Starting /dee2/code/volunteer_pipeline.sh SRR6958220 current disk space = 1550548107264 free memory = 1601634432 SRR6958220 SRAfilesize a1854d6da9a050c275f18cc5352adc55 SRR6958220.sra SRR6958220.sra file validated SRR6958220 is paired end SRR6958220 is conventional basespace SRR6958220 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958220_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.20175 18.0 18.0 18.0 18.0 32.0 2 20.4585 18.0 18.0 18.0 18.0 30.0 3 27.04 27.0 27.0 28.0 25.0 30.0 4 31.07375 32.0 32.0 32.0 27.0 33.0 5 31.1395 32.0 32.0 33.0 28.0 33.0 6 34.3965 37.0 33.0 38.0 29.0 38.0 7 36.18175 38.0 36.0 38.0 33.0 38.0 8 36.62525 38.0 37.0 38.0 34.0 38.0 9 37.11475 38.0 38.0 38.0 35.0 38.0 10-14 37.35235 38.0 38.0 38.0 36.6 38.0 15-19 37.43895 38.0 38.0 38.0 37.0 38.0 20-24 37.54935 38.0 38.0 38.0 37.8 38.0 25-29 37.555 38.0 38.0 38.0 38.0 38.0 30-34 37.4945 38.0 38.0 38.0 37.6 38.0 35-39 37.4605 38.0 38.0 38.0 37.0 38.0 40-44 37.48755 38.0 38.0 38.0 37.2 38.0 45-49 37.414100000000005 38.0 38.0 38.0 37.2 38.0 50-54 37.3478 38.0 38.0 38.0 37.0 38.0 55-59 37.234950000000005 38.0 38.0 38.0 36.4 38.0 60-64 37.1484 38.0 38.0 38.0 36.6 38.0 65-69 37.20265 38.0 38.0 38.0 36.0 38.0 70-74 37.1736 38.0 38.0 38.0 36.0 38.0 75-79 37.0325 38.0 38.0 38.0 36.0 38.0 80-84 37.0103 38.0 38.0 38.0 35.4 38.0 85-89 36.90915 38.0 38.0 38.0 35.0 38.0 90-94 36.808550000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.6135 38.0 38.0 38.0 33.8 38.0 100-104 36.29925 38.0 37.8 38.0 32.8 38.0 105-109 36.185 38.0 37.6 38.0 32.6 38.0 110-114 35.962 38.0 37.2 38.0 31.8 38.0 115-119 35.6057 38.0 36.6 38.0 30.4 38.0 120-124 35.4469 38.0 36.0 38.0 29.4 38.0 125-129 35.3081 38.0 36.0 38.0 29.0 38.0 130-134 34.92975 38.0 36.0 38.0 27.8 38.0 135-139 34.1023 38.0 33.6 38.0 24.2 38.0 140-144 33.7718 38.0 33.0 38.0 22.8 38.0 145-149 33.14475 38.0 33.0 38.0 18.6 38.0 150-151 26.53875 32.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 2.0 19 2.0 20 3.0 21 6.0 22 6.0 23 3.0 24 16.0 25 16.0 26 18.0 27 25.0 28 23.0 29 46.0 30 29.0 31 74.0 32 82.0 33 119.0 34 198.0 35 395.0 36 1168.0 37 1766.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.8 33.4 8.4 45.4 2 19.950000000000003 18.75 23.075000000000003 38.224999999999994 3 20.325 15.875 26.450000000000003 37.35 4 24.975 22.45 22.85 29.725 5 26.075 26.325 23.45 24.15 6 24.275 30.775000000000002 23.175 21.775 7 18.325 22.975 39.324999999999996 19.375 8 20.825 23.775 28.075 27.325 9 19.950000000000003 21.725 32.45 25.874999999999996 10-14 22.665 25.3 26.58 25.455 15-19 22.665666416604154 24.521130282570645 26.49162290572643 26.321580395098778 20-24 22.99 25.05 26.215 25.745 25-29 23.635 24.36 26.119999999999997 25.885 30-34 23.325000000000003 24.825 26.095000000000002 25.755 35-39 22.900000000000002 24.86 26.279999999999998 25.96 40-44 23.880000000000003 25.03 25.64 25.45 45-49 22.66 25.040000000000003 26.400000000000002 25.900000000000002 50-54 23.135 24.415 26.26 26.19 55-59 23.75 24.955 25.775 25.52 60-64 23.13010370221933 25.254245779269574 25.645007765142026 25.970642753369074 65-69 23.150000000000002 24.55 25.755 26.545 70-74 23.115 24.785 25.83 26.27 75-79 23.46 25.130000000000003 25.945 25.465 80-84 24.03 24.705 25.81 25.455 85-89 23.674999999999997 24.87 25.47 25.985000000000003 90-94 23.815 24.654999999999998 25.94 25.590000000000003 95-99 23.515 24.104999999999997 26.38 26.0 100-104 23.69 24.5 25.779999999999998 26.029999999999998 105-109 24.285 24.72 25.515 25.480000000000004 110-114 24.29 24.355 25.759999999999998 25.595000000000002 115-119 23.945 24.67 25.169999999999998 26.215 120-124 23.175 25.319999999999997 25.105 26.400000000000002 125-129 23.655 24.695 25.55 26.1 130-134 23.36 24.665 25.419999999999998 26.555 135-139 24.375 24.560000000000002 25.629999999999995 25.435000000000002 140-144 23.855 25.415 24.94 25.790000000000003 145-149 24.145 24.57 25.53 25.755 150-151 24.462500000000002 23.8125 25.6 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 2.5 28 3.5 29 2.5 30 4.0 31 8.5 32 14.5 33 17.5 34 20.0 35 26.5 36 44.0 37 59.0 38 77.0 39 112.0 40 123.0 41 125.5 42 170.0 43 202.5 44 199.0 45 193.0 46 201.5 47 200.0 48 193.0 49 192.0 50 173.0 51 155.5 52 135.0 53 124.5 54 115.0 55 104.0 56 105.0 57 99.0 58 94.5 59 89.0 60 79.5 61 67.5 62 54.0 63 56.0 64 61.0 65 55.5 66 48.5 67 38.5 68 30.0 69 28.0 70 25.0 71 20.5 72 13.5 73 10.0 74 10.0 75 6.5 76 2.5 77 2.0 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.025 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.19499999999999998 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.1375 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.9249999999999998 0.0 0.0 0.0 0.0 130-131 2.2125 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.7875 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAGTT 10 0.006830828 145.0 145 >>END_MODULE SRR6958220 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958220_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86225 33.0 33.0 34.0 32.0 34.0 2 32.9885 34.0 33.0 34.0 32.0 34.0 3 33.0035 34.0 33.0 34.0 32.0 34.0 4 32.993 34.0 33.0 34.0 33.0 34.0 5 32.91975 34.0 33.0 34.0 33.0 34.0 6 37.14275 38.0 38.0 38.0 37.0 38.0 7 37.103 38.0 38.0 38.0 37.0 38.0 8 37.12425 38.0 38.0 38.0 37.0 38.0 9 37.094 38.0 38.0 38.0 37.0 38.0 10-14 37.0676 38.0 38.0 38.0 37.0 38.0 15-19 37.054899999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.02795 38.0 38.0 38.0 37.0 38.0 25-29 36.974199999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.0449 38.0 38.0 38.0 37.0 38.0 35-39 37.0329 38.0 38.0 38.0 37.0 38.0 40-44 36.95605 38.0 38.0 38.0 36.6 38.0 45-49 36.9724 38.0 38.0 38.0 37.0 38.0 50-54 36.907050000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.88265 38.0 38.0 38.0 36.0 38.0 60-64 36.8973 38.0 38.0 38.0 36.0 38.0 65-69 36.856849999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.80005 38.0 38.0 38.0 36.0 38.0 75-79 36.77015 38.0 38.0 38.0 36.0 38.0 80-84 36.775099999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.605399999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.508050000000004 38.0 38.0 38.0 34.8 38.0 95-99 36.44045 38.0 38.0 38.0 34.4 38.0 100-104 36.3466 38.0 38.0 38.0 34.0 38.0 105-109 36.2635 38.0 38.0 38.0 34.0 38.0 110-114 36.0364 38.0 38.0 38.0 33.4 38.0 115-119 35.93955 38.0 38.0 38.0 33.2 38.0 120-124 35.83695 38.0 38.0 38.0 33.0 38.0 125-129 35.66645000000001 38.0 37.4 38.0 32.4 38.0 130-134 35.4633 38.0 36.8 38.0 31.6 38.0 135-139 35.322649999999996 38.0 36.0 38.0 31.0 38.0 140-144 35.04365 38.0 36.0 38.0 30.6 38.0 145-149 34.3823 38.0 35.0 38.0 28.0 38.0 150-151 30.480875 35.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 6.0 4 2.0 5 1.0 6 2.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 0.0 13 3.0 14 2.0 15 1.0 16 4.0 17 2.0 18 3.0 19 3.0 20 6.0 21 3.0 22 3.0 23 10.0 24 16.0 25 11.0 26 15.0 27 18.0 28 22.0 29 33.0 30 26.0 31 46.0 32 65.0 33 91.0 34 114.0 35 201.0 36 456.0 37 2813.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.4 18.3 12.275 31.025000000000002 2 28.29573934837093 24.586466165413533 26.31578947368421 20.80200501253133 3 23.609022556390975 26.21553884711779 27.593984962406015 22.581453634085214 4 26.766917293233085 30.802005012531332 20.726817042606516 21.704260651629074 5 29.24812030075188 30.55137844611529 19.072681704260653 21.127819548872182 6 22.656641604010026 34.962406015037594 20.776942355889723 21.604010025062657 7 22.13032581453634 20.325814536340854 35.388471177944865 22.155388471177943 8 24.680531195189175 22.174893510398398 24.455023803558003 28.68955149085442 9 23.50877192982456 22.55639097744361 26.8922305764411 27.04260651629073 10-14 26.521303258145362 25.94486215538847 22.967418546365913 24.56641604010025 15-19 25.749373433583962 26.04010025062657 23.849624060150376 24.360902255639097 20-24 25.899749373433583 25.67418546365915 24.50125313283208 23.924812030075188 25-29 26.360902255639097 25.568922305764413 23.573934837092732 24.49624060150376 30-34 25.94467274731883 26.14513380775784 23.6443820787812 24.265811366142128 35-39 25.958598566487893 25.61776352062553 24.114079494762166 24.309558418124404 40-44 26.17627899984968 25.389587613368743 24.146915869118605 24.287217517662977 45-49 25.992182802164766 25.48606935257567 24.30847865303668 24.213269192222892 50-54 25.993684527091375 25.492456518470252 24.309558418124404 24.20430053631397 55-59 26.48591761050416 25.633958103638367 23.7045203969129 24.175603888944572 60-64 26.231644364256002 25.364606826041197 24.64792261815266 23.755826191550142 65-69 26.33056028866393 25.503658414353016 24.100430991279946 24.065350305703117 70-74 26.20050125313283 25.94486215538847 23.654135338345863 24.200501253132835 75-79 25.690095686588847 25.775261760432844 24.422624117028207 24.1120184359501 80-84 26.24749498997996 24.909819639278556 24.45390781563126 24.38877755511022 85-89 26.170191440312717 25.769269319434702 24.48130700611406 23.57923223413852 90-94 25.53745928338762 25.717865196692557 24.480080180405913 24.264595339513907 95-99 26.42710369368015 25.850749260762797 24.071568185235304 23.650578860321755 100-104 26.56641604010025 26.195488721804512 23.859649122807017 23.37844611528822 105-109 25.717865196692557 25.69782009521423 24.891004760711603 23.693309947381607 110-114 25.784461152882205 26.085213032581457 24.355889724310778 23.774436090225564 115-119 26.577457024006414 25.900867037538216 24.02145040845988 23.50022552999549 120-124 26.230576441102755 25.834586466165415 24.32080200501253 23.614035087719298 125-129 26.907851881545326 25.92574034173473 23.99158190108734 23.17482587563261 130-134 26.404409922325232 26.449511400651467 23.82861438236031 23.317464294662994 135-139 26.27912803808569 25.9784515159108 24.72563267351541 23.016787772488097 140-144 26.694065757818763 25.66158781074579 24.654170008019246 22.990176423416198 145-149 26.820710741316223 26.47486341536765 24.144153175279435 22.560272668036692 150-151 27.330827067669173 25.914786967418546 24.62406015037594 22.13032581453634 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 3.5 2 3.0 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.5 28 2.0 29 4.0 30 5.5 31 5.0 32 9.0 33 12.0 34 19.5 35 23.0 36 27.0 37 52.5 38 70.0 39 84.0 40 112.0 41 140.5 42 162.0 43 166.5 44 171.0 45 198.0 46 221.5 47 206.5 48 181.0 49 167.0 50 165.0 51 161.5 52 139.5 53 126.5 54 112.0 55 100.0 56 95.5 57 92.5 58 101.0 59 94.5 60 81.0 61 75.0 62 72.0 63 64.0 64 55.0 65 60.0 66 54.5 67 51.5 68 50.5 69 43.5 70 35.5 71 31.0 72 28.5 73 20.5 74 13.5 75 6.0 76 5.5 77 4.0 78 3.0 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.25 4 0.25 5 0.25 6 0.25 7 0.25 8 0.22499999999999998 9 0.25 10-14 0.25 15-19 0.25 20-24 0.25 25-29 0.25 30-34 0.22999999999999998 35-39 0.245 40-44 0.215 45-49 0.22 50-54 0.245 55-59 0.22999999999999998 60-64 0.23500000000000001 65-69 0.22999999999999998 70-74 0.25 75-79 0.19499999999999998 80-84 0.2 85-89 0.22999999999999998 90-94 0.22499999999999998 95-99 0.23500000000000001 100-104 0.25 105-109 0.22499999999999998 110-114 0.25 115-119 0.23500000000000001 120-124 0.25 125-129 0.215 130-134 0.22499999999999998 135-139 0.22499999999999998 140-144 0.24 145-149 0.245 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9367088607595 97.7 2 0.9113924050632912 1.7999999999999998 3 0.10126582278481014 0.3 4 0.05063291139240507 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.6125 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 3.075 0.0 0.0 0.0 0.0 138-139 3.5999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAATAC 10 0.006830828 145.0 5 >>END_MODULE Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876071 spots for SRR6958220.sra Written 876071 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra Read 876068 spots for SRR6958220.sra Written 876068 spots for SRR6958220.sra SRR ids: ['SRR6958220.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bwzlmzjn SRR6958220.sra spots: 17521363 blocks: [[1, 876068], [876069, 1752136], [1752137, 2628204], [2628205, 3504272], [3504273, 4380340], [4380341, 5256408], [5256409, 6132476], [6132477, 7008544], [7008545, 7884612], [7884613, 8760680], [8760681, 9636748], [9636749, 10512816], [10512817, 11388884], [11388885, 12264952], [12264953, 13141020], [13141021, 14017088], [14017089, 14893156], [14893157, 15769224], [15769225, 16645292], [16645293, 17521363]] SRR6958220 file size 5915714 SRR6958220 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958220 SRR6958220_1.fastq SRR6958220_2.fastq Input file: SRR6958220_1.fastq Paired file: SRR6958220_2.fastq trimmed: SRR6958220-trimmed-pair1.fastq, SRR6958220-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:35:10 2024 >> started Fri Dec 6 16:35:29 2024 >> done (18.457s) 17521363 read pairs processed; of these: 20530 ( 0.12%) short read pairs filtered out after trimming by size control 35344 ( 0.20%) empty read pairs filtered out after trimming by size control 17465489 (99.68%) read pairs available; of these: 7931514 (45.41%) trimmed read pairs available after processing 9533975 (54.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 2 0.00% 25 4 0.00% 26 6 0.00% 27 1 0.00% 28 6 0.00% 29 5 0.00% 30 3 0.00% 31 4 0.00% 32 2 0.00% 33 7 0.00% 34 3 0.00% 35 3 0.00% 36 2 0.00% 37 8 0.00% 38 7 0.00% 39 2 0.00% 40 7 0.00% 41 12 0.00% 42 8 0.00% 43 11 0.00% 44 16 0.00% 45 11 0.00% 46 14 0.00% 47 17 0.00% 48 21 0.00% 49 18 0.00% 50 20 0.00% 51 32 0.00% 52 30 0.00% 53 27 0.00% 54 36 0.00% 55 36 0.00% 56 45 0.00% 57 55 0.00% 58 59 0.00% 59 66 0.00% 60 63 0.00% 61 76 0.00% 62 74 0.00% 63 97 0.00% 64 119 0.00% 65 131 0.00% 66 109 0.00% 67 154 0.00% 68 170 0.00% 69 176 0.00% 70 238 0.00% 71 282 0.00% 72 321 0.00% 73 317 0.00% 74 402 0.00% 75 378 0.00% 76 555 0.00% 77 596 0.00% 78 570 0.00% 79 680 0.00% 80 775 0.00% 81 925 0.01% 82 1082 0.01% 83 1224 0.01% 84 2075 0.01% 85 2597 0.01% 86 2622 0.02% 87 2922 0.02% 88 3000 0.02% 89 3210 0.02% 90 3430 0.02% 91 3571 0.02% 92 3846 0.02% 93 4118 0.02% 94 4637 0.03% 95 4960 0.03% 96 5337 0.03% 97 5532 0.03% 98 5897 0.03% 99 6389 0.04% 100 6790 0.04% 101 7291 0.04% 102 7998 0.05% 103 8527 0.05% 104 9191 0.05% 105 9929 0.06% 106 10549 0.06% 107 11147 0.06% 108 11855 0.07% 109 12515 0.07% 110 13075 0.07% 111 13897 0.08% 112 15093 0.09% 113 15833 0.09% 114 17136 0.10% 115 18088 0.10% 116 19222 0.11% 117 20281 0.12% 118 20998 0.12% 119 22066 0.13% 120 23124 0.13% 121 24397 0.14% 122 25544 0.15% 123 27074 0.16% 124 28706 0.16% 125 30379 0.17% 126 32052 0.18% 127 33369 0.19% 128 34080 0.20% 129 35758 0.20% 130 37844 0.22% 131 39488 0.23% 132 41866 0.24% 133 44145 0.25% 134 46372 0.27% 135 49151 0.28% 136 51543 0.30% 137 54001 0.31% 138 57043 0.33% 139 60575 0.35% 140 64525 0.37% 141 71043 0.41% 142 77397 0.44% 143 86913 0.50% 144 100087 0.57% 145 118273 0.68% 146 146814 0.84% 147 201212 1.15% 148 309757 1.77% 149 672706 3.85% 150 4960518 28.40% 151 9533975 54.59% 17465489 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=20 prefix-density=0.70 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.14 sequence-density-rank=24 fanout-score=14.18 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=4.9 sequence=CCGCACTTGCACTTGCCGTCGTTCTCCGCCGCGGACTCCTGCACCTCGAAGTGGCTCTTCTCGGTGTCAACCATGACGATGCCGTAGCCGTTTCCCTTCTTCACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGCCGCAGCCGCTCGACATGGTGGCCTTAACTTGCTGGGGAGATCGAGTACACGAATCAGCTGTGTTTTGCCTGTGTGTG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=25 prefix-density=0.52 prefix-fanout=2.7 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=60.36 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=11.9 sequence=GCCGCCGCCGCCAAGGAAGGC SRR6958220 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:36:16 Started mapping on | Dec 06 16:36:16 Finished on | Dec 06 16:37:34 Mapping speed, Million of reads per hour | 806.10 Number of input reads | 17465489 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16652095 Uniquely mapped reads % | 95.34% Average mapped length | 296.73 Number of splices: Total | 19238746 Number of splices: Annotated (sjdb) | 18104305 Number of splices: GT/AG | 18985412 Number of splices: GC/AG | 230902 Number of splices: AT/AC | 8030 Number of splices: Non-canonical | 14402 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214126 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 42211 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.67% % of reads unmapped: other | 1.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 611361 611361 611361 N_multimapping 214126 214126 214126 N_noFeature 632218 16227533 746374 N_ambiguous 374563 2182 65402 UnstrandedReadsAssigned:15645314 PositiveStrandReadsAssigned:422380 NegativeStrandReadsAssigned:15840319 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958220 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958220-trimmed-pair1.fastq SRR6958220-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,465,489 reads, 15,927,093 reads pseudoaligned [quant] estimated average fragment length: 263.448 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR6958220.ke.tsv 35125 SRR6958220.se.tsv 88098 total ==> SRR6958220.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.162 0 0 PNS24247 1044 781.552 54.6881 6.61688 PNS24249 1928 1665.55 42.1948 2.39562 PNS24246 1044 781.552 54.6881 6.61688 PNS24248 1044 781.552 54.6881 6.61688 PNS24244 1471 1208.55 48.7408 3.81369 PNS24243 293 85.1233 0 0 KQK14069 1603 1340.55 2254.84 159.056 KQK14071 474 226.992 58.9982 24.5779 ==> SRR6958220.se.tsv <== BRADI_1g14170v3 2619 BRADI_1g53295v3 265 BRADI_1g59795v3 252 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 224 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 254 BRADI_1g48960v3 0 SRR6958220 completed mapping pipeline successfully