Starting /dee2/code/volunteer_pipeline.sh SRR6958222 current disk space = 1550577455104 free memory = 1600622812 SRR6958222 SRAfilesize e1a219b82cfc1065e12cdab3459fb58a SRR6958222.sra SRR6958222.sra file validated SRR6958222 is paired end SRR6958222 is conventional basespace SRR6958222 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958222_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.1515 18.0 18.0 32.0 18.0 33.0 2 21.00575 18.0 18.0 25.0 18.0 32.0 3 27.1755 27.0 25.0 32.0 18.0 32.0 4 26.63325 29.0 25.0 31.0 15.0 33.0 5 29.55075 32.0 30.0 33.0 15.0 33.0 6 35.41375 37.0 35.0 38.0 30.0 38.0 7 36.241 38.0 37.0 38.0 33.0 38.0 8 36.762 38.0 38.0 38.0 34.0 38.0 9 37.11225 38.0 38.0 38.0 36.0 38.0 10-14 37.241099999999996 38.0 38.0 38.0 36.4 38.0 15-19 37.3202 38.0 38.0 38.0 37.0 38.0 20-24 37.23010000000001 38.0 38.0 38.0 36.4 38.0 25-29 37.0368 38.0 38.0 38.0 36.0 38.0 30-34 36.72555 38.0 38.0 38.0 34.4 38.0 35-39 36.66645 38.0 38.0 38.0 34.6 38.0 40-44 36.76039999999999 38.0 38.0 38.0 34.8 38.0 45-49 36.702 38.0 38.0 38.0 34.6 38.0 50-54 36.5052 38.0 38.0 38.0 33.6 38.0 55-59 36.267849999999996 38.0 37.4 38.0 33.0 38.0 60-64 36.6629 38.0 38.0 38.0 34.2 38.0 65-69 36.4308 38.0 37.8 38.0 33.6 38.0 70-74 36.03025 38.0 37.0 38.0 31.8 38.0 75-79 35.94285 38.0 37.0 38.0 31.6 38.0 80-84 35.8466 38.0 37.0 38.0 31.2 38.0 85-89 35.8346 38.0 36.6 38.0 31.4 38.0 90-94 35.8635 38.0 36.8 38.0 31.6 38.0 95-99 35.23855 38.0 35.8 38.0 28.4 38.0 100-104 34.96715 38.0 35.2 38.0 27.6 38.0 105-109 34.70805 38.0 35.0 38.0 26.2 38.0 110-114 34.441449999999996 38.0 34.4 38.0 24.2 38.0 115-119 34.05045 38.0 34.0 38.0 23.0 38.0 120-124 33.799099999999996 38.0 33.8 38.0 21.0 38.0 125-129 33.6674 38.0 33.8 38.0 20.6 38.0 130-134 33.70975 38.0 33.8 38.0 21.2 38.0 135-139 31.811499999999995 36.0 30.2 38.0 15.2 38.0 140-144 31.222699999999996 36.0 30.0 38.0 13.0 38.0 145-149 29.846600000000002 35.2 28.0 38.0 8.6 38.0 150-151 24.553625 33.0 8.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 6.0 18 2.0 19 6.0 20 4.0 21 10.0 22 7.0 23 13.0 24 22.0 25 32.0 26 31.0 27 55.0 28 53.0 29 92.0 30 106.0 31 134.0 32 187.0 33 226.0 34 390.0 35 573.0 36 1125.0 37 921.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.00591875168146 15.119720204465967 6.752757600215227 44.12160344363734 2 19.825 17.925 29.15 33.1 3 19.275000000000002 14.649999999999999 24.45 41.625 4 23.1 20.349999999999998 23.825 32.725 5 23.599999999999998 27.325 23.125 25.95 6 25.35 29.549999999999997 22.15 22.95 7 18.575 24.375 36.8 20.25 8 22.125 25.074999999999996 27.224999999999998 25.575 9 20.7 23.625 32.324999999999996 23.35 10-14 22.845 25.8 26.005 25.35 15-19 22.88 24.315 26.384999999999998 26.419999999999998 20-24 22.945 25.230000000000004 26.045 25.779999999999998 25-29 23.43 24.745 25.8 26.025 30-34 23.845 24.805 25.435000000000002 25.915 35-39 23.405 24.735 25.759999999999998 26.1 40-44 23.145 25.014999999999997 26.31 25.53 45-49 23.445 24.995 25.22 26.340000000000003 50-54 23.44 24.83 25.655 26.075 55-59 23.645 24.935 25.540000000000003 25.88 60-64 23.765 25.22 25.259999999999998 25.755 65-69 24.09 24.34 25.430000000000003 26.14 70-74 23.94 24.035 26.08 25.945 75-79 24.01 24.18 25.915 25.895000000000003 80-84 23.810000000000002 24.884999999999998 25.2 26.105 85-89 23.97 24.285 25.180000000000003 26.565 90-94 23.895 24.465 25.6 26.040000000000003 95-99 23.595 24.58 25.575 26.25 100-104 23.919999999999998 24.88 25.355 25.845000000000002 105-109 23.785 24.310000000000002 25.845000000000002 26.06 110-114 23.87 24.04 25.490000000000002 26.6 115-119 23.61 24.515 25.775 26.1 120-124 24.265 24.104999999999997 25.695 25.935000000000002 125-129 23.66 24.33 25.759999999999998 26.25 130-134 24.29 24.755 25.095 25.86 135-139 24.72 24.29 25.85 25.14 140-144 24.19 24.404999999999998 25.009999999999998 26.395000000000003 145-149 24.0 24.26 25.5 26.240000000000002 150-151 24.25 23.8875 26.337500000000002 25.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.5 27 3.0 28 2.5 29 3.0 30 4.0 31 6.0 32 11.5 33 14.5 34 17.5 35 25.5 36 35.5 37 53.5 38 69.5 39 82.5 40 106.5 41 138.5 42 168.5 43 189.0 44 184.0 45 194.0 46 204.0 47 207.0 48 201.0 49 193.5 50 183.0 51 151.5 52 148.0 53 140.0 54 118.0 55 103.0 56 98.5 57 90.0 58 79.0 59 86.0 60 88.5 61 74.0 62 62.5 63 66.5 64 65.0 65 56.0 66 53.5 67 48.0 68 41.0 69 28.0 70 19.5 71 19.5 72 18.0 73 15.0 74 11.0 75 7.5 76 5.5 77 4.0 78 2.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.074999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.8624999999999998 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.75 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACTCC 10 0.006841402 144.925 145 GTTACAT 10 0.006841402 144.925 3 CTTCTAG 10 0.006841402 144.925 145 >>END_MODULE SRR6958222 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958222_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46425 33.0 33.0 34.0 32.0 34.0 2 32.3935 33.0 33.0 34.0 31.0 34.0 3 32.2955 33.0 33.0 34.0 31.0 34.0 4 32.41625 33.0 33.0 34.0 31.0 34.0 5 32.255 33.0 33.0 34.0 31.0 34.0 6 36.16725 38.0 38.0 38.0 33.0 38.0 7 36.4005 38.0 38.0 38.0 34.0 38.0 8 36.3595 38.0 38.0 38.0 34.0 38.0 9 36.42275 38.0 38.0 38.0 34.0 38.0 10-14 36.37585 38.0 38.0 38.0 34.0 38.0 15-19 36.55685 38.0 38.0 38.0 34.4 38.0 20-24 36.619550000000004 38.0 38.0 38.0 34.8 38.0 25-29 36.64215 38.0 38.0 38.0 35.0 38.0 30-34 36.48535 38.0 38.0 38.0 34.4 38.0 35-39 36.384949999999996 38.0 38.0 38.0 33.8 38.0 40-44 36.29725 38.0 38.0 38.0 33.6 38.0 45-49 36.27875 38.0 38.0 38.0 34.0 38.0 50-54 36.174 38.0 38.0 38.0 33.6 38.0 55-59 36.1543 38.0 38.0 38.0 33.2 38.0 60-64 36.079950000000004 38.0 37.8 38.0 33.0 38.0 65-69 35.7613 38.0 37.2 38.0 31.0 38.0 70-74 35.5692 38.0 37.0 38.0 30.2 38.0 75-79 35.6828 38.0 37.0 38.0 31.0 38.0 80-84 35.520500000000006 38.0 37.0 38.0 30.2 38.0 85-89 35.52315 38.0 36.8 38.0 30.6 38.0 90-94 35.20885 38.0 36.0 38.0 29.0 38.0 95-99 35.0246 38.0 36.0 38.0 28.6 38.0 100-104 34.6931 38.0 35.2 38.0 26.2 38.0 105-109 34.39025 38.0 34.8 38.0 24.6 38.0 110-114 34.05715 38.0 34.6 38.0 22.8 38.0 115-119 33.969950000000004 38.0 34.4 38.0 22.8 38.0 120-124 33.46515 38.0 33.8 38.0 19.4 38.0 125-129 33.36280000000001 38.0 33.8 38.0 17.8 38.0 130-134 32.642250000000004 38.0 31.6 38.0 15.0 38.0 135-139 32.021550000000005 37.2 30.8 38.0 13.0 38.0 140-144 31.5957 36.2 31.0 38.0 13.0 38.0 145-149 29.696549999999995 35.8 28.2 38.0 6.0 38.0 150-151 23.6535 30.5 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 5.0 4 1.0 5 1.0 6 1.0 7 3.0 8 6.0 9 1.0 10 3.0 11 4.0 12 2.0 13 2.0 14 5.0 15 3.0 16 6.0 17 5.0 18 12.0 19 5.0 20 12.0 21 11.0 22 14.0 23 24.0 24 19.0 25 25.0 26 31.0 27 46.0 28 54.0 29 75.0 30 82.0 31 110.0 32 162.0 33 196.0 34 287.0 35 484.0 36 842.0 37 1444.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.25 18.75 12.950000000000001 31.05 2 30.625000000000004 25.25 23.599999999999998 20.525 3 24.25 27.075 25.224999999999998 23.45 4 26.224999999999998 31.424999999999997 19.575 22.775000000000002 5 27.500000000000004 33.175 18.775 20.549999999999997 6 25.874999999999996 33.725 20.025000000000002 20.375 7 24.0 20.0 32.35 23.65 8 23.75 22.85 24.65 28.749999999999996 9 24.725 23.025000000000002 26.825 25.424999999999997 10-14 25.86 25.755 22.785 25.6 15-19 26.165 25.130000000000003 23.880000000000003 24.825 20-24 25.919999999999998 25.430000000000003 24.044999999999998 24.605 25-29 26.0 25.71 23.72 24.57 30-34 25.82 25.419999999999998 24.14 24.62 35-39 25.865 25.36 24.175 24.6 40-44 25.95 25.759999999999998 23.64 24.65 45-49 26.525 25.205 24.075 24.195 50-54 25.779999999999998 25.61 24.26 24.349999999999998 55-59 26.229999999999997 25.275 23.785 24.709999999999997 60-64 26.185000000000002 25.515 23.94 24.36 65-69 26.314999999999998 25.314999999999998 24.19 24.18 70-74 26.495 24.9 24.185000000000002 24.42 75-79 26.05 24.85 24.59 24.51 80-84 26.46 25.240000000000002 24.215 24.085 85-89 26.43 25.595000000000002 23.685000000000002 24.29 90-94 26.275 25.735000000000003 23.849999999999998 24.14 95-99 25.974999999999998 25.779999999999998 23.905 24.34 100-104 26.705000000000002 25.124999999999996 24.08 24.09 105-109 26.26 25.19 24.529999999999998 24.02 110-114 26.384999999999998 25.545 24.165 23.905 115-119 26.275 25.755 23.82 24.15 120-124 26.27 25.255 24.349999999999998 24.125 125-129 26.979999999999997 25.735000000000003 23.865 23.419999999999998 130-134 26.405 25.490000000000002 23.78 24.325 135-139 26.540000000000003 25.990000000000002 23.974999999999998 23.494999999999997 140-144 27.24 25.46 24.240000000000002 23.06 145-149 27.155 25.865 24.015 22.965 150-151 27.437499999999996 24.7375 24.0625 23.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 1.0 26 3.0 27 3.0 28 2.5 29 6.0 30 6.5 31 5.0 32 6.5 33 10.0 34 18.0 35 25.5 36 32.0 37 40.0 38 58.0 39 77.0 40 92.5 41 118.0 42 150.0 43 172.0 44 177.0 45 194.5 46 210.5 47 194.5 48 183.5 49 185.5 50 173.5 51 158.0 52 137.5 53 117.0 54 110.0 55 113.0 56 112.5 57 114.5 58 99.0 59 84.5 60 86.5 61 85.5 62 86.5 63 74.5 64 67.5 65 67.5 66 57.5 67 48.5 68 42.5 69 36.5 70 38.5 71 32.0 72 22.5 73 18.0 74 16.0 75 11.5 76 6.0 77 3.0 78 2.5 79 3.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01315789473685 97.82499999999999 2 0.8603238866396761 1.7000000000000002 3 0.07591093117408906 0.22499999999999998 4 0.0 0.0 5 0.05060728744939271 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCC 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0125 0.0 0.0 96-97 0.2375 0.0 0.025 0.0 0.0 98-99 0.3125 0.0 0.025 0.0 0.0 100-101 0.3875 0.0 0.025 0.0 0.0 102-103 0.4875 0.0 0.025 0.0 0.0 104-105 0.55 0.0 0.025 0.0 0.0 106-107 0.6 0.0 0.025 0.0 0.0 108-109 0.6875 0.0 0.025 0.0 0.0 110-111 0.775 0.0 0.025 0.0 0.0 112-113 0.9125 0.0 0.025 0.0 0.0 114-115 1.0 0.0 0.025 0.0 0.0 116-117 1.2125 0.0 0.025 0.0 0.0 118-119 1.4125 0.0 0.025 0.0 0.0 120-121 1.6 0.0 0.025 0.0 0.0 122-123 1.7 0.0 0.025 0.0 0.0 124-125 1.9125 0.0 0.025 0.0 0.0 126-127 2.1125 0.0 0.025 0.0 0.0 128-129 2.3875 0.0 0.025 0.0 0.0 130-131 2.9000000000000004 0.0 0.025 0.0 0.0 132-133 3.125 0.0 0.025 0.0 0.0 134-135 3.4375 0.0 0.025 0.0 0.0 136-137 3.9000000000000004 0.0 0.025 0.0 0.0 138-139 4.1375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGGCT 10 0.006830828 145.0 1 >>END_MODULE Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010463 spots for SRR6958222.sra Written 1010463 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra Read 1010456 spots for SRR6958222.sra Written 1010456 spots for SRR6958222.sra SRR ids: ['SRR6958222.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j8i_6p01 SRR6958222.sra spots: 20209127 blocks: [[1, 1010456], [1010457, 2020912], [2020913, 3031368], [3031369, 4041824], [4041825, 5052280], [5052281, 6062736], [6062737, 7073192], [7073193, 8083648], [8083649, 9094104], [9094105, 10104560], [10104561, 11115016], [11115017, 12125472], [12125473, 13135928], [13135929, 14146384], [14146385, 15156840], [15156841, 16167296], [16167297, 17177752], [17177753, 18188208], [18188209, 19198664], [19198665, 20209127]] SRR6958222 file size 6826509 SRR6958222 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958222 SRR6958222_1.fastq SRR6958222_2.fastq Input file: SRR6958222_1.fastq Paired file: SRR6958222_2.fastq trimmed: SRR6958222-trimmed-pair1.fastq, SRR6958222-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:40:14 2024 >> started Fri Dec 6 16:40:36 2024 >> done (22.574s) 20209127 read pairs processed; of these: 42427 ( 0.21%) short read pairs filtered out after trimming by size control 35345 ( 0.17%) empty read pairs filtered out after trimming by size control 20131355 (99.62%) read pairs available; of these: 9339148 (46.39%) trimmed read pairs available after processing 10792207 (53.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 4 0.00% 22 5 0.00% 23 8 0.00% 24 6 0.00% 25 4 0.00% 26 9 0.00% 27 10 0.00% 28 10 0.00% 29 13 0.00% 30 15 0.00% 31 16 0.00% 32 12 0.00% 33 17 0.00% 34 15 0.00% 35 13 0.00% 36 18 0.00% 37 18 0.00% 38 17 0.00% 39 19 0.00% 40 22 0.00% 41 24 0.00% 42 25 0.00% 43 24 0.00% 44 32 0.00% 45 34 0.00% 46 38 0.00% 47 33 0.00% 48 42 0.00% 49 55 0.00% 50 68 0.00% 51 74 0.00% 52 92 0.00% 53 86 0.00% 54 99 0.00% 55 100 0.00% 56 101 0.00% 57 107 0.00% 58 119 0.00% 59 152 0.00% 60 178 0.00% 61 189 0.00% 62 187 0.00% 63 216 0.00% 64 274 0.00% 65 274 0.00% 66 304 0.00% 67 300 0.00% 68 398 0.00% 69 390 0.00% 70 470 0.00% 71 524 0.00% 72 610 0.00% 73 704 0.00% 74 691 0.00% 75 809 0.00% 76 980 0.00% 77 957 0.00% 78 1074 0.01% 79 1213 0.01% 80 1381 0.01% 81 1634 0.01% 82 1790 0.01% 83 2142 0.01% 84 3650 0.02% 85 4638 0.02% 86 4588 0.02% 87 4697 0.02% 88 4895 0.02% 89 5037 0.03% 90 5204 0.03% 91 5509 0.03% 92 5902 0.03% 93 6041 0.03% 94 6643 0.03% 95 7006 0.03% 96 7290 0.04% 97 7804 0.04% 98 8243 0.04% 99 8602 0.04% 100 9347 0.05% 101 9527 0.05% 102 10295 0.05% 103 11044 0.05% 104 11828 0.06% 105 12505 0.06% 106 13129 0.07% 107 13897 0.07% 108 14560 0.07% 109 15351 0.08% 110 16112 0.08% 111 17015 0.08% 112 17889 0.09% 113 18941 0.09% 114 20343 0.10% 115 21443 0.11% 116 22588 0.11% 117 23528 0.12% 118 24784 0.12% 119 26159 0.13% 120 27137 0.13% 121 28523 0.14% 122 30065 0.15% 123 31884 0.16% 124 33880 0.17% 125 35980 0.18% 126 37883 0.19% 127 39867 0.20% 128 42217 0.21% 129 44344 0.22% 130 46824 0.23% 131 50052 0.25% 132 52456 0.26% 133 55956 0.28% 134 59591 0.30% 135 63471 0.32% 136 68056 0.34% 137 73079 0.36% 138 77542 0.39% 139 84319 0.42% 140 91998 0.46% 141 101131 0.50% 142 113509 0.56% 143 129952 0.65% 144 152602 0.76% 145 186373 0.93% 146 237602 1.18% 147 327027 1.62% 148 508616 2.53% 149 1019886 5.07% 150 5042039 25.05% 151 10792207 53.61% 20131355 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=18 prefix-density=0.79 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=28.36 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=22 prefix-density=0.61 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=52.73 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=11.0 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958222 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:41:30 Started mapping on | Dec 06 16:41:30 Finished on | Dec 06 16:43:38 Mapping speed, Million of reads per hour | 566.19 Number of input reads | 20131355 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19451895 Uniquely mapped reads % | 96.62% Average mapped length | 295.66 Number of splices: Total | 22737205 Number of splices: Annotated (sjdb) | 21358045 Number of splices: GT/AG | 22420709 Number of splices: GC/AG | 267676 Number of splices: AT/AC | 7794 Number of splices: Non-canonical | 41026 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226678 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 11056 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.86% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 474488 474488 474488 N_multimapping 226678 226678 226678 N_noFeature 568074 18877943 707555 N_ambiguous 507810 2539 74099 UnstrandedReadsAssigned:18376011 PositiveStrandReadsAssigned:571413 NegativeStrandReadsAssigned:18670241 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958222 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958222-trimmed-pair1.fastq SRR6958222-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,131,355 reads, 18,659,389 reads pseudoaligned [quant] estimated average fragment length: 255.455 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR6958222.ke.tsv 35125 SRR6958222.se.tsv 88098 total ==> SRR6958222.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.104 0 0 PNS24247 1044 789.545 54.1173 5.28193 PNS24249 1928 1673.55 74.0665 3.4105 PNS24246 1044 789.545 54.1173 5.28193 PNS24248 1044 789.545 54.1173 5.28193 PNS24244 1471 1216.55 36.5816 2.31722 PNS24243 293 83.4432 0 0 KQK14069 1603 1348.55 8130.99 464.634 KQK14071 474 230.098 90.7144 30.3806 ==> SRR6958222.se.tsv <== BRADI_1g14170v3 8816 BRADI_1g53295v3 1000 BRADI_1g59795v3 64 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 265 BRADI_1g74790v3 105 BRADI_1g09890v3 0 BRADI_1g77505v3 223 BRADI_1g48960v3 0 SRR6958222 completed mapping pipeline successfully