Starting /dee2/code/volunteer_pipeline.sh SRR6958225 current disk space = 1550636793856 free memory = 1600107884 SRR6958225 SRAfilesize c1d4105e315e7617cb87eb9c5b8ac507 SRR6958225.sra SRR6958225.sra file validated SRR6958225 is paired end SRR6958225 is conventional basespace SRR6958225 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958225_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.12875 18.0 18.0 30.0 18.0 32.0 2 26.59675 27.0 18.0 32.0 18.0 32.0 3 25.793 27.0 18.0 31.0 18.0 33.0 4 28.873 30.0 27.0 31.0 25.0 33.0 5 29.73925 32.0 30.0 33.0 15.0 33.0 6 35.09075 37.0 35.0 38.0 29.0 38.0 7 36.0905 38.0 36.0 38.0 33.0 38.0 8 36.483 38.0 37.0 38.0 34.0 38.0 9 36.7975 38.0 38.0 38.0 34.0 38.0 10-14 36.96055 38.0 38.0 38.0 35.2 38.0 15-19 36.876650000000005 38.0 38.0 38.0 35.0 38.0 20-24 36.9527 38.0 38.0 38.0 35.4 38.0 25-29 36.86325 38.0 38.0 38.0 35.0 38.0 30-34 36.637499999999996 38.0 38.0 38.0 34.4 38.0 35-39 36.635850000000005 38.0 38.0 38.0 34.2 38.0 40-44 36.679050000000004 38.0 38.0 38.0 34.6 38.0 45-49 36.6706 38.0 38.0 38.0 34.6 38.0 50-54 36.2863 38.0 37.6 38.0 33.2 38.0 55-59 36.1844 38.0 37.2 38.0 32.4 38.0 60-64 36.47410000000001 38.0 37.6 38.0 33.6 38.0 65-69 36.548500000000004 38.0 38.0 38.0 33.8 38.0 70-74 36.07555 38.0 37.0 38.0 32.2 38.0 75-79 35.90415 38.0 37.0 38.0 31.0 38.0 80-84 35.686350000000004 38.0 36.6 38.0 30.6 38.0 85-89 35.91765 38.0 37.0 38.0 31.6 38.0 90-94 35.636 38.0 36.4 38.0 30.6 38.0 95-99 35.28115 38.0 35.8 38.0 28.8 38.0 100-104 34.74805 38.0 35.0 38.0 26.4 38.0 105-109 34.304950000000005 38.0 34.2 38.0 24.0 38.0 110-114 34.168600000000005 38.0 34.0 38.0 23.6 38.0 115-119 34.033750000000005 38.0 34.0 38.0 22.8 38.0 120-124 33.76545 38.0 34.0 38.0 21.0 38.0 125-129 33.7847 38.0 34.0 38.0 22.6 38.0 130-134 33.481700000000004 37.8 33.6 38.0 20.6 38.0 135-139 32.7681 37.2 32.6 38.0 17.0 38.0 140-144 31.5539 36.0 30.4 38.0 13.4 38.0 145-149 29.981600000000004 35.2 28.4 38.0 8.6 38.0 150-151 25.590874999999997 33.0 14.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 3.0 17 0.0 18 4.0 19 6.0 20 8.0 21 9.0 22 12.0 23 20.0 24 22.0 25 34.0 26 42.0 27 52.0 28 67.0 29 82.0 30 89.0 31 125.0 32 158.0 33 247.0 34 335.0 35 571.0 36 1147.0 37 962.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.05723905723906 13.571613571613572 4.1440041440041435 43.22714322714323 2 21.525 8.225 25.2 45.050000000000004 3 20.525 12.725 21.125 45.625 4 26.6 20.875 22.8 29.725 5 29.549999999999997 20.825 22.775000000000002 26.85 6 23.75 31.0 22.625 22.625 7 16.975 23.95 39.050000000000004 20.025000000000002 8 22.15 22.925 27.474999999999998 27.450000000000003 9 20.599999999999998 21.6 32.35 25.45 10-14 22.53 25.855 25.955000000000002 25.66 15-19 23.015 24.855 26.279999999999998 25.85 20-24 22.915 24.4 26.415 26.27 25-29 23.335 25.405 25.295 25.965 30-34 22.91 24.535 26.51 26.045 35-39 23.335 24.41 26.08 26.174999999999997 40-44 23.39 24.58 25.755 26.275 45-49 23.05 24.66 25.715 26.575 50-54 23.28 24.16 26.215 26.345000000000002 55-59 23.345 24.285 25.955000000000002 26.415 60-64 23.715 24.525 25.869999999999997 25.89 65-69 23.825 24.965 25.205 26.005 70-74 23.565 24.654999999999998 25.624999999999996 26.155 75-79 23.685000000000002 24.695 25.724999999999998 25.895000000000003 80-84 23.815 24.57 25.755 25.86 85-89 23.915 24.485 25.540000000000003 26.06 90-94 23.73 24.245 26.145000000000003 25.88 95-99 24.08 25.03 25.119999999999997 25.77 100-104 23.73 24.275 25.929999999999996 26.064999999999998 105-109 24.060000000000002 24.785 25.455 25.7 110-114 24.22 24.560000000000002 25.21 26.009999999999998 115-119 24.01 24.91 25.485000000000003 25.595000000000002 120-124 24.035 24.884999999999998 25.335 25.745 125-129 23.885 24.605 25.5 26.009999999999998 130-134 24.255 24.335 25.330000000000002 26.08 135-139 24.09 24.975 25.355 25.580000000000002 140-144 23.94 24.55 25.575 25.935000000000002 145-149 23.835 24.455 25.66 26.05 150-151 24.962500000000002 24.075 25.1875 25.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 0.5 28 1.0 29 2.5 30 4.0 31 5.5 32 7.0 33 7.5 34 16.5 35 27.5 36 42.0 37 43.5 38 54.0 39 84.5 40 113.5 41 136.0 42 154.0 43 175.5 44 188.0 45 206.0 46 213.5 47 224.5 48 215.5 49 183.5 50 176.5 51 161.0 52 136.0 53 123.0 54 112.5 55 100.0 56 107.0 57 97.5 58 80.0 59 87.5 60 88.0 61 81.5 62 73.0 63 62.5 64 55.5 65 55.5 66 52.0 67 44.0 68 39.5 69 36.0 70 34.5 71 28.0 72 15.0 73 13.0 74 11.5 75 9.0 76 6.5 77 2.0 78 1.5 79 0.5 80 1.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93617021276596 97.65 2 0.8611955420466059 1.7000000000000002 3 0.1773049645390071 0.525 4 0.0 0.0 5 0.025329280648429587 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.36250000000000004 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.3 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.4749999999999996 0.0 0.0 0.0 0.0 128-129 2.825 0.0 0.0 0.0 0.0 130-131 3.1624999999999996 0.0 0.0 0.0 0.0 132-133 3.5250000000000004 0.0 0.0 0.0 0.0 134-135 3.8499999999999996 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958225 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958225_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.057 33.0 33.0 34.0 30.0 34.0 2 32.119 33.0 33.0 34.0 30.0 34.0 3 31.9865 33.0 33.0 34.0 28.0 34.0 4 31.8855 33.0 33.0 34.0 30.0 34.0 5 31.90375 33.0 33.0 34.0 30.0 34.0 6 35.63725 38.0 37.0 38.0 29.0 38.0 7 35.892 38.0 38.0 38.0 31.0 38.0 8 35.6255 38.0 37.0 38.0 29.0 38.0 9 35.429 38.0 37.0 38.0 29.0 38.0 10-14 35.7291 38.0 37.4 38.0 29.8 38.0 15-19 35.86405 38.0 37.8 38.0 31.4 38.0 20-24 35.9899 38.0 38.0 38.0 32.6 38.0 25-29 35.8529 38.0 37.6 38.0 31.6 38.0 30-34 35.9735 38.0 38.0 38.0 33.0 38.0 35-39 35.76415 38.0 37.6 38.0 31.4 38.0 40-44 35.5723 38.0 37.0 38.0 29.4 38.0 45-49 35.5837 38.0 37.0 38.0 29.6 38.0 50-54 35.579100000000004 38.0 37.0 38.0 30.0 38.0 55-59 35.6909 38.0 37.2 38.0 31.0 38.0 60-64 35.351099999999995 38.0 36.8 38.0 29.0 38.0 65-69 35.16674999999999 38.0 36.6 38.0 28.2 38.0 70-74 34.913850000000004 38.0 36.2 38.0 27.4 38.0 75-79 34.91865 38.0 36.4 38.0 27.6 38.0 80-84 34.73205 38.0 35.8 38.0 26.6 38.0 85-89 34.73505 38.0 35.8 38.0 27.0 38.0 90-94 34.354 38.0 35.0 38.0 23.0 38.0 95-99 33.787 38.0 34.2 38.0 19.8 38.0 100-104 33.381299999999996 38.0 33.8 38.0 16.2 38.0 105-109 33.4218 38.0 34.0 38.0 16.2 38.0 110-114 33.146100000000004 38.0 33.8 38.0 16.2 38.0 115-119 32.2629 37.2 31.4 38.0 14.6 38.0 120-124 32.077299999999994 37.4 31.4 38.0 14.6 38.0 125-129 31.42145 36.2 30.0 38.0 13.8 38.0 130-134 30.8259 36.0 29.8 38.0 13.0 38.0 135-139 29.6923 35.0 25.4 38.0 13.0 38.0 140-144 28.819550000000003 33.6 24.4 38.0 3.8 38.0 145-149 26.9692 33.2 17.2 38.0 2.0 38.0 150-151 21.0465 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 6.0 4 8.0 5 5.0 6 3.0 7 2.0 8 3.0 9 5.0 10 4.0 11 3.0 12 10.0 13 3.0 14 14.0 15 11.0 16 11.0 17 7.0 18 17.0 19 13.0 20 18.0 21 21.0 22 26.0 23 24.0 24 45.0 25 52.0 26 54.0 27 63.0 28 81.0 29 118.0 30 107.0 31 118.0 32 166.0 33 245.0 34 279.0 35 503.0 36 855.0 37 1075.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.36536536536536 19.01901901901902 12.237237237237238 28.37837837837838 2 29.875 23.925 25.424999999999997 20.775 3 22.475 28.225 25.624999999999996 23.674999999999997 4 26.474999999999998 30.45 19.675 23.400000000000002 5 26.8 32.125 19.425 21.65 6 22.975 34.025 21.25 21.75 7 22.900000000000002 19.25 34.325 23.525 8 24.075 23.724999999999998 23.325000000000003 28.875 9 24.025 24.675 25.3 26.0 10-14 26.235000000000003 26.545 22.869999999999997 24.349999999999998 15-19 25.624999999999996 25.83 24.145 24.4 20-24 26.095000000000002 25.72 23.86 24.325 25-29 25.91 25.47 24.485 24.135 30-34 25.785000000000004 26.19 24.18 23.845 35-39 25.915 25.77 23.925 24.39 40-44 25.56 25.56 23.745 25.135 45-49 25.61 25.21 24.044999999999998 25.135 50-54 25.779999999999998 25.555 24.025 24.64 55-59 26.145000000000003 24.67 24.529999999999998 24.654999999999998 60-64 26.334999999999997 24.765 24.79 24.11 65-69 26.02 25.629999999999995 23.87 24.48 70-74 26.06 25.275 24.265 24.4 75-79 25.445 25.5 24.365000000000002 24.69 80-84 25.835 25.490000000000002 24.47 24.205 85-89 26.015 25.215 24.23 24.54 90-94 26.465 25.35 24.09 24.095 95-99 26.009999999999998 25.080000000000002 24.84 24.07 100-104 26.090000000000003 25.005 24.42 24.485 105-109 26.185000000000002 25.290000000000003 24.884999999999998 23.64 110-114 26.075 25.124999999999996 25.130000000000003 23.669999999999998 115-119 26.66 25.21 24.224999999999998 23.905 120-124 26.235000000000003 25.965 24.265 23.535 125-129 26.71 25.28 24.36 23.65 130-134 26.840000000000003 26.040000000000003 23.565 23.555 135-139 26.915 25.595000000000002 24.125 23.365 140-144 27.725 25.47 23.880000000000003 22.925 145-149 27.405 25.380000000000003 24.025 23.189999999999998 150-151 27.6375 26.087500000000002 23.8125 22.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 1.0 28 1.5 29 2.5 30 2.5 31 5.0 32 7.5 33 9.0 34 14.0 35 20.5 36 33.5 37 50.0 38 69.0 39 89.5 40 115.0 41 135.0 42 156.5 43 173.0 44 183.0 45 191.0 46 199.5 47 198.5 48 182.0 49 182.0 50 167.0 51 151.5 52 144.5 53 128.0 54 112.5 55 105.0 56 100.0 57 88.0 58 80.0 59 86.5 60 107.5 61 98.0 62 83.0 63 75.5 64 63.0 65 61.0 66 56.0 67 61.5 68 52.0 69 38.0 70 32.0 71 22.5 72 15.0 73 11.5 74 11.5 75 8.0 76 5.5 77 4.0 78 2.0 79 1.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85612608032537 97.225 2 0.864260294865277 1.7000000000000002 3 0.1525165226232842 0.44999999999999996 4 0.05083884087442806 0.2 5 0.02541942043721403 0.125 6 0.05083884087442806 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGA 6 0.15 No Hit CATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGC 6 0.15 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.5375 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.725 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.8875 0.0 0.0 0.0 0.0 138-139 4.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGAC 10 0.006830828 145.0 145 >>END_MODULE Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134560 spots for SRR6958225.sra Written 1134560 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra Read 1134549 spots for SRR6958225.sra Written 1134549 spots for SRR6958225.sra SRR ids: ['SRR6958225.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_87n8emu7 SRR6958225.sra spots: 22690991 blocks: [[1, 1134549], [1134550, 2269098], [2269099, 3403647], [3403648, 4538196], [4538197, 5672745], [5672746, 6807294], [6807295, 7941843], [7941844, 9076392], [9076393, 10210941], [10210942, 11345490], [11345491, 12480039], [12480040, 13614588], [13614589, 14749137], [14749138, 15883686], [15883687, 17018235], [17018236, 18152784], [18152785, 19287333], [19287334, 20421882], [20421883, 21556431], [21556432, 22690991]] SRR6958225 file size 7667531 SRR6958225 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958225 SRR6958225_1.fastq SRR6958225_2.fastq Input file: SRR6958225_1.fastq Paired file: SRR6958225_2.fastq trimmed: SRR6958225-trimmed-pair1.fastq, SRR6958225-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:49:57 2024 >> started Fri Dec 6 16:50:22 2024 >> done (25.144s) 22690991 read pairs processed; of these: 46479 ( 0.20%) short read pairs filtered out after trimming by size control 35500 ( 0.16%) empty read pairs filtered out after trimming by size control 22609012 (99.64%) read pairs available; of these: 10167061 (44.97%) trimmed read pairs available after processing 12441951 (55.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 5 0.00% 22 4 0.00% 23 5 0.00% 24 9 0.00% 25 3 0.00% 26 5 0.00% 27 8 0.00% 28 9 0.00% 29 10 0.00% 30 10 0.00% 31 10 0.00% 32 11 0.00% 33 12 0.00% 34 12 0.00% 35 14 0.00% 36 21 0.00% 37 13 0.00% 38 21 0.00% 39 19 0.00% 40 21 0.00% 41 14 0.00% 42 24 0.00% 43 26 0.00% 44 24 0.00% 45 25 0.00% 46 29 0.00% 47 55 0.00% 48 35 0.00% 49 35 0.00% 50 54 0.00% 51 67 0.00% 52 68 0.00% 53 85 0.00% 54 86 0.00% 55 102 0.00% 56 132 0.00% 57 119 0.00% 58 130 0.00% 59 171 0.00% 60 173 0.00% 61 201 0.00% 62 222 0.00% 63 253 0.00% 64 307 0.00% 65 292 0.00% 66 375 0.00% 67 411 0.00% 68 393 0.00% 69 514 0.00% 70 524 0.00% 71 597 0.00% 72 710 0.00% 73 843 0.00% 74 861 0.00% 75 929 0.00% 76 1027 0.00% 77 1159 0.01% 78 1360 0.01% 79 1514 0.01% 80 1735 0.01% 81 2003 0.01% 82 2305 0.01% 83 2804 0.01% 84 4542 0.02% 85 6001 0.03% 86 6142 0.03% 87 6165 0.03% 88 6333 0.03% 89 6605 0.03% 90 6836 0.03% 91 7125 0.03% 92 7478 0.03% 93 7879 0.03% 94 8689 0.04% 95 9452 0.04% 96 9738 0.04% 97 10260 0.05% 98 10824 0.05% 99 11462 0.05% 100 12043 0.05% 101 13096 0.06% 102 13846 0.06% 103 14962 0.07% 104 15900 0.07% 105 16796 0.07% 106 17948 0.08% 107 18788 0.08% 108 19597 0.09% 109 20737 0.09% 110 21834 0.10% 111 22900 0.10% 112 24405 0.11% 113 25736 0.11% 114 27634 0.12% 115 28952 0.13% 116 30409 0.13% 117 31636 0.14% 118 33295 0.15% 119 34531 0.15% 120 36134 0.16% 121 37905 0.17% 122 39647 0.18% 123 41690 0.18% 124 43990 0.19% 125 46540 0.21% 126 48692 0.22% 127 51403 0.23% 128 53256 0.24% 129 55943 0.25% 130 58171 0.26% 131 61496 0.27% 132 65304 0.29% 133 68784 0.30% 134 72167 0.32% 135 77386 0.34% 136 81634 0.36% 137 86207 0.38% 138 91487 0.40% 139 99017 0.44% 140 106253 0.47% 141 115870 0.51% 142 128383 0.57% 143 144837 0.64% 144 167905 0.74% 145 200508 0.89% 146 252373 1.12% 147 339615 1.50% 148 514835 2.28% 149 1021992 4.52% 150 5364042 23.73% 151 12441951 55.03% 22609012 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=19 prefix-density=0.88 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=147.78 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.3 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=17 prefix-density=0.59 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=311.27 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=12.9 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958225 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:51:08 Started mapping on | Dec 06 16:51:08 Finished on | Dec 06 16:53:39 Mapping speed, Million of reads per hour | 539.02 Number of input reads | 22609012 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21636574 Uniquely mapped reads % | 95.70% Average mapped length | 295.11 Number of splices: Total | 25413991 Number of splices: Annotated (sjdb) | 23875592 Number of splices: GT/AG | 25057468 Number of splices: GC/AG | 301547 Number of splices: AT/AC | 8800 Number of splices: Non-canonical | 46176 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234697 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 9888 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 765617 765617 765617 N_multimapping 234697 234697 234697 N_noFeature 642065 21012231 791988 N_ambiguous 557542 2732 83861 UnstrandedReadsAssigned:20436967 PositiveStrandReadsAssigned:621611 NegativeStrandReadsAssigned:20760725 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958225 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958225-trimmed-pair1.fastq SRR6958225-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,609,012 reads, 20,755,547 reads pseudoaligned [quant] estimated average fragment length: 253.182 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR6958225.ke.tsv 35125 SRR6958225.se.tsv 88098 total ==> SRR6958225.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 684.261 0 0 PNS24247 1044 791.818 69.8815 6.22247 PNS24249 1928 1675.82 44.9326 1.89043 PNS24246 1044 791.818 69.8815 6.22247 PNS24248 1044 791.818 69.8815 6.22247 PNS24244 1471 1218.82 34.4228 1.99128 PNS24243 293 86.4623 0 0 KQK14069 1603 1350.82 5915.92 308.781 KQK14071 474 232.313 79.8275 24.2272 ==> SRR6958225.se.tsv <== BRADI_1g14170v3 6583 BRADI_1g53295v3 1513 BRADI_1g59795v3 93 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 341 BRADI_1g74790v3 115 BRADI_1g09890v3 0 BRADI_1g77505v3 291 BRADI_1g48960v3 0 SRR6958225 completed mapping pipeline successfully