Starting /dee2/code/volunteer_pipeline.sh SRR6958224 current disk space = 1550624878592 free memory = 1600953848 SRR6958224 SRAfilesize 5818ccc15c3f0bbe17c7b9578605cdd6 SRR6958224.sra SRR6958224.sra file validated SRR6958224 is paired end SRR6958224 is conventional basespace SRR6958224 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958224_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.75625 25.0 18.0 32.0 18.0 33.0 2 30.158 31.0 28.0 33.0 27.0 33.0 3 30.99775 33.0 31.0 33.0 27.0 33.0 4 30.80775 33.0 31.0 33.0 28.0 33.0 5 32.11275 33.0 32.0 33.0 31.0 34.0 6 36.161 38.0 36.0 38.0 33.0 38.0 7 36.834 38.0 37.0 38.0 35.0 38.0 8 37.12975 38.0 38.0 38.0 36.0 38.0 9 37.207 38.0 38.0 38.0 36.0 38.0 10-14 37.35470000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.377050000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.480900000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.4245 38.0 38.0 38.0 37.0 38.0 30-34 37.3444 38.0 38.0 38.0 37.0 38.0 35-39 37.29625 38.0 38.0 38.0 36.8 38.0 40-44 37.172900000000006 38.0 38.0 38.0 36.2 38.0 45-49 37.12405 38.0 38.0 38.0 36.4 38.0 50-54 37.19475 38.0 38.0 38.0 36.4 38.0 55-59 37.03075 38.0 38.0 38.0 35.6 38.0 60-64 36.9371 38.0 38.0 38.0 35.2 38.0 65-69 36.986850000000004 38.0 38.0 38.0 35.4 38.0 70-74 37.121249999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.95805 38.0 38.0 38.0 35.6 38.0 80-84 36.56464999999999 38.0 38.0 38.0 34.0 38.0 85-89 36.53095 38.0 38.0 38.0 34.0 38.0 90-94 36.5376 38.0 38.0 38.0 34.0 38.0 95-99 36.5647 38.0 38.0 38.0 34.0 38.0 100-104 36.380250000000004 38.0 37.4 38.0 34.0 38.0 105-109 36.185449999999996 38.0 37.2 38.0 33.2 38.0 110-114 35.9188 38.0 37.0 38.0 32.4 38.0 115-119 35.924299999999995 38.0 36.8 38.0 32.4 38.0 120-124 35.648450000000004 38.0 36.0 38.0 31.0 38.0 125-129 35.47175 38.0 35.8 38.0 30.6 38.0 130-134 35.316900000000004 38.0 35.4 38.0 29.6 38.0 135-139 35.02265 38.0 35.0 38.0 28.0 38.0 140-144 34.584199999999996 38.0 35.0 38.0 26.8 38.0 145-149 33.793949999999995 38.0 34.2 38.0 21.6 38.0 150-151 29.571125000000002 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 0.0 19 1.0 20 2.0 21 2.0 22 1.0 23 4.0 24 6.0 25 9.0 26 13.0 27 18.0 28 23.0 29 39.0 30 51.0 31 60.0 32 97.0 33 119.0 34 202.0 35 397.0 36 919.0 37 2031.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.56533055700156 14.393545028630921 8.198854763144196 42.84226965122332 2 19.779944986246562 13.15328832208052 37.559389847461865 29.507376844211052 3 20.775 15.875 24.925 38.425 4 25.55 22.900000000000002 20.599999999999998 30.95 5 25.576152304609217 27.805611222444888 24.774549098196395 21.8436873747495 6 23.7 31.624999999999996 23.799999999999997 20.875 7 18.05 25.6 37.8 18.55 8 20.424999999999997 24.275 30.45 24.85 9 19.925 22.400000000000002 33.475 24.2 10-14 21.959999999999997 26.700000000000003 26.229999999999997 25.11 15-19 22.485 25.83 26.39 25.295 20-24 22.74 25.495 26.44 25.324999999999996 25-29 22.48 25.885 26.5 25.135 30-34 22.975 26.029999999999998 26.005 24.990000000000002 35-39 23.150000000000002 25.2 26.695 24.955 40-44 22.42 26.295 26.229999999999997 25.055 45-49 22.465 25.380000000000003 26.38 25.775 50-54 22.065 26.085 26.38 25.47 55-59 22.375 25.895000000000003 26.435 25.295 60-64 23.01 25.865 25.635 25.490000000000002 65-69 22.91 25.85 25.69 25.55 70-74 22.770000000000003 25.445 26.46 25.324999999999996 75-79 23.185 25.545 26.32 24.95 80-84 22.615 25.525 26.400000000000002 25.46 85-89 22.99 25.635 26.08 25.295 90-94 23.285 25.569999999999997 26.265 24.88 95-99 23.375 25.779999999999998 25.665 25.180000000000003 100-104 23.365 25.25 25.865 25.52 105-109 23.32 25.44 25.915 25.324999999999996 110-114 23.095 25.735000000000003 25.635 25.535000000000004 115-119 23.185 25.745 25.814999999999998 25.255 120-124 23.515 25.5 25.480000000000004 25.505 125-129 23.66 25.56 25.590000000000003 25.19 130-134 23.09 25.83 25.369999999999997 25.71 135-139 23.330000000000002 25.724999999999998 25.545 25.4 140-144 23.150000000000002 26.245 25.195 25.41 145-149 23.705000000000002 25.224999999999998 25.715 25.355 150-151 23.814291077462144 25.34100863471405 26.379677136778877 24.465023151044925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 2.0 28 3.5 29 7.5 30 12.0 31 15.0 32 13.5 33 16.5 34 27.5 35 43.5 36 59.5 37 79.5 38 100.5 39 114.5 40 141.5 41 162.0 42 176.5 43 204.0 44 219.0 45 227.0 46 219.0 47 195.5 48 183.0 49 185.0 50 162.0 51 145.0 52 145.5 53 118.0 54 96.0 55 88.5 56 89.5 57 78.0 58 60.0 59 60.5 60 62.0 61 62.0 62 59.5 63 52.5 64 52.0 65 43.0 66 31.5 67 30.5 68 31.0 69 26.5 70 20.0 71 16.5 72 16.5 73 14.5 74 8.5 75 5.0 76 3.5 77 4.0 78 4.5 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.95 2 0.025 3 0.0 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.48750000000000004 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.7250000000000001 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.1749999999999998 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.7 0.0 0.0 0.0 0.0 130-131 1.8875000000000002 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.625 0.0 0.0 0.0 0.0 138-139 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958224 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958224_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9995 33.0 33.0 34.0 32.0 34.0 2 32.88975 34.0 33.0 34.0 32.0 34.0 3 33.01125 34.0 33.0 34.0 32.0 34.0 4 32.98275 34.0 33.0 34.0 32.0 34.0 5 32.98425 34.0 33.0 34.0 32.0 34.0 6 37.10725 38.0 38.0 38.0 36.0 38.0 7 37.07425 38.0 38.0 38.0 36.0 38.0 8 37.10575 38.0 38.0 38.0 37.0 38.0 9 37.13675 38.0 38.0 38.0 36.0 38.0 10-14 37.0347 38.0 38.0 38.0 36.0 38.0 15-19 36.84665 38.0 38.0 38.0 35.4 38.0 20-24 36.9927 38.0 38.0 38.0 36.2 38.0 25-29 37.090799999999994 38.0 38.0 38.0 36.4 38.0 30-34 37.09325 38.0 38.0 38.0 36.4 38.0 35-39 37.0816 38.0 38.0 38.0 36.4 38.0 40-44 37.098 38.0 38.0 38.0 36.4 38.0 45-49 37.008449999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.9051 38.0 38.0 38.0 35.8 38.0 55-59 36.94055000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.8635 38.0 38.0 38.0 35.8 38.0 65-69 36.74830000000001 38.0 38.0 38.0 35.2 38.0 70-74 36.60940000000001 38.0 38.0 38.0 34.4 38.0 75-79 36.39645 38.0 38.0 38.0 34.0 38.0 80-84 36.5031 38.0 38.0 38.0 34.0 38.0 85-89 36.2887 38.0 38.0 38.0 34.0 38.0 90-94 36.2973 38.0 38.0 38.0 33.6 38.0 95-99 36.1623 38.0 37.8 38.0 33.6 38.0 100-104 36.0423 38.0 37.6 38.0 33.2 38.0 105-109 35.8583 38.0 37.2 38.0 32.2 38.0 110-114 35.618300000000005 38.0 36.8 38.0 31.2 38.0 115-119 35.4039 38.0 36.2 38.0 30.0 38.0 120-124 35.26574999999999 38.0 36.0 38.0 29.2 38.0 125-129 35.30755 38.0 36.0 38.0 29.8 38.0 130-134 34.72275 38.0 35.2 38.0 27.0 38.0 135-139 34.37474999999999 38.0 35.0 38.0 24.6 38.0 140-144 34.047450000000005 38.0 34.6 38.0 23.2 38.0 145-149 33.5467 38.0 33.6 38.0 21.4 38.0 150-151 28.51425 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 0.0 6 0.0 7 0.0 8 2.0 9 2.0 10 2.0 11 2.0 12 2.0 13 1.0 14 3.0 15 6.0 16 0.0 17 2.0 18 3.0 19 4.0 20 3.0 21 4.0 22 8.0 23 9.0 24 13.0 25 10.0 26 24.0 27 30.0 28 29.0 29 41.0 30 52.0 31 78.0 32 99.0 33 119.0 34 184.0 35 274.0 36 668.0 37 2319.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.04255319148936 17.972465581977474 12.240300375469337 35.74468085106383 2 29.299999999999997 22.900000000000002 28.775000000000002 19.025 3 21.25 27.35 28.325 23.075000000000003 4 24.825 30.275000000000002 21.5 23.400000000000002 5 28.35708927231808 33.18329582395599 19.979994998749685 18.479619904976243 6 22.55 36.025 21.425 20.0 7 22.05 19.625 36.6 21.725 8 23.75 24.075 25.1 27.075 9 24.9 21.875 29.049999999999997 24.175 10-14 25.840000000000003 26.240000000000002 24.275 23.645 15-19 25.8 25.55 25.115 23.535 20-24 25.105 26.3 25.005 23.59 25-29 25.415 25.455 25.03 24.099999999999998 30-34 25.1 26.200000000000003 24.6 24.099999999999998 35-39 24.67 26.064999999999998 25.44 23.825 40-44 25.874999999999996 24.89 25.545 23.69 45-49 25.055 26.179999999999996 24.865000000000002 23.9 50-54 25.724999999999998 25.88 25.31 23.085 55-59 26.135 25.665 24.345 23.855 60-64 25.540000000000003 25.285000000000004 25.669999999999998 23.505000000000003 65-69 25.009999999999998 26.22 24.93 23.84 70-74 26.11 25.94 24.645 23.305 75-79 25.474999999999998 25.66 25.64 23.225 80-84 25.564999999999998 25.455 25.290000000000003 23.69 85-89 25.53 26.455000000000002 24.57 23.445 90-94 25.97 25.27 25.47 23.29 95-99 25.155 26.625 25.169999999999998 23.05 100-104 25.825 25.525 25.1 23.549999999999997 105-109 24.93 25.759999999999998 25.885 23.425 110-114 25.36 25.945 25.374999999999996 23.32 115-119 26.16 25.83 25.230000000000004 22.78 120-124 25.2 25.69 25.6 23.51 125-129 25.590000000000003 26.61 24.58 23.22 130-134 25.81 26.090000000000003 25.2 22.900000000000002 135-139 25.83 25.924999999999997 25.75 22.495 140-144 26.245 26.135 24.995 22.625 145-149 25.874999999999996 26.36 25.130000000000003 22.634999999999998 150-151 25.46614941809536 25.691402828181705 25.941684394944314 22.900763358778626 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 1.0 26 1.0 27 5.0 28 5.0 29 3.5 30 8.5 31 12.5 32 17.5 33 18.5 34 24.5 35 39.5 36 38.5 37 53.5 38 88.5 39 107.0 40 131.0 41 168.5 42 184.0 43 173.0 44 185.5 45 201.0 46 209.0 47 214.5 48 197.0 49 175.0 50 157.0 51 145.0 52 137.5 53 131.5 54 101.5 55 76.0 56 81.0 57 88.5 58 88.0 59 83.0 60 76.5 61 64.0 62 59.5 63 63.5 64 54.0 65 48.0 66 53.0 67 46.0 68 36.5 69 30.5 70 27.0 71 20.5 72 15.0 73 16.0 74 14.0 75 8.0 76 3.5 77 4.0 78 2.5 79 0.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1670873296315 98.225 2 0.7319535588086825 1.4500000000000002 3 0.0757193336698637 0.22499999999999998 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.1749999999999998 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.7 0.0 0.0 0.0 0.0 130-131 1.8625 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.2750000000000004 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981027 spots for SRR6958224.sra Written 981027 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra Read 981008 spots for SRR6958224.sra Written 981008 spots for SRR6958224.sra SRR ids: ['SRR6958224.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7wpfo6si SRR6958224.sra spots: 19620179 blocks: [[1, 981008], [981009, 1962016], [1962017, 2943024], [2943025, 3924032], [3924033, 4905040], [4905041, 5886048], [5886049, 6867056], [6867057, 7848064], [7848065, 8829072], [8829073, 9810080], [9810081, 10791088], [10791089, 11772096], [11772097, 12753104], [12753105, 13734112], [13734113, 14715120], [14715121, 15696128], [15696129, 16677136], [16677137, 17658144], [17658145, 18639152], [18639153, 19620179]] SRR6958224 file size 6626934 SRR6958224 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958224 SRR6958224_1.fastq SRR6958224_2.fastq Input file: SRR6958224_1.fastq Paired file: SRR6958224_2.fastq trimmed: SRR6958224-trimmed-pair1.fastq, SRR6958224-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:48:33 2024 >> started Fri Dec 6 16:48:57 2024 >> done (24.535s) 19620179 read pairs processed; of these: 9856 ( 0.05%) short read pairs filtered out after trimming by size control 7817 ( 0.04%) empty read pairs filtered out after trimming by size control 19602506 (99.91%) read pairs available; of these: 6722492 (34.29%) trimmed read pairs available after processing 12880014 (65.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 1 0.00% 23 6 0.00% 24 8 0.00% 25 4 0.00% 26 5 0.00% 27 5 0.00% 28 7 0.00% 29 2 0.00% 30 6 0.00% 31 7 0.00% 32 5 0.00% 33 9 0.00% 34 6 0.00% 35 5 0.00% 36 5 0.00% 37 12 0.00% 38 11 0.00% 39 9 0.00% 40 8 0.00% 41 9 0.00% 42 9 0.00% 43 15 0.00% 44 15 0.00% 45 11 0.00% 46 15 0.00% 47 16 0.00% 48 23 0.00% 49 13 0.00% 50 22 0.00% 51 21 0.00% 52 28 0.00% 53 27 0.00% 54 40 0.00% 55 34 0.00% 56 41 0.00% 57 33 0.00% 58 48 0.00% 59 49 0.00% 60 56 0.00% 61 69 0.00% 62 71 0.00% 63 87 0.00% 64 89 0.00% 65 120 0.00% 66 124 0.00% 67 123 0.00% 68 144 0.00% 69 165 0.00% 70 158 0.00% 71 166 0.00% 72 244 0.00% 73 250 0.00% 74 254 0.00% 75 312 0.00% 76 341 0.00% 77 422 0.00% 78 484 0.00% 79 539 0.00% 80 572 0.00% 81 636 0.00% 82 779 0.00% 83 860 0.00% 84 1429 0.01% 85 1749 0.01% 86 1783 0.01% 87 1884 0.01% 88 2125 0.01% 89 2198 0.01% 90 2288 0.01% 91 2453 0.01% 92 2545 0.01% 93 2903 0.01% 94 3184 0.02% 95 3422 0.02% 96 3614 0.02% 97 3895 0.02% 98 4215 0.02% 99 4425 0.02% 100 4764 0.02% 101 5162 0.03% 102 5637 0.03% 103 6047 0.03% 104 6384 0.03% 105 6735 0.03% 106 7456 0.04% 107 7855 0.04% 108 8293 0.04% 109 9079 0.05% 110 9728 0.05% 111 10211 0.05% 112 10821 0.06% 113 11601 0.06% 114 12291 0.06% 115 13309 0.07% 116 13941 0.07% 117 14925 0.08% 118 15593 0.08% 119 16124 0.08% 120 17240 0.09% 121 18396 0.09% 122 19254 0.10% 123 20511 0.10% 124 21375 0.11% 125 22835 0.12% 126 23618 0.12% 127 25459 0.13% 128 26519 0.14% 129 27942 0.14% 130 29634 0.15% 131 31381 0.16% 132 33065 0.17% 133 35595 0.18% 134 37698 0.19% 135 39826 0.20% 136 43214 0.22% 137 45708 0.23% 138 48478 0.25% 139 52744 0.27% 140 57367 0.29% 141 62677 0.32% 142 69326 0.35% 143 78842 0.40% 144 93272 0.48% 145 112181 0.57% 146 146822 0.75% 147 196738 1.00% 148 310953 1.59% 149 660344 3.37% 150 4065738 20.74% 151 12880014 65.71% 19602506 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=24 prefix-density=0.76 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=59.78 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=19 prefix-density=0.51 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=38.23 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.9 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958224 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:49:40 Started mapping on | Dec 06 16:49:40 Finished on | Dec 06 16:51:13 Mapping speed, Million of reads per hour | 758.81 Number of input reads | 19602506 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19307370 Uniquely mapped reads % | 98.49% Average mapped length | 298.34 Number of splices: Total | 22631067 Number of splices: Annotated (sjdb) | 21331511 Number of splices: GT/AG | 22341488 Number of splices: GC/AG | 264602 Number of splices: AT/AC | 8480 Number of splices: Non-canonical | 16497 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 123851 % of reads mapped to multiple loci | 0.63% Number of reads mapped to too many loci | 9177 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 177078 177078 177078 N_multimapping 123851 123851 123851 N_noFeature 715830 18763100 865828 N_ambiguous 466058 2444 72826 UnstrandedReadsAssigned:18125482 PositiveStrandReadsAssigned:541826 NegativeStrandReadsAssigned:18368716 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958224 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958224-trimmed-pair1.fastq SRR6958224-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,602,506 reads, 18,377,183 reads pseudoaligned [quant] estimated average fragment length: 268.594 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR6958224.ke.tsv 35125 SRR6958224.se.tsv 88098 total ==> SRR6958224.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.876 0 0 PNS24247 1044 776.406 75.522 8.07417 PNS24249 1928 1660.41 40.0988 2.00461 PNS24246 1044 776.406 75.522 8.07417 PNS24248 1044 776.406 75.522 8.07417 PNS24244 1471 1203.41 23.3351 1.60957 PNS24243 293 78.4231 0 0 KQK14069 1603 1335.41 6265.81 389.473 KQK14071 474 219.529 122.286 46.2379 ==> SRR6958224.se.tsv <== BRADI_1g14170v3 7092 BRADI_1g53295v3 272 BRADI_1g59795v3 245 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 226 BRADI_1g74790v3 104 BRADI_1g09890v3 0 BRADI_1g77505v3 209 BRADI_1g48960v3 0 SRR6958224 completed mapping pipeline successfully