Starting /dee2/code/volunteer_pipeline.sh SRR6958223 current disk space = 1550637641728 free memory = 1364086240 SRR6958223 SRAfilesize f80c9239959f124372d69e04d3ea2862 SRR6958223.sra SRR6958223.sra file validated SRR6958223 is paired end SRR6958223 is conventional basespace SRR6958223 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958223_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.10775 30.0 18.0 33.0 18.0 33.0 2 27.984 29.0 27.0 33.0 18.0 33.0 3 29.6265 31.0 28.0 33.0 25.0 33.0 4 31.208 33.0 31.0 33.0 28.0 33.0 5 31.821 33.0 31.0 33.0 29.0 34.0 6 36.484 38.0 37.0 38.0 34.0 38.0 7 36.99525 38.0 38.0 38.0 35.0 38.0 8 36.91675 38.0 38.0 38.0 35.0 38.0 9 36.9215 38.0 38.0 38.0 35.0 38.0 10-14 37.07215 38.0 38.0 38.0 36.0 38.0 15-19 37.084849999999996 38.0 38.0 38.0 36.0 38.0 20-24 37.33425 38.0 38.0 38.0 37.0 38.0 25-29 37.23595 38.0 38.0 38.0 36.6 38.0 30-34 37.03245 38.0 38.0 38.0 35.6 38.0 35-39 36.99679999999999 38.0 38.0 38.0 35.6 38.0 40-44 36.83265 38.0 38.0 38.0 35.2 38.0 45-49 37.14515 38.0 38.0 38.0 36.0 38.0 50-54 37.0486 38.0 38.0 38.0 35.8 38.0 55-59 36.51855 38.0 37.6 38.0 34.0 38.0 60-64 36.00785 38.0 37.0 38.0 31.4 38.0 65-69 35.738350000000004 38.0 36.2 38.0 30.0 38.0 70-74 35.705749999999995 38.0 36.2 38.0 30.0 38.0 75-79 36.1163 38.0 37.0 38.0 32.2 38.0 80-84 36.1506 38.0 36.8 38.0 32.4 38.0 85-89 35.6868 38.0 36.4 38.0 30.4 38.0 90-94 35.91685 38.0 36.8 38.0 32.0 38.0 95-99 35.55525 38.0 36.2 38.0 30.4 38.0 100-104 35.075649999999996 38.0 35.4 38.0 28.0 38.0 105-109 34.761849999999995 38.0 34.8 38.0 26.8 38.0 110-114 34.11675 38.0 34.0 38.0 23.6 38.0 115-119 33.16195 37.2 32.8 38.0 15.0 38.0 120-124 33.27645 37.2 33.2 38.0 19.8 38.0 125-129 33.8054 37.8 33.8 38.0 22.4 38.0 130-134 34.15599999999999 38.0 34.0 38.0 23.6 38.0 135-139 33.8643 38.0 34.0 38.0 22.6 38.0 140-144 32.9051 37.0 33.0 38.0 17.0 38.0 145-149 31.029149999999998 36.0 30.2 38.0 9.0 38.0 150-151 26.148125 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 3.0 17 1.0 18 5.0 19 2.0 20 1.0 21 2.0 22 5.0 23 8.0 24 13.0 25 13.0 26 20.0 27 44.0 28 62.0 29 76.0 30 88.0 31 129.0 32 154.0 33 228.0 34 381.0 35 607.0 36 1080.0 37 1072.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.04448105436573 10.186710598572212 10.735859417902253 40.0329489291598 2 23.05 11.85 34.8 30.3 3 24.0 14.549999999999999 24.025 37.425000000000004 4 26.375 22.6 21.95 29.075 5 27.24543407555667 26.194645984488368 24.0180135101326 22.54190642982237 6 23.025000000000002 30.95 23.875 22.15 7 18.2 24.6 39.25 17.95 8 20.200000000000003 23.95 29.2 26.650000000000002 9 19.575 22.825 33.0 24.6 10-14 22.32 26.58 26.029999999999998 25.069999999999997 15-19 22.725 25.2 26.505000000000003 25.569999999999997 20-24 22.855 25.955000000000002 26.11 25.080000000000002 25-29 22.82 25.505 26.55 25.124999999999996 30-34 22.675 25.169999999999998 26.615 25.540000000000003 35-39 22.915 25.264999999999997 26.529999999999998 25.290000000000003 40-44 22.695 25.290000000000003 26.135 25.88 45-49 22.39 25.15 26.35 26.11 50-54 23.080000000000002 24.884999999999998 25.885 26.150000000000002 55-59 22.869999999999997 24.83 26.5 25.8 60-64 23.325000000000003 25.259999999999998 25.775 25.64 65-69 23.080000000000002 25.380000000000003 26.395000000000003 25.145 70-74 22.93 24.79 26.229999999999997 26.05 75-79 23.205000000000002 25.040000000000003 25.88 25.874999999999996 80-84 22.825 25.535000000000004 25.53 26.11 85-89 23.145 24.755 25.915 26.185000000000002 90-94 23.195 25.275 26.045 25.485000000000003 95-99 23.26 24.87 26.200000000000003 25.669999999999998 100-104 23.91 24.615000000000002 26.325 25.15 105-109 23.49 24.9 26.045 25.564999999999998 110-114 22.985 25.4 25.900000000000002 25.715 115-119 23.65 24.715 26.005 25.629999999999995 120-124 23.330000000000002 25.064999999999998 25.61 25.995 125-129 23.005 25.27 25.840000000000003 25.885 130-134 23.69 24.48 26.27 25.56 135-139 23.9 24.955 25.44 25.705 140-144 24.035 25.56 24.88 25.525 145-149 23.405 25.34 25.64 25.615 150-151 23.775 25.7625 25.4 25.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 2.0 28 4.5 29 5.0 30 4.5 31 6.0 32 12.5 33 16.0 34 21.0 35 25.0 36 45.0 37 71.5 38 87.0 39 107.5 40 127.0 41 154.0 42 181.5 43 196.5 44 206.5 45 205.0 46 209.5 47 208.5 48 197.0 49 182.0 50 171.0 51 169.5 52 139.5 53 119.0 54 112.5 55 104.0 56 98.0 57 92.5 58 80.5 59 75.5 60 82.0 61 68.0 62 58.0 63 59.0 64 48.5 65 39.5 66 35.5 67 33.5 68 33.0 69 27.5 70 24.5 71 16.5 72 12.0 73 11.0 74 6.0 75 3.5 76 1.5 77 1.0 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.95 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6499999999999999 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.05 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.2249999999999996 0.0 0.0 0.0 0.0 120-121 2.4 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.9000000000000004 0.0 0.0 0.0 0.0 126-127 3.1875 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.1625 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 5.0125 0.0 0.0 0.0 0.0 138-139 5.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATGA 10 0.006843168 144.91249 3 >>END_MODULE SRR6958223 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958223_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74525 33.0 33.0 34.0 32.0 34.0 2 32.796 33.0 33.0 34.0 32.0 34.0 3 32.76975 33.0 33.0 34.0 32.0 34.0 4 32.69925 33.0 33.0 34.0 32.0 34.0 5 32.76175 34.0 33.0 34.0 32.0 34.0 6 36.9365 38.0 38.0 38.0 35.0 38.0 7 36.6105 38.0 38.0 38.0 35.0 38.0 8 36.67375 38.0 38.0 38.0 35.0 38.0 9 36.75525 38.0 38.0 38.0 35.0 38.0 10-14 36.7362 38.0 38.0 38.0 35.0 38.0 15-19 36.85125 38.0 38.0 38.0 36.0 38.0 20-24 36.9097 38.0 38.0 38.0 35.8 38.0 25-29 36.7908 38.0 38.0 38.0 35.2 38.0 30-34 36.6056 38.0 38.0 38.0 34.4 38.0 35-39 36.59245 38.0 38.0 38.0 34.4 38.0 40-44 36.48135 38.0 38.0 38.0 34.0 38.0 45-49 36.62555 38.0 38.0 38.0 34.6 38.0 50-54 36.41185 38.0 38.0 38.0 33.8 38.0 55-59 36.531400000000005 38.0 38.0 38.0 34.2 38.0 60-64 36.39555 38.0 38.0 38.0 33.8 38.0 65-69 36.39475 38.0 38.0 38.0 33.8 38.0 70-74 36.306850000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.0975 38.0 37.6 38.0 32.6 38.0 80-84 35.8307 38.0 37.0 38.0 32.0 38.0 85-89 35.863099999999996 38.0 37.0 38.0 32.6 38.0 90-94 35.939800000000005 38.0 37.2 38.0 33.0 38.0 95-99 35.786699999999996 38.0 37.0 38.0 32.0 38.0 100-104 35.171350000000004 38.0 36.2 38.0 28.8 38.0 105-109 34.65435 38.0 35.0 38.0 26.0 38.0 110-114 34.16845000000001 38.0 34.4 38.0 23.0 38.0 115-119 34.0693 38.0 34.2 38.0 23.0 38.0 120-124 33.854 38.0 34.0 38.0 22.6 38.0 125-129 32.882600000000004 37.6 33.0 38.0 16.2 38.0 130-134 32.068349999999995 36.2 31.4 38.0 14.2 38.0 135-139 30.74525 35.4 27.6 38.0 13.4 38.0 140-144 30.31835 35.0 27.4 38.0 13.0 38.0 145-149 30.0097 35.4 28.0 38.0 6.4 38.0 150-151 25.090625 33.5 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 3.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 5.0 12 2.0 13 4.0 14 3.0 15 3.0 16 1.0 17 2.0 18 10.0 19 6.0 20 10.0 21 11.0 22 14.0 23 19.0 24 21.0 25 30.0 26 21.0 27 57.0 28 54.0 29 58.0 30 89.0 31 99.0 32 149.0 33 193.0 34 285.0 35 485.0 36 991.0 37 1358.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.8 18.375 13.750000000000002 33.074999999999996 2 28.425 24.15 27.200000000000003 20.225 3 23.05 26.3 26.575 24.075 4 25.974999999999998 31.45 20.599999999999998 21.975 5 27.224999999999998 32.875 19.525000000000002 20.375 6 23.400000000000002 36.375 20.125 20.1 7 23.400000000000002 19.950000000000003 34.699999999999996 21.95 8 23.225 22.6 24.15 30.025000000000002 9 22.875 23.575 29.049999999999997 24.5 10-14 26.005 26.650000000000002 23.135 24.21 15-19 25.855 25.05 24.529999999999998 24.565 20-24 25.2 26.0 24.94 23.86 25-29 26.145000000000003 25.72 24.45 23.685000000000002 30-34 25.314999999999998 26.21 24.685000000000002 23.79 35-39 25.4 26.145000000000003 24.385 24.07 40-44 25.674999999999997 26.005 23.810000000000002 24.51 45-49 25.474999999999998 26.355 24.575 23.595 50-54 26.16 25.755 24.785 23.3 55-59 26.150000000000002 25.759999999999998 24.175 23.915 60-64 25.285000000000004 26.779999999999998 24.060000000000002 23.875 65-69 25.94 26.345000000000002 24.404999999999998 23.31 70-74 25.8 25.55 24.755 23.895 75-79 26.295 25.905 24.375 23.425 80-84 25.36 26.235000000000003 25.09 23.315 85-89 25.869999999999997 25.629999999999995 24.995 23.505000000000003 90-94 25.825 25.979999999999997 24.905 23.29 95-99 26.369999999999997 26.640000000000004 24.310000000000002 22.68 100-104 26.400000000000002 25.290000000000003 24.33 23.98 105-109 26.08 25.5 25.145 23.275000000000002 110-114 26.224999999999998 25.555 25.27 22.95 115-119 26.365 25.89 24.55 23.195 120-124 26.745 26.21 24.23 22.814999999999998 125-129 26.685 26.245 24.555 22.515 130-134 26.790000000000003 25.995 24.75 22.465 135-139 26.515 26.445 24.5 22.54 140-144 27.150000000000002 26.13 24.48 22.24 145-149 26.884999999999998 26.5 24.57 22.045 150-151 27.5625 26.125 24.3875 21.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 2.5 27 2.5 28 2.5 29 3.5 30 4.5 31 7.0 32 10.5 33 14.5 34 16.0 35 24.5 36 39.0 37 53.0 38 76.5 39 93.5 40 110.0 41 139.5 42 167.5 43 193.5 44 216.5 45 205.0 46 189.5 47 200.5 48 193.5 49 178.5 50 166.5 51 153.0 52 145.0 53 136.5 54 116.5 55 108.0 56 102.5 57 99.5 58 96.5 59 82.5 60 83.5 61 81.0 62 63.5 63 57.0 64 60.5 65 54.5 66 44.0 67 34.5 68 38.5 69 36.5 70 27.0 71 18.5 72 14.0 73 13.0 74 5.5 75 3.0 76 4.5 77 2.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1409802930773 98.1 2 0.7074279939363315 1.4000000000000001 3 0.1010611419909045 0.3 4 0.05053057099545225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6499999999999999 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.6500000000000004 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.1625 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.125 0.0 0.0 0.0 0.0 134-135 4.487500000000001 0.0 0.0 0.0 0.0 136-137 4.9 0.0 0.0 0.0 0.0 138-139 5.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTAGC 10 0.006830828 145.0 6 TCATGTC 10 0.006830828 145.0 2 >>END_MODULE Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961080 spots for SRR6958223.sra Written 961080 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra Read 961064 spots for SRR6958223.sra Written 961064 spots for SRR6958223.sra SRR ids: ['SRR6958223.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_642ie9nt SRR6958223.sra spots: 19221296 blocks: [[1, 961064], [961065, 1922128], [1922129, 2883192], [2883193, 3844256], [3844257, 4805320], [4805321, 5766384], [5766385, 6727448], [6727449, 7688512], [7688513, 8649576], [8649577, 9610640], [9610641, 10571704], [10571705, 11532768], [11532769, 12493832], [12493833, 13454896], [13454897, 14415960], [14415961, 15377024], [15377025, 16338088], [16338089, 17299152], [17299153, 18260216], [18260217, 19221296]] SRR6958223 file size 6491766 SRR6958223 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958223 SRR6958223_1.fastq SRR6958223_2.fastq Input file: SRR6958223_1.fastq Paired file: SRR6958223_2.fastq trimmed: SRR6958223-trimmed-pair1.fastq, SRR6958223-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:48:17 2024 >> started Fri Dec 6 16:48:40 2024 >> done (23.426s) 19221296 read pairs processed; of these: 19478 ( 0.10%) short read pairs filtered out after trimming by size control 14798 ( 0.08%) empty read pairs filtered out after trimming by size control 19187020 (99.82%) read pairs available; of these: 8540194 (44.51%) trimmed read pairs available after processing 10646826 (55.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 2 0.00% 23 2 0.00% 24 6 0.00% 25 4 0.00% 26 6 0.00% 27 2 0.00% 28 7 0.00% 29 2 0.00% 30 6 0.00% 31 10 0.00% 32 11 0.00% 33 5 0.00% 34 8 0.00% 35 7 0.00% 36 9 0.00% 37 10 0.00% 38 15 0.00% 39 20 0.00% 40 23 0.00% 41 17 0.00% 42 17 0.00% 43 18 0.00% 44 17 0.00% 45 27 0.00% 46 22 0.00% 47 33 0.00% 48 29 0.00% 49 35 0.00% 50 48 0.00% 51 49 0.00% 52 50 0.00% 53 59 0.00% 54 69 0.00% 55 86 0.00% 56 82 0.00% 57 102 0.00% 58 106 0.00% 59 119 0.00% 60 141 0.00% 61 187 0.00% 62 211 0.00% 63 232 0.00% 64 255 0.00% 65 281 0.00% 66 342 0.00% 67 355 0.00% 68 408 0.00% 69 473 0.00% 70 505 0.00% 71 565 0.00% 72 657 0.00% 73 756 0.00% 74 876 0.00% 75 1048 0.01% 76 1118 0.01% 77 1261 0.01% 78 1410 0.01% 79 1636 0.01% 80 1818 0.01% 81 2058 0.01% 82 2414 0.01% 83 2724 0.01% 84 3873 0.02% 85 4613 0.02% 86 4854 0.03% 87 5170 0.03% 88 5472 0.03% 89 5618 0.03% 90 6130 0.03% 91 6528 0.03% 92 6969 0.04% 93 7619 0.04% 94 8279 0.04% 95 8795 0.05% 96 9631 0.05% 97 10277 0.05% 98 10759 0.06% 99 11392 0.06% 100 12096 0.06% 101 12733 0.07% 102 13786 0.07% 103 14557 0.08% 104 15497 0.08% 105 16541 0.09% 106 17350 0.09% 107 18204 0.09% 108 19347 0.10% 109 20291 0.11% 110 21282 0.11% 111 22230 0.12% 112 23338 0.12% 113 24448 0.13% 114 25879 0.13% 115 27610 0.14% 116 29331 0.15% 117 30415 0.16% 118 31575 0.16% 119 32757 0.17% 120 34376 0.18% 121 35845 0.19% 122 36968 0.19% 123 38791 0.20% 124 41225 0.21% 125 43281 0.23% 126 45132 0.24% 127 48003 0.25% 128 49877 0.26% 129 52252 0.27% 130 55098 0.29% 131 58057 0.30% 132 61057 0.32% 133 65628 0.34% 134 69350 0.36% 135 74191 0.39% 136 80113 0.42% 137 85843 0.45% 138 92161 0.48% 139 101127 0.53% 140 109847 0.57% 141 119635 0.62% 142 130400 0.68% 143 141337 0.74% 144 150754 0.79% 145 169289 0.88% 146 197594 1.03% 147 267441 1.39% 148 424076 2.21% 149 879215 4.58% 150 4214105 21.96% 151 10646826 55.49% 19187020 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=17 prefix-density=0.80 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=26.34 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=19 prefix-density=0.54 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=56.37 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.2 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958223 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:49:36 Started mapping on | Dec 06 16:49:37 Finished on | Dec 06 16:51:15 Mapping speed, Million of reads per hour | 704.83 Number of input reads | 19187020 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18437507 Uniquely mapped reads % | 96.09% Average mapped length | 294.91 Number of splices: Total | 21620503 Number of splices: Annotated (sjdb) | 20349769 Number of splices: GT/AG | 21338396 Number of splices: GC/AG | 252232 Number of splices: AT/AC | 7804 Number of splices: Non-canonical | 22071 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 274971 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 42154 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 1.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 486789 486789 486789 N_multimapping 274971 274971 274971 N_noFeature 628201 17924350 773146 N_ambiguous 442803 2470 75928 UnstrandedReadsAssigned:17366503 PositiveStrandReadsAssigned:510687 NegativeStrandReadsAssigned:17588433 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958223 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958223-trimmed-pair1.fastq SRR6958223-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,187,020 reads, 17,651,472 reads pseudoaligned [quant] estimated average fragment length: 259.728 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR6958223.ke.tsv 35125 SRR6958223.se.tsv 88098 total ==> SRR6958223.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 677.765 4.81115 0.591886 PNS24247 1044 785.272 47.3051 5.02293 PNS24249 1928 1669.27 47.2368 2.35951 PNS24246 1044 785.272 47.3051 5.02293 PNS24248 1044 785.272 47.3051 5.02293 PNS24244 1471 1212.27 17.0367 1.1718 PNS24243 293 90.253 0 0 KQK14069 1603 1344.27 6721.7 416.927 KQK14071 474 231.644 59.8928 21.5587 ==> SRR6958223.se.tsv <== BRADI_1g14170v3 7340 BRADI_1g53295v3 133 BRADI_1g59795v3 182 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 160 BRADI_1g74790v3 97 BRADI_1g09890v3 0 BRADI_1g77505v3 191 BRADI_1g48960v3 0 SRR6958223 completed mapping pipeline successfully