Starting /dee2/code/volunteer_pipeline.sh SRR6958221 current disk space = 1550524891136 free memory = 1600579952 SRR6958221 SRAfilesize deec988359ad8651bbe147805a0ed7f4 SRR6958221.sra SRR6958221.sra file validated SRR6958221 is paired end SRR6958221 is conventional basespace SRR6958221 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958221_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.364 27.0 18.0 32.0 18.0 33.0 2 26.8845 28.0 18.0 32.0 18.0 33.0 3 25.24375 27.0 18.0 32.0 18.0 32.0 4 29.272 31.0 28.0 33.0 25.0 33.0 5 30.70425 32.0 32.0 33.0 25.0 33.0 6 35.8335 37.0 36.0 38.0 31.0 38.0 7 36.57025 38.0 37.0 38.0 34.0 38.0 8 36.85625 38.0 38.0 38.0 35.0 38.0 9 36.9095 38.0 38.0 38.0 35.0 38.0 10-14 37.02135 38.0 38.0 38.0 35.6 38.0 15-19 37.22805 38.0 38.0 38.0 36.0 38.0 20-24 37.0477 38.0 38.0 38.0 35.8 38.0 25-29 36.9028 38.0 38.0 38.0 35.2 38.0 30-34 36.64855 38.0 38.0 38.0 34.4 38.0 35-39 36.53445 38.0 38.0 38.0 34.0 38.0 40-44 36.647450000000006 38.0 38.0 38.0 34.2 38.0 45-49 36.5375 38.0 38.0 38.0 33.8 38.0 50-54 36.31 38.0 37.8 38.0 33.4 38.0 55-59 36.092349999999996 38.0 37.2 38.0 32.6 38.0 60-64 36.463049999999996 38.0 37.8 38.0 33.8 38.0 65-69 36.2331 38.0 37.2 38.0 32.8 38.0 70-74 35.942099999999996 38.0 37.0 38.0 31.6 38.0 75-79 35.76434999999999 38.0 36.8 38.0 30.6 38.0 80-84 35.56815 38.0 36.4 38.0 29.8 38.0 85-89 35.60315 38.0 36.4 38.0 30.2 38.0 90-94 35.48895 38.0 36.2 38.0 29.2 38.0 95-99 34.8845 38.0 35.4 38.0 27.0 38.0 100-104 34.44675 38.0 34.6 38.0 24.4 38.0 105-109 34.30565 38.0 34.4 38.0 23.6 38.0 110-114 34.1262 38.0 34.0 38.0 22.8 38.0 115-119 33.5613 38.0 34.0 38.0 17.8 38.0 120-124 33.2743 37.6 33.2 38.0 19.4 38.0 125-129 33.18555 37.8 33.2 38.0 17.8 38.0 130-134 33.21365 37.8 33.2 38.0 18.6 38.0 135-139 31.22475 35.6 29.0 38.0 13.4 38.0 140-144 30.676050000000004 35.6 29.2 38.0 12.8 38.0 145-149 28.90475 34.2 24.6 38.0 4.2 38.0 150-151 23.70275 31.5 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 1.0 16 2.0 17 7.0 18 9.0 19 3.0 20 7.0 21 15.0 22 11.0 23 24.0 24 29.0 25 33.0 26 47.0 27 49.0 28 62.0 29 94.0 30 117.0 31 144.0 32 199.0 33 252.0 34 342.0 35 579.0 36 1052.0 37 917.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.551257776575596 8.926156342980796 9.494184473897754 35.02840140654585 2 26.650000000000002 10.575 32.125 30.65 3 22.25 13.625000000000002 28.9 35.225 4 27.250000000000004 21.15 22.05 29.549999999999997 5 26.1 25.124999999999996 25.224999999999998 23.549999999999997 6 26.474999999999998 29.65 22.325 21.55 7 17.45 23.200000000000003 38.625 20.724999999999998 8 20.849999999999998 23.799999999999997 27.474999999999998 27.875 9 19.950000000000003 22.3 31.75 26.0 10-14 23.87 25.15 25.674999999999997 25.305 15-19 23.54 24.565 26.009999999999998 25.885 20-24 23.375 24.92 25.82 25.885 25-29 24.015 24.8 25.845000000000002 25.34 30-34 23.735 24.6 26.075 25.590000000000003 35-39 23.525 24.805 25.629999999999995 26.040000000000003 40-44 23.125 24.474999999999998 26.025 26.375 45-49 23.715 24.279999999999998 25.669999999999998 26.334999999999997 50-54 24.13 24.45 25.525 25.895000000000003 55-59 23.630000000000003 24.32 25.679999999999996 26.369999999999997 60-64 24.195 24.605 25.21 25.990000000000002 65-69 23.77 24.54 25.515 26.174999999999997 70-74 24.275 24.035 25.814999999999998 25.874999999999996 75-79 23.494999999999997 24.785 25.445 26.275 80-84 23.98 24.565 25.61 25.845000000000002 85-89 23.96 24.23 25.47 26.340000000000003 90-94 24.08 24.610000000000003 25.56 25.75 95-99 23.880000000000003 24.015 26.35 25.755 100-104 24.21 24.175 25.790000000000003 25.825 105-109 24.435000000000002 24.36 25.509999999999998 25.695 110-114 23.794999999999998 24.36 25.674999999999997 26.169999999999998 115-119 24.035 24.355 25.75 25.86 120-124 24.69 24.25 25.535000000000004 25.525 125-129 24.27 23.96 25.540000000000003 26.229999999999997 130-134 23.845 24.64 25.019999999999996 26.495 135-139 24.235 24.235 25.39 26.14 140-144 24.515 24.265 25.345000000000002 25.874999999999996 145-149 24.474999999999998 24.005000000000003 25.515 26.005 150-151 25.337500000000002 23.575 25.85 25.2375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 2.5 29 1.5 30 3.0 31 7.0 32 10.5 33 17.0 34 23.5 35 25.0 36 36.0 37 58.5 38 69.5 39 91.5 40 119.5 41 124.5 42 145.0 43 173.5 44 191.0 45 201.5 46 205.0 47 202.0 48 183.5 49 174.5 50 169.0 51 147.5 52 125.5 53 127.0 54 122.5 55 109.5 56 118.5 57 118.5 58 102.5 59 92.0 60 81.0 61 73.0 62 67.5 63 57.0 64 72.0 65 73.0 66 47.0 67 36.0 68 39.0 69 40.0 70 27.5 71 18.0 72 16.5 73 14.5 74 12.0 75 9.0 76 5.0 77 5.0 78 3.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11616161616162 98.125 2 0.7575757575757576 1.5 3 0.12626262626262627 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0125 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.025 0.0 0.025 0.0 0.0 82-83 0.025 0.0 0.025 0.0 0.0 84-85 0.025 0.0 0.025 0.0 0.0 86-87 0.037500000000000006 0.0 0.025 0.0 0.0 88-89 0.05 0.0 0.025 0.0 0.0 90-91 0.075 0.0 0.025 0.0 0.0 92-93 0.075 0.0 0.025 0.0 0.0 94-95 0.075 0.0 0.025 0.0 0.0 96-97 0.0875 0.0 0.025 0.0 0.0 98-99 0.1 0.0 0.025 0.0 0.0 100-101 0.1875 0.0 0.025 0.0 0.0 102-103 0.2375 0.0 0.025 0.0 0.0 104-105 0.2625 0.0 0.025 0.0 0.0 106-107 0.35 0.0 0.025 0.0 0.0 108-109 0.375 0.0 0.025 0.0 0.0 110-111 0.3875 0.0 0.025 0.0 0.0 112-113 0.48750000000000004 0.0 0.025 0.0 0.0 114-115 0.5875 0.0 0.025 0.0 0.0 116-117 0.675 0.0 0.025 0.0 0.0 118-119 0.7749999999999999 0.0 0.025 0.0 0.0 120-121 1.0125 0.0 0.025 0.0 0.0 122-123 1.1625 0.0 0.025 0.0 0.0 124-125 1.325 0.0 0.025 0.0 0.0 126-127 1.55 0.0 0.025 0.0 0.0 128-129 1.65 0.0 0.025 0.0 0.0 130-131 1.8375 0.0 0.025 0.0 0.0 132-133 2.0375 0.0 0.025 0.0 0.0 134-135 2.2750000000000004 0.0 0.025 0.0 0.0 136-137 2.4875 0.0 0.025 0.0 0.0 138-139 2.65 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGTCC 10 0.0068396386 144.9375 6 >>END_MODULE SRR6958221 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958221_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.269 33.0 33.0 34.0 31.0 34.0 2 32.05025 33.0 33.0 34.0 30.0 34.0 3 31.99075 33.0 33.0 34.0 30.0 34.0 4 32.1 33.0 33.0 34.0 31.0 34.0 5 31.9525 33.0 33.0 34.0 30.0 34.0 6 35.7885 38.0 37.0 38.0 31.0 38.0 7 36.05125 38.0 38.0 38.0 33.0 38.0 8 36.0825 38.0 38.0 38.0 33.0 38.0 9 36.29525 38.0 38.0 38.0 34.0 38.0 10-14 36.160000000000004 38.0 38.0 38.0 33.4 38.0 15-19 36.25600000000001 38.0 38.0 38.0 33.6 38.0 20-24 36.353750000000005 38.0 38.0 38.0 34.0 38.0 25-29 36.35594999999999 38.0 38.0 38.0 34.2 38.0 30-34 36.22565 38.0 38.0 38.0 33.6 38.0 35-39 36.05145 38.0 38.0 38.0 32.8 38.0 40-44 36.02905 38.0 38.0 38.0 32.6 38.0 45-49 35.93920000000001 38.0 38.0 38.0 32.6 38.0 50-54 35.9731 38.0 37.8 38.0 32.8 38.0 55-59 35.9072 38.0 37.8 38.0 32.6 38.0 60-64 35.7055 38.0 37.0 38.0 31.0 38.0 65-69 35.341899999999995 38.0 36.6 38.0 29.4 38.0 70-74 35.1513 38.0 36.4 38.0 28.6 38.0 75-79 35.3301 38.0 36.8 38.0 29.0 38.0 80-84 35.1799 38.0 36.4 38.0 29.0 38.0 85-89 35.06965 38.0 36.0 38.0 28.6 38.0 90-94 34.86315 38.0 35.8 38.0 27.4 38.0 95-99 34.66044999999999 38.0 35.4 38.0 26.4 38.0 100-104 34.245850000000004 38.0 35.0 38.0 23.6 38.0 105-109 33.97025 38.0 34.4 38.0 22.2 38.0 110-114 33.7656 38.0 34.0 38.0 20.6 38.0 115-119 33.6665 38.0 33.8 38.0 21.0 38.0 120-124 33.046350000000004 38.0 33.4 38.0 16.2 38.0 125-129 32.9335 38.0 33.0 38.0 15.0 38.0 130-134 32.0931 37.6 31.4 38.0 13.2 38.0 135-139 31.655849999999997 36.8 30.6 38.0 13.0 38.0 140-144 31.1017 36.0 31.0 38.0 13.0 38.0 145-149 28.700799999999997 34.6 24.8 38.0 2.0 38.0 150-151 22.59075 28.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 10.0 4 2.0 5 2.0 6 2.0 7 3.0 8 3.0 9 1.0 10 4.0 11 3.0 12 5.0 13 7.0 14 5.0 15 3.0 16 3.0 17 10.0 18 5.0 19 12.0 20 16.0 21 16.0 22 17.0 23 21.0 24 20.0 25 28.0 26 41.0 27 55.0 28 80.0 29 71.0 30 91.0 31 122.0 32 151.0 33 228.0 34 294.0 35 434.0 36 876.0 37 1332.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 20.674999999999997 11.700000000000001 27.975 2 30.825000000000003 23.65 24.675 20.849999999999998 3 23.974999999999998 25.525 27.525 22.975 4 26.700000000000003 30.0 19.425 23.875 5 27.1 31.924999999999997 19.15 21.825 6 25.224999999999998 33.225 19.625 21.925 7 23.150000000000002 18.525 34.050000000000004 24.275 8 25.174999999999997 22.900000000000002 23.5 28.425 9 24.85 22.6 25.424999999999997 27.125 10-14 26.064999999999998 25.895000000000003 22.56 25.480000000000004 15-19 26.87 25.430000000000003 23.415 24.285 20-24 25.7 25.319999999999997 24.060000000000002 24.92 25-29 25.81 25.35 24.01 24.83 30-34 26.215 24.884999999999998 23.79 25.11 35-39 25.929999999999996 25.31 23.51 25.25 40-44 26.205000000000002 24.51 23.419999999999998 25.865 45-49 26.435 25.314999999999998 23.205000000000002 25.045 50-54 26.47 24.42 24.02 25.09 55-59 26.63 25.215 23.44 24.715 60-64 26.055 25.230000000000004 24.05 24.665 65-69 26.465 24.2 23.885 25.45 70-74 27.175 24.42 23.669999999999998 24.735 75-79 25.845000000000002 24.81 24.505 24.84 80-84 26.0 24.779999999999998 24.335 24.884999999999998 85-89 26.375 25.115 23.3 25.21 90-94 25.945 25.215 24.59 24.25 95-99 26.165 24.955 24.235 24.645 100-104 26.375 24.72 24.465 24.44 105-109 26.55 25.21 24.11 24.13 110-114 26.515 25.264999999999997 24.104999999999997 24.115000000000002 115-119 26.740000000000002 25.085 23.724999999999998 24.45 120-124 27.0 26.025 23.595 23.380000000000003 125-129 26.8 25.765 23.86 23.575 130-134 26.895000000000003 25.724999999999998 23.72 23.66 135-139 26.665 25.580000000000002 24.37 23.385 140-144 26.595000000000002 25.985000000000003 24.265 23.155 145-149 27.12 25.095 24.11 23.674999999999997 150-151 26.8 26.025 24.212500000000002 22.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 0.5 27 0.5 28 1.5 29 1.5 30 2.5 31 6.5 32 10.0 33 9.5 34 10.5 35 16.5 36 27.0 37 42.5 38 64.5 39 91.0 40 101.0 41 106.0 42 142.0 43 170.5 44 165.0 45 167.5 46 184.0 47 183.0 48 172.0 49 169.0 50 167.0 51 148.0 52 136.5 53 136.5 54 124.0 55 115.5 56 107.5 57 102.5 58 100.5 59 113.5 60 111.0 61 93.5 62 95.5 63 86.0 64 71.5 65 70.5 66 72.5 67 61.5 68 50.5 69 42.0 70 33.0 71 30.5 72 26.0 73 21.0 74 15.5 75 8.0 76 2.0 77 2.0 78 3.0 79 1.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83307965499746 97.39999999999999 2 0.91324200913242 1.7999999999999998 3 0.20294266869609334 0.6 4 0.050735667174023336 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7749999999999999 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1375 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.575 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.8875 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCGTG 10 0.006830828 145.0 8 TGCCAAT 10 0.006830828 145.0 6 ATGCCAA 10 0.006830828 145.0 5 GTGACTT 10 0.006830828 145.0 3 AGTGACT 10 0.006830828 145.0 2 GCCAATG 10 0.006830828 145.0 7 TTGCCGT 10 0.006830828 145.0 7 >>END_MODULE Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175628 spots for SRR6958221.sra Written 1175628 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra Read 1175616 spots for SRR6958221.sra Written 1175616 spots for SRR6958221.sra SRR ids: ['SRR6958221.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uy8g7_2v SRR6958221.sra spots: 23512332 blocks: [[1, 1175616], [1175617, 2351232], [2351233, 3526848], [3526849, 4702464], [4702465, 5878080], [5878081, 7053696], [7053697, 8229312], [8229313, 9404928], [9404929, 10580544], [10580545, 11756160], [11756161, 12931776], [12931777, 14107392], [14107393, 15283008], [15283009, 16458624], [16458625, 17634240], [17634241, 18809856], [18809857, 19985472], [19985473, 21161088], [21161089, 22336704], [22336705, 23512332]] SRR6958221 file size 7945857 SRR6958221 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958221 SRR6958221_1.fastq SRR6958221_2.fastq Input file: SRR6958221_1.fastq Paired file: SRR6958221_2.fastq trimmed: SRR6958221-trimmed-pair1.fastq, SRR6958221-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:38:14 2024 >> started Fri Dec 6 16:38:43 2024 >> done (29.221s) 23512332 read pairs processed; of these: 63530 ( 0.27%) short read pairs filtered out after trimming by size control 59064 ( 0.25%) empty read pairs filtered out after trimming by size control 23389738 (99.48%) read pairs available; of these: 11234969 (48.03%) trimmed read pairs available after processing 12154769 (51.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 6 0.00% 21 7 0.00% 22 4 0.00% 23 13 0.00% 24 6 0.00% 25 17 0.00% 26 7 0.00% 27 13 0.00% 28 11 0.00% 29 15 0.00% 30 11 0.00% 31 24 0.00% 32 7 0.00% 33 13 0.00% 34 26 0.00% 35 19 0.00% 36 22 0.00% 37 27 0.00% 38 32 0.00% 39 28 0.00% 40 21 0.00% 41 19 0.00% 42 35 0.00% 43 37 0.00% 44 47 0.00% 45 42 0.00% 46 57 0.00% 47 58 0.00% 48 54 0.00% 49 73 0.00% 50 73 0.00% 51 87 0.00% 52 94 0.00% 53 116 0.00% 54 119 0.00% 55 133 0.00% 56 153 0.00% 57 165 0.00% 58 162 0.00% 59 197 0.00% 60 216 0.00% 61 220 0.00% 62 271 0.00% 63 272 0.00% 64 276 0.00% 65 344 0.00% 66 380 0.00% 67 369 0.00% 68 447 0.00% 69 493 0.00% 70 542 0.00% 71 600 0.00% 72 726 0.00% 73 788 0.00% 74 889 0.00% 75 960 0.00% 76 1013 0.00% 77 1219 0.01% 78 1301 0.01% 79 1418 0.01% 80 1625 0.01% 81 1737 0.01% 82 2168 0.01% 83 2644 0.01% 84 5091 0.02% 85 6431 0.03% 86 6326 0.03% 87 6300 0.03% 88 6516 0.03% 89 6449 0.03% 90 6508 0.03% 91 6757 0.03% 92 7152 0.03% 93 7344 0.03% 94 7799 0.03% 95 8308 0.04% 96 8591 0.04% 97 8871 0.04% 98 9080 0.04% 99 9763 0.04% 100 10189 0.04% 101 10798 0.05% 102 11532 0.05% 103 12296 0.05% 104 12918 0.06% 105 13689 0.06% 106 14195 0.06% 107 15359 0.07% 108 16252 0.07% 109 16875 0.07% 110 17737 0.08% 111 18938 0.08% 112 20366 0.09% 113 21329 0.09% 114 22455 0.10% 115 23644 0.10% 116 25281 0.11% 117 26239 0.11% 118 27862 0.12% 119 28831 0.12% 120 30623 0.13% 121 31821 0.14% 122 33524 0.14% 123 35767 0.15% 124 38108 0.16% 125 40288 0.17% 126 42350 0.18% 127 45550 0.19% 128 47940 0.20% 129 50361 0.22% 130 54436 0.23% 131 57090 0.24% 132 60645 0.26% 133 65259 0.28% 134 69825 0.30% 135 74280 0.32% 136 80025 0.34% 137 86120 0.37% 138 93259 0.40% 139 101844 0.44% 140 111108 0.48% 141 124029 0.53% 142 140638 0.60% 143 161938 0.69% 144 192240 0.82% 145 236090 1.01% 146 304949 1.30% 147 423942 1.81% 148 660148 2.82% 149 1299017 5.55% 150 5934714 25.37% 151 12154769 51.97% 23389738 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=21 prefix-density=1.01 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=40.47 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=24 prefix-density=0.69 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=295.88 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=12.9 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958221 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:39:26 Started mapping on | Dec 06 16:39:26 Finished on | Dec 06 16:41:53 Mapping speed, Million of reads per hour | 572.81 Number of input reads | 23389738 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 22336040 Uniquely mapped reads % | 95.50% Average mapped length | 295.59 Number of splices: Total | 26468365 Number of splices: Annotated (sjdb) | 24926120 Number of splices: GT/AG | 26108451 Number of splices: GC/AG | 308741 Number of splices: AT/AC | 8787 Number of splices: Non-canonical | 42386 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253887 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 18691 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 836973 836973 836973 N_multimapping 253887 253887 253887 N_noFeature 567081 21657515 717857 N_ambiguous 613045 2828 86287 UnstrandedReadsAssigned:21155914 PositiveStrandReadsAssigned:675697 NegativeStrandReadsAssigned:21531896 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958221 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958221-trimmed-pair1.fastq SRR6958221-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,389,738 reads, 21,517,187 reads pseudoaligned [quant] estimated average fragment length: 265.859 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52973 SRR6958221.ke.tsv 35125 SRR6958221.se.tsv 88098 total ==> SRR6958221.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.675 0 0 PNS24247 1044 779.141 62.239 5.28214 PNS24249 1928 1663.14 53.4952 2.12691 PNS24246 1044 779.141 62.239 5.28214 PNS24248 1044 779.141 62.239 5.28214 PNS24244 1471 1206.14 30.7877 1.68788 PNS24243 293 80.1085 1 0.825439 KQK14069 1603 1338.14 8564.81 423.233 KQK14071 474 222.228 104.456 31.081 ==> SRR6958221.se.tsv <== BRADI_1g14170v3 9476 BRADI_1g53295v3 922 BRADI_1g59795v3 65 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 330 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 234 BRADI_1g48960v3 0 SRR6958221 completed mapping pipeline successfully