional basespace SRR6958219 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958219_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.777 27.0 18.0 33.0 18.0 33.0 2 29.06525 31.0 27.0 33.0 25.0 33.0 3 30.11025 31.0 29.0 33.0 25.0 33.0 4 31.66 33.0 31.0 33.0 29.0 33.0 5 31.36225 33.0 31.0 33.0 29.0 33.0 6 36.7515 38.0 37.0 38.0 34.0 38.0 7 37.293 38.0 38.0 38.0 36.0 38.0 8 37.47725 38.0 38.0 38.0 37.0 38.0 9 37.631 38.0 38.0 38.0 38.0 38.0 10-14 37.5172 38.0 38.0 38.0 37.8 38.0 15-19 37.570350000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.651399999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.53075 38.0 38.0 38.0 37.8 38.0 30-34 37.45045 38.0 38.0 38.0 37.4 38.0 35-39 37.50095 38.0 38.0 38.0 37.6 38.0 40-44 37.61035 38.0 38.0 38.0 38.0 38.0 45-49 37.567750000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.39205 38.0 38.0 38.0 37.0 38.0 55-59 37.44285 38.0 38.0 38.0 37.2 38.0 60-64 37.56175 38.0 38.0 38.0 38.0 38.0 65-69 37.62455 38.0 38.0 38.0 38.0 38.0 70-74 37.22795 38.0 38.0 38.0 36.4 38.0 75-79 37.5278 38.0 38.0 38.0 37.4 38.0 80-84 37.47265 38.0 38.0 38.0 37.2 38.0 85-89 37.2216 38.0 38.0 38.0 36.2 38.0 90-94 35.9307 38.0 36.8 38.0 31.2 38.0 95-99 36.18535 38.0 37.4 38.0 32.8 38.0 100-104 36.31795 38.0 37.6 38.0 33.2 38.0 105-109 36.449799999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.28779999999999 38.0 37.8 38.0 33.6 38.0 115-119 36.7742 38.0 38.0 38.0 34.8 38.0 120-124 36.9128 38.0 38.0 38.0 35.0 38.0 125-129 36.8963 38.0 38.0 38.0 35.0 38.0 130-134 36.806200000000004 38.0 38.0 38.0 35.0 38.0 135-139 36.66795 38.0 38.0 38.0 35.0 38.0 140-144 36.251000000000005 38.0 38.0 38.0 33.6 38.0 145-149 35.75915 38.0 36.4 38.0 33.0 38.0 150-151 30.021500000000003 35.5 19.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 2.0 23 2.0 24 3.0 25 6.0 26 3.0 27 4.0 28 19.0 29 20.0 30 23.0 31 33.0 32 53.0 33 81.0 34 140.0 35 256.0 36 706.0 37 2645.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.03921568627451 11.328976034858387 6.209150326797386 34.42265795206972 2 25.55 13.125 30.9 30.425 3 22.225 17.7 22.775000000000002 37.3 4 27.950000000000003 24.45 21.7 25.900000000000002 5 26.3 28.799999999999997 22.5 22.400000000000002 6 22.675 33.225 22.375 21.725 7 18.0 23.925 40.225 17.849999999999998 8 20.75 23.25 29.425 26.575 9 20.125 21.925 33.300000000000004 24.65 10-14 23.175 26.515 25.430000000000003 24.88 15-19 23.95 25.195 25.47 25.385 20-24 22.327862289831867 25.555444355484386 26.471176941553242 25.645516413130505 25-29 23.185 25.83 25.575 25.41 30-34 23.015 25.650000000000002 25.955000000000002 25.380000000000003 35-39 23.015 25.224999999999998 25.935000000000002 25.825 40-44 23.064999999999998 25.61 26.150000000000002 25.174999999999997 45-49 23.31 25.685000000000002 25.64 25.365 50-54 22.759999999999998 25.525 26.1 25.615 55-59 23.385 25.83 25.345000000000002 25.44 60-64 23.205000000000002 25.31 25.619999999999997 25.865 65-69 22.919999999999998 25.655 25.415 26.009999999999998 70-74 22.71 25.759999999999998 25.96 25.569999999999997 75-79 23.35 25.09 25.72 25.840000000000003 80-84 23.27 25.3 26.215 25.215 85-89 23.335 24.945 25.985000000000003 25.735000000000003 90-94 23.794999999999998 25.245 24.884999999999998 26.075 95-99 23.415 25.174999999999997 26.115 25.295 100-104 23.549999999999997 25.040000000000003 26.22 25.19 105-109 23.39 25.174999999999997 25.7 25.735000000000003 110-114 23.885 25.319999999999997 25.0 25.795 115-119 23.715 25.374999999999996 25.474999999999998 25.435000000000002 120-124 23.925 25.040000000000003 25.53 25.505 125-129 23.595 25.64 25.305 25.46 130-134 23.935000000000002 24.485 25.515 26.064999999999998 135-139 24.015 25.264999999999997 25.224999999999998 25.495 140-144 23.93 25.224999999999998 25.335 25.509999999999998 145-149 23.445 25.330000000000002 25.535000000000004 25.69 150-151 24.474999999999998 24.775 26.8375 23.9125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.5 26 1.5 27 1.5 28 3.0 29 5.5 30 9.0 31 12.0 32 12.0 33 19.0 34 26.0 35 31.5 36 46.5 37 62.5 38 83.5 39 115.0 40 127.0 41 141.5 42 169.5 43 190.5 44 207.5 45 202.5 46 227.0 47 235.5 48 194.5 49 169.5 50 168.5 51 161.5 52 132.0 53 118.0 54 103.5 55 81.0 56 70.0 57 82.0 58 88.0 59 72.5 60 67.5 61 67.0 62 65.5 63 57.0 64 48.5 65 52.0 66 49.0 67 44.0 68 41.0 69 29.0 70 27.0 71 28.0 72 18.0 73 9.5 74 6.5 75 7.0 76 3.5 77 2.0 78 2.5 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.200000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.08 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.5125000000000002 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.1500000000000004 0.0 0.0 0.0 0.0 130-131 2.2875 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.8625 0.0 0.0 0.0 0.0 136-137 3.1 0.0 0.0 0.0 0.0 138-139 3.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAAAA 10 0.006841402 144.925 9 >>END_MODULE SRR6958219 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958219_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0515 33.0 33.0 34.0 33.0 34.0 2 33.13475 34.0 33.0 34.0 33.0 34.0 3 33.22125 34.0 33.0 34.0 33.0 34.0 4 33.24925 34.0 33.0 34.0 33.0 34.0 5 33.1465 34.0 33.0 34.0 33.0 34.0 6 37.279 38.0 38.0 38.0 37.0 38.0 7 37.245 38.0 38.0 38.0 37.0 38.0 8 37.35375 38.0 38.0 38.0 38.0 38.0 9 37.2345 38.0 38.0 38.0 37.0 38.0 10-14 37.14235000000001 38.0 38.0 38.0 36.8 38.0 15-19 37.0855 38.0 38.0 38.0 36.8 38.0 20-24 37.148399999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.184250000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.2784 38.0 38.0 38.0 37.6 38.0 35-39 37.305400000000006 38.0 38.0 38.0 37.8 38.0 40-44 37.3775 38.0 38.0 38.0 38.0 38.0 45-49 37.28175 38.0 38.0 38.0 37.0 38.0 50-54 37.17985 38.0 38.0 38.0 37.2 38.0 55-59 36.91105 38.0 38.0 38.0 36.0 38.0 60-64 36.466899999999995 38.0 37.8 38.0 33.8 38.0 65-69 36.7786 38.0 38.0 38.0 35.6 38.0 70-74 36.934000000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.8622 38.0 38.0 38.0 36.0 38.0 80-84 36.7105 38.0 38.0 38.0 35.4 38.0 85-89 36.53574999999999 38.0 38.0 38.0 34.8 38.0 90-94 36.45825000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.9488 38.0 38.0 38.0 36.0 38.0 100-104 36.90865 38.0 38.0 38.0 36.0 38.0 105-109 36.7935 38.0 38.0 38.0 35.2 38.0 110-114 36.75675 38.0 38.0 38.0 35.4 38.0 115-119 36.43900000000001 38.0 38.0 38.0 34.2 38.0 120-124 36.21805 38.0 38.0 38.0 34.0 38.0 125-129 34.51665 38.0 34.8 38.0 25.4 38.0 130-134 36.062599999999996 38.0 38.0 38.0 33.4 38.0 135-139 36.06605 38.0 38.0 38.0 33.6 38.0 140-144 35.8779 38.0 38.0 38.0 33.0 38.0 145-149 35.5391 38.0 36.8 38.0 32.4 38.0 150-151 31.791875 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 3.0 5 0.0 6 4.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 3.0 14 1.0 15 2.0 16 2.0 17 2.0 18 1.0 19 4.0 20 3.0 21 5.0 22 4.0 23 4.0 24 8.0 25 16.0 26 12.0 27 11.0 28 23.0 29 28.0 30 28.0 31 36.0 32 62.0 33 81.0 34 94.0 35 162.0 36 514.0 37 2875.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.325 18.875 9.35 29.45 2 28.299999999999997 22.6 28.599999999999998 20.5 3 22.7 24.4 29.549999999999997 23.35 4 25.974999999999998 31.2 20.65 22.175 5 28.15 32.9 18.875 20.075000000000003 6 22.55 37.175000000000004 19.25 21.025 7 21.975 19.950000000000003 35.25 22.825 8 23.35 23.025000000000002 24.5 29.125 9 24.425 21.4 27.575 26.6 10-14 26.06 25.575 23.71 24.654999999999998 15-19 25.645 25.56 24.39 24.404999999999998 20-24 25.2 26.46 24.185000000000002 24.154999999999998 25-29 26.174999999999997 25.56 23.919999999999998 24.345 30-34 25.505 25.974999999999998 24.63 23.89 35-39 25.915 25.290000000000003 24.175 24.62 40-44 25.805 25.324999999999996 24.345 24.525 45-49 25.595000000000002 25.515 24.474999999999998 24.415 50-54 25.874999999999996 25.485000000000003 24.94 23.7 55-59 25.86 25.324999999999996 24.615000000000002 24.2 60-64 25.545 25.919999999999998 24.515 24.02 65-69 25.55 25.900000000000002 24.635 23.915 70-74 25.945 25.040000000000003 25.130000000000003 23.885 75-79 25.490000000000002 25.71 24.654999999999998 24.145 80-84 25.745 25.650000000000002 24.495 24.11 85-89 25.3 25.685000000000002 24.205 24.81 90-94 25.72 25.365 24.555 24.36 95-99 25.6 25.645 24.925 23.830000000000002 100-104 25.619999999999997 25.855 24.57 23.955000000000002 105-109 25.569999999999997 26.174999999999997 24.8 23.455000000000002 110-114 26.685 25.895000000000003 24.375 23.044999999999998 115-119 26.200000000000003 25.935000000000002 24.169999999999998 23.695 120-124 25.885 26.195 23.965 23.955000000000002 125-129 25.64 26.1 24.44 23.82 130-134 26.13 25.295 25.1 23.474999999999998 135-139 26.0 25.900000000000002 24.63 23.47 140-144 26.685 26.015 24.425 22.875 145-149 26.44 25.935000000000002 24.625 23.0 150-151 26.900000000000002 25.85 24.587500000000002 22.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 1.5 26 2.5 27 2.0 28 3.0 29 4.0 30 7.5 31 11.5 32 15.5 33 20.5 34 24.5 35 28.0 36 38.0 37 60.5 38 79.0 39 94.0 40 120.5 41 146.5 42 168.0 43 167.5 44 182.0 45 192.5 46 185.5 47 186.0 48 179.5 49 173.0 50 154.0 51 134.5 52 121.5 53 121.5 54 114.0 55 94.0 56 94.0 57 105.0 58 103.0 59 92.5 60 84.5 61 79.0 62 78.5 63 80.0 64 73.0 65 59.5 66 48.0 67 40.5 68 38.0 69 45.5 70 39.5 71 29.5 72 25.5 73 14.0 74 10.0 75 10.5 76 7.0 77 4.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85960466294982 97.52499999999999 2 0.963000506842372 1.9 3 0.12671059300557527 0.375 4 0.05068423720223011 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.4874999999999998 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.125 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.8375 0.0 0.0 0.0 0.0 136-137 3.075 0.0 0.0 0.0 0.0 138-139 3.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002634 spots for SRR6958219.sra Written 1002634 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra Read 1002619 spots for SRR6958219.sra Written 1002619 spots for SRR6958219.sra SRR ids: ['SRR6958219.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mwsi_p81 SRR6958219.sra spots: 20052395 blocks: [[1, 1002619], [1002620, 2005238], [2005239, 3007857], [3007858, 4010476], [4010477, 5013095], [5013096, 6015714], [6015715, 7018333], [7018334, 8020952], [8020953, 9023571], [9023572, 10026190], [10026191, 11028809], [11028810, 12031428], [12031429, 13034047], [13034048, 14036666], [14036667, 15039285], [15039286, 16041904], [16041905, 17044523], [17044524, 18047142], [18047143, 19049761], [19049762, 20052395]] SRR6958219 file size 6773398 SRR6958219 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958219 SRR6958219_1.fastq SRR6958219_2.fastq Input file: SRR6958219_1.fastq Paired file: SRR6958219_2.fastq trimmed: SRR6958219-trimmed-pair1.fastq, SRR6958219-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:31:49 2024 >> started Fri Dec 6 16:32:09 2024 >> done (19.975s) 20052395 read pairs processed; of these: 16226 ( 0.08%) short read pairs filtered out after trimming by size control 11668 ( 0.06%) empty read pairs filtered out after trimming by size control 20024501 (99.86%) read pairs available; of these: 5950246 (29.71%) trimmed read pairs available after processing 14074255 (70.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 2 0.00% 21 5 0.00% 22 10 0.00% 23 6 0.00% 24 8 0.00% 25 6 0.00% 26 8 0.00% 27 2 0.00% 28 7 0.00% 29 8 0.00% 30 5 0.00% 31 7 0.00% 32 8 0.00% 33 5 0.00% 34 8 0.00% 35 5 0.00% 36 10 0.00% 37 8 0.00% 38 8 0.00% 39 5 0.00% 40 7 0.00% 41 13 0.00% 42 9 0.00% 43 8 0.00% 44 12 0.00% 45 16 0.00% 46 13 0.00% 47 13 0.00% 48 18 0.00% 49 27 0.00% 50 27 0.00% 51 28 0.00% 52 37 0.00% 53 31 0.00% 54 39 0.00% 55 39 0.00% 56 41 0.00% 57 60 0.00% 58 61 0.00% 59 86 0.00% 60 82 0.00% 61 112 0.00% 62 114 0.00% 63 125 0.00% 64 145 0.00% 65 157 0.00% 66 169 0.00% 67 176 0.00% 68 234 0.00% 69 276 0.00% 70 313 0.00% 71 330 0.00% 72 399 0.00% 73 464 0.00% 74 541 0.00% 75 575 0.00% 76 717 0.00% 77 764 0.00% 78 848 0.00% 79 954 0.00% 80 1043 0.01% 81 1292 0.01% 82 1497 0.01% 83 1547 0.01% 84 2445 0.01% 85 3076 0.02% 86 3327 0.02% 87 3382 0.02% 88 3777 0.02% 89 3891 0.02% 90 4063 0.02% 91 4338 0.02% 92 4671 0.02% 93 5041 0.03% 94 5628 0.03% 95 5890 0.03% 96 6111 0.03% 97 6706 0.03% 98 6900 0.03% 99 7497 0.04% 100 8003 0.04% 101 8379 0.04% 102 9100 0.05% 103 9599 0.05% 104 10363 0.05% 105 11149 0.06% 106 11467 0.06% 107 12156 0.06% 108 12835 0.06% 109 13590 0.07% 110 14145 0.07% 111 15019 0.08% 112 16045 0.08% 113 16610 0.08% 114 17653 0.09% 115 18625 0.09% 116 19482 0.10% 117 20278 0.10% 118 20865 0.10% 119 21740 0.11% 120 22717 0.11% 121 23689 0.12% 122 24651 0.12% 123 25776 0.13% 124 27122 0.14% 125 28670 0.14% 126 29897 0.15% 127 30933 0.15% 128 32093 0.16% 129 33299 0.17% 130 34643 0.17% 131 35660 0.18% 132 37960 0.19% 133 39846 0.20% 134 41213 0.21% 135 43379 0.22% 136 45599 0.23% 137 47261 0.24% 138 49385 0.25% 139 52977 0.26% 140 55406 0.28% 141 59823 0.30% 142 64974 0.32% 143 71378 0.36% 144 79802 0.40% 145 92403 0.46% 146 109975 0.55% 147 141710 0.71% 148 207473 1.04% 149 412946 2.06% 150 3570140 17.83% 151 14074255 70.29% 20024501 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=26 prefix-density=0.94 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=73.58 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=15 prefix-density=0.65 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=34.48 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=1.3 sequence=CAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAG SRR6958219 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:32:49 Started mapping on | Dec 06 16:32:51 Finished on | Dec 06 16:34:38 Mapping speed, Million of reads per hour | 673.72 Number of input reads | 20024501 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19455780 Uniquely mapped reads % | 97.16% Average mapped length | 297.62 Number of splices: Total | 22479125 Number of splices: Annotated (sjdb) | 21211147 Number of splices: GT/AG | 22188172 Number of splices: GC/AG | 264682 Number of splices: AT/AC | 8514 Number of splices: Non-canonical | 17757 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 128129 % of reads mapped to multiple loci | 0.64% Number of reads mapped to too many loci | 13026 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451620 451620 451620 N_multimapping 128129 128129 128129 N_noFeature 688277 18895883 839746 N_ambiguous 479880 2373 72783 UnstrandedReadsAssigned:18287623 PositiveStrandReadsAssigned:557524 NegativeStrandReadsAssigned:18543251 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6958219 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958219-trimmed-pair1.fastq SRR6958219-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,024,501 reads, 18,553,286 reads pseudoaligned [quant] estimated average fragment length: 267.663 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 SRR6958219.ke.tsv 35125 SRR6958219.se.tsv 88098 total ==> SRR6958219.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.88 0 0 PNS24247 1044 777.337 52.3336 5.48432 PNS24249 1928 1661.34 31.537 1.54637 PNS24246 1044 777.337 52.3336 5.48432 PNS24248 1044 777.337 52.3336 5.48432 PNS24244 1471 1204.34 27.4622 1.85754 PNS24243 293 83.9994 0 0 KQK14069 1603 1336.34 3865.57 235.64 KQK14071 474 224.106 104.479 37.9778 ==> SRR6958219.se.tsv <== BRADI_1g14170v3 4646 BRADI_1g53295v3 313 BRADI_1g59795v3 196 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 358 BRADI_1g74790v3 118 BRADI_1g09890v3 0 BRADI_1g77505v3 197 BRADI_1g48960v3 0 SRR6958219 completed mapping pipeline successfully