Starting /dee2/code/volunteer_pipeline.sh SRR6958226 current disk space = 1516060758016 free memory = 1596827860 SRR6958226 SRAfilesize 35c19c0c15aab22277734936df973c12 SRR6958226.sra SRR6958226.sra file validated SRR6958226 is paired end SRR6958226 is conventional basespace SRR6958226 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958226_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.8665 32.0 25.0 33.0 18.0 33.0 2 27.43175 31.0 18.0 33.0 18.0 33.0 3 29.36625 31.0 27.0 33.0 25.0 33.0 4 30.5105 31.0 30.0 33.0 27.0 33.0 5 31.6325 33.0 32.0 33.0 30.0 33.0 6 36.13025 38.0 37.0 38.0 33.0 38.0 7 36.18025 38.0 37.0 38.0 33.0 38.0 8 36.571 38.0 37.0 38.0 34.0 38.0 9 36.5365 38.0 38.0 38.0 34.0 38.0 10-14 36.9735 38.0 38.0 38.0 35.2 38.0 15-19 37.04055 38.0 38.0 38.0 35.8 38.0 20-24 36.986850000000004 38.0 38.0 38.0 35.6 38.0 25-29 36.831399999999995 38.0 38.0 38.0 35.0 38.0 30-34 36.7101 38.0 38.0 38.0 34.6 38.0 35-39 36.77935 38.0 38.0 38.0 34.4 38.0 40-44 36.73075 38.0 38.0 38.0 34.6 38.0 45-49 36.62275 38.0 38.0 38.0 34.2 38.0 50-54 36.1243 38.0 37.2 38.0 32.4 38.0 55-59 36.1661 38.0 37.0 38.0 32.4 38.0 60-64 36.5318 38.0 37.6 38.0 33.8 38.0 65-69 36.573699999999995 38.0 37.6 38.0 34.0 38.0 70-74 36.08275 38.0 36.8 38.0 32.2 38.0 75-79 35.816649999999996 38.0 36.8 38.0 31.0 38.0 80-84 35.65695 38.0 36.0 38.0 29.6 38.0 85-89 35.920950000000005 38.0 37.0 38.0 31.8 38.0 90-94 35.5947 38.0 36.2 38.0 29.8 38.0 95-99 35.27185 38.0 35.8 38.0 28.6 38.0 100-104 34.5163 38.0 35.0 38.0 25.4 38.0 105-109 33.987049999999996 38.0 34.0 38.0 19.8 38.0 110-114 33.7666 38.0 33.8 38.0 21.0 38.0 115-119 33.73555 38.0 34.0 38.0 21.0 38.0 120-124 33.518449999999994 37.8 33.8 38.0 20.6 38.0 125-129 33.729 38.0 34.0 38.0 22.4 38.0 130-134 33.398199999999996 37.6 33.6 38.0 19.4 38.0 135-139 32.502250000000004 36.6 32.2 38.0 14.6 38.0 140-144 31.053050000000002 35.8 29.8 38.0 13.4 38.0 145-149 29.162600000000005 34.4 24.8 38.0 6.4 38.0 150-151 25.20925 33.0 13.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 1.0 16 1.0 17 2.0 18 4.0 19 7.0 20 7.0 21 9.0 22 10.0 23 13.0 24 17.0 25 25.0 26 40.0 27 42.0 28 62.0 29 93.0 30 108.0 31 157.0 32 189.0 33 254.0 34 356.0 35 566.0 36 1066.0 37 966.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.12386955330227 9.043573581803233 6.467525349410798 32.36503151548369 2 22.375 10.775 34.75 32.1 3 20.0 17.7 26.275 36.025 4 24.9 25.0 22.05 28.050000000000004 5 25.05 28.825 22.85 23.275000000000002 6 22.5 32.9 23.474999999999998 21.125 7 17.75 23.9 39.300000000000004 19.05 8 18.875 25.15 28.7 27.275 9 18.775 22.875 32.550000000000004 25.8 10-14 22.24 26.955000000000002 25.515 25.290000000000003 15-19 21.945 26.029999999999998 26.715 25.31 20-24 22.52 25.86 26.384999999999998 25.235000000000003 25-29 22.245 25.655 26.484999999999996 25.615 30-34 21.84 26.169999999999998 26.784999999999997 25.205 35-39 22.009999999999998 25.855 26.724999999999998 25.41 40-44 22.165000000000003 25.865 26.669999999999998 25.3 45-49 22.384999999999998 25.945 26.645000000000003 25.025 50-54 21.790000000000003 25.965 26.995 25.25 55-59 22.37 26.19 26.534999999999997 24.905 60-64 22.009999999999998 26.08 26.705000000000002 25.205 65-69 21.845 25.990000000000002 26.529999999999998 25.635 70-74 22.2 26.355 26.450000000000003 24.995 75-79 22.02 25.669999999999998 26.724999999999998 25.585 80-84 22.305 25.605 26.445 25.645 85-89 22.81 26.284999999999997 25.735000000000003 25.169999999999998 90-94 22.27 26.25 26.029999999999998 25.45 95-99 22.400000000000002 26.14 25.655 25.805 100-104 22.525000000000002 26.090000000000003 26.525 24.86 105-109 22.56 25.91 26.21 25.319999999999997 110-114 22.52 26.32 26.06 25.1 115-119 22.095000000000002 26.064999999999998 26.155 25.685000000000002 120-124 22.245 26.145000000000003 25.96 25.650000000000002 125-129 22.695 26.575 25.515 25.215 130-134 22.994999999999997 26.150000000000002 25.96 24.895 135-139 22.495 26.265 25.585 25.655 140-144 22.675 25.564999999999998 25.645 26.115 145-149 22.61 26.005 25.72 25.665 150-151 23.400000000000002 25.4375 26.087500000000002 25.074999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.5 27 3.0 28 4.5 29 5.0 30 6.5 31 11.0 32 15.0 33 22.5 34 30.0 35 42.5 36 57.5 37 75.0 38 99.0 39 118.5 40 145.5 41 171.0 42 180.0 43 204.5 44 219.0 45 223.0 46 224.5 47 221.0 48 211.5 49 189.0 50 173.5 51 152.0 52 143.0 53 118.5 54 104.0 55 95.0 56 78.5 57 79.0 58 70.0 59 62.0 60 52.0 61 40.5 62 34.5 63 43.0 64 43.5 65 36.5 66 39.0 67 33.5 68 24.5 69 21.0 70 15.5 71 17.0 72 16.5 73 10.5 74 7.0 75 2.5 76 1.5 77 2.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.774999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.5250000000000004 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.4000000000000004 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.137499999999999 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 5.0625 0.0 0.0 0.0 0.0 130-131 5.45 0.0 0.0 0.0 0.0 132-133 5.8625 0.0 0.0 0.0 0.0 134-135 6.3125 0.0 0.0 0.0 0.0 136-137 6.824999999999999 0.0 0.0 0.0 0.0 138-139 7.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAGA 10 0.006843168 144.91249 6 >>END_MODULE SRR6958226 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958226_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.03475 33.0 33.0 34.0 30.0 34.0 2 32.1145 33.0 33.0 34.0 30.0 34.0 3 31.98975 33.0 33.0 34.0 28.0 34.0 4 31.7535 33.0 33.0 34.0 28.0 34.0 5 31.8785 33.0 33.0 34.0 30.0 34.0 6 35.81375 38.0 37.0 38.0 31.0 38.0 7 35.985 38.0 38.0 38.0 31.0 38.0 8 35.7705 38.0 38.0 38.0 31.0 38.0 9 35.5535 38.0 37.0 38.0 29.0 38.0 10-14 35.782849999999996 38.0 37.8 38.0 30.6 38.0 15-19 36.05239999999999 38.0 38.0 38.0 33.2 38.0 20-24 36.2128 38.0 38.0 38.0 34.0 38.0 25-29 35.8808 38.0 38.0 38.0 32.2 38.0 30-34 36.07435 38.0 38.0 38.0 33.6 38.0 35-39 35.81115 38.0 37.8 38.0 31.8 38.0 40-44 35.5702 38.0 37.0 38.0 30.0 38.0 45-49 35.5429 38.0 37.0 38.0 30.6 38.0 50-54 35.59015000000001 38.0 37.4 38.0 30.6 38.0 55-59 35.71705 38.0 37.6 38.0 31.8 38.0 60-64 35.3142 38.0 37.0 38.0 29.4 38.0 65-69 35.151050000000005 38.0 36.6 38.0 28.8 38.0 70-74 34.805 38.0 36.2 38.0 27.2 38.0 75-79 34.851749999999996 38.0 36.0 38.0 27.6 38.0 80-84 34.70735 38.0 35.8 38.0 26.8 38.0 85-89 34.646550000000005 38.0 35.8 38.0 26.4 38.0 90-94 34.3455 38.0 35.2 38.0 24.6 38.0 95-99 33.6457 38.0 34.2 38.0 19.8 38.0 100-104 33.16995 38.0 33.8 38.0 15.0 38.0 105-109 33.246750000000006 38.0 34.0 38.0 15.0 38.0 110-114 32.977850000000004 38.0 33.4 38.0 16.2 38.0 115-119 32.196 37.2 31.6 38.0 14.6 38.0 120-124 31.767150000000004 36.8 31.0 38.0 14.4 38.0 125-129 31.1476 36.2 29.0 38.0 13.4 38.0 130-134 30.58385 36.0 28.4 38.0 13.0 38.0 135-139 29.501350000000002 34.4 25.0 38.0 13.0 38.0 140-144 28.5648 33.8 23.0 38.0 2.0 38.0 145-149 26.368450000000003 33.0 13.4 38.0 2.0 38.0 150-151 20.028875 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 17.0 4 6.0 5 3.0 6 4.0 7 6.0 8 6.0 9 3.0 10 6.0 11 2.0 12 4.0 13 5.0 14 8.0 15 11.0 16 9.0 17 13.0 18 18.0 19 12.0 20 12.0 21 19.0 22 21.0 23 25.0 24 40.0 25 44.0 26 60.0 27 56.0 28 81.0 29 75.0 30 109.0 31 147.0 32 189.0 33 273.0 34 330.0 35 528.0 36 870.0 37 959.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.37318659329665 19.30965482741371 11.455727863931967 22.861430715357677 2 29.275000000000002 22.15 27.200000000000003 21.375 3 22.35 25.25 30.175 22.225 4 27.224999999999998 31.65 20.150000000000002 20.974999999999998 5 26.625 34.425 20.0 18.95 6 24.224999999999998 34.849999999999994 20.525 20.4 7 23.25 20.95 35.0 20.8 8 24.275 23.625 24.575 27.525 9 23.75 23.65 26.35 26.25 10-14 25.36 26.035000000000004 25.15 23.455000000000002 15-19 25.44 25.945 25.369999999999997 23.244999999999997 20-24 25.724999999999998 25.905 24.65 23.72 25-29 25.564999999999998 25.81 25.235000000000003 23.39 30-34 25.064999999999998 25.535000000000004 26.150000000000002 23.25 35-39 25.319999999999997 26.040000000000003 25.369999999999997 23.27 40-44 25.47 25.81 25.39 23.330000000000002 45-49 25.624999999999996 25.765 25.415 23.195 50-54 25.014999999999997 26.14 24.915000000000003 23.93 55-59 26.38 25.759999999999998 25.415 22.445 60-64 25.540000000000003 26.005 25.705 22.75 65-69 25.69 26.355 25.490000000000002 22.465 70-74 25.66 26.155 25.55 22.634999999999998 75-79 26.045 26.595000000000002 25.595000000000002 21.765 80-84 26.045 26.455000000000002 25.525 21.975 85-89 25.655 25.865 25.94 22.54 90-94 26.155 25.995 25.335 22.515 95-99 25.715 26.415 25.374999999999996 22.495 100-104 25.979999999999997 25.55 25.919999999999998 22.55 105-109 25.595000000000002 25.915 26.155 22.335 110-114 25.540000000000003 26.195 25.729999999999997 22.535 115-119 26.284999999999997 25.53 25.89 22.295 120-124 26.415 26.3 25.814999999999998 21.47 125-129 26.650000000000002 26.13 25.495 21.725 130-134 26.575 26.075 26.085 21.265 135-139 26.56 26.87 25.509999999999998 21.060000000000002 140-144 26.755000000000003 26.13 25.674999999999997 21.44 145-149 27.034999999999997 26.355 25.495 21.115000000000002 150-151 28.175 25.124999999999996 25.5625 21.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.0 25 0.0 26 0.0 27 1.5 28 3.5 29 6.5 30 7.5 31 9.5 32 16.0 33 22.5 34 29.5 35 41.0 36 59.0 37 73.0 38 77.5 39 100.5 40 126.0 41 150.5 42 178.5 43 195.0 44 217.5 45 220.0 46 198.5 47 191.5 48 182.5 49 182.0 50 190.5 51 162.0 52 127.5 53 112.0 54 108.5 55 102.0 56 88.0 57 87.0 58 81.5 59 67.0 60 65.5 61 63.5 62 60.0 63 57.0 64 50.5 65 46.5 66 44.0 67 40.0 68 30.5 69 23.0 70 20.5 71 20.0 72 17.5 73 11.0 74 9.0 75 6.0 76 1.5 77 2.0 78 2.0 79 1.0 80 0.5 81 0.0 82 1.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.0875 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.8625 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.75 0.0 0.0 0.0 0.0 134-135 6.225 0.0 0.0 0.0 0.0 136-137 6.7625 0.0 0.0 0.0 0.0 138-139 7.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148538 spots for SRR6958226.sra Written 1148538 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra Read 1148533 spots for SRR6958226.sra Written 1148533 spots for SRR6958226.sra SRR ids: ['SRR6958226.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t6cnpxlh SRR6958226.sra spots: 22970665 blocks: [[1, 1148533], [1148534, 2297066], [2297067, 3445599], [3445600, 4594132], [4594133, 5742665], [5742666, 6891198], [6891199, 8039731], [8039732, 9188264], [9188265, 10336797], [10336798, 11485330], [11485331, 12633863], [12633864, 13782396], [13782397, 14930929], [14930930, 16079462], [16079463, 17227995], [17227996, 18376528], [18376529, 19525061], [19525062, 20673594], [20673595, 21822127], [21822128, 22970665]] SRR6958226 file size 7762304 SRR6958226 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958226 SRR6958226_1.fastq SRR6958226_2.fastq Input file: SRR6958226_1.fastq Paired file: SRR6958226_2.fastq trimmed: SRR6958226-trimmed-pair1.fastq, SRR6958226-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:04:56 2024 >> started Thu Dec 12 03:05:27 2024 >> done (30.720s) 22970665 read pairs processed; of these: 89056 ( 0.39%) short read pairs filtered out after trimming by size control 77934 ( 0.34%) empty read pairs filtered out after trimming by size control 22803675 (99.27%) read pairs available; of these: 11406971 (50.02%) trimmed read pairs available after processing 11396704 (49.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 5 0.00% 21 9 0.00% 22 10 0.00% 23 14 0.00% 24 12 0.00% 25 10 0.00% 26 13 0.00% 27 12 0.00% 28 15 0.00% 29 12 0.00% 30 15 0.00% 31 14 0.00% 32 13 0.00% 33 21 0.00% 34 16 0.00% 35 21 0.00% 36 32 0.00% 37 44 0.00% 38 36 0.00% 39 35 0.00% 40 52 0.00% 41 52 0.00% 42 60 0.00% 43 61 0.00% 44 78 0.00% 45 75 0.00% 46 91 0.00% 47 101 0.00% 48 129 0.00% 49 129 0.00% 50 148 0.00% 51 207 0.00% 52 211 0.00% 53 256 0.00% 54 255 0.00% 55 262 0.00% 56 309 0.00% 57 346 0.00% 58 427 0.00% 59 454 0.00% 60 556 0.00% 61 633 0.00% 62 767 0.00% 63 731 0.00% 64 816 0.00% 65 956 0.00% 66 1009 0.00% 67 1052 0.00% 68 1216 0.01% 69 1449 0.01% 70 1581 0.01% 71 1858 0.01% 72 2155 0.01% 73 2407 0.01% 74 2596 0.01% 75 2894 0.01% 76 3224 0.01% 77 3493 0.02% 78 3841 0.02% 79 4293 0.02% 80 4789 0.02% 81 5418 0.02% 82 6238 0.03% 83 7020 0.03% 84 10822 0.05% 85 12819 0.06% 86 12748 0.06% 87 13245 0.06% 88 13623 0.06% 89 13938 0.06% 90 14279 0.06% 91 15292 0.07% 92 16447 0.07% 93 17403 0.08% 94 18201 0.08% 95 19270 0.08% 96 19926 0.09% 97 20830 0.09% 98 21343 0.09% 99 22449 0.10% 100 23604 0.10% 101 24511 0.11% 102 26513 0.12% 103 27672 0.12% 104 28927 0.13% 105 30378 0.13% 106 31638 0.14% 107 32293 0.14% 108 33468 0.15% 109 34295 0.15% 110 35596 0.16% 111 37376 0.16% 112 39125 0.17% 113 41351 0.18% 114 43023 0.19% 115 44879 0.20% 116 45672 0.20% 117 47506 0.21% 118 49059 0.22% 119 49771 0.22% 120 51205 0.22% 121 52823 0.23% 122 55374 0.24% 123 57450 0.25% 124 60892 0.27% 125 63061 0.28% 126 65074 0.29% 127 67784 0.30% 128 69624 0.31% 129 72070 0.32% 130 74507 0.33% 131 77748 0.34% 132 81604 0.36% 133 86051 0.38% 134 90184 0.40% 135 94920 0.42% 136 100709 0.44% 137 106186 0.47% 138 112948 0.50% 139 120687 0.53% 140 128420 0.56% 141 141267 0.62% 142 154837 0.68% 143 175228 0.77% 144 203286 0.89% 145 242189 1.06% 146 303901 1.33% 147 405607 1.78% 148 603709 2.65% 149 1156729 5.07% 150 5276541 23.14% 151 11396704 49.98% 22803675 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=32 prefix-density=0.19 prefix-fanout=2.8 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=8 fanout-score=375.58 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=36.9 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=39 prefix-density=0.24 prefix-fanout=2.0 sequence=GCGGCAACTGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=211.24 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=18.0 sequence=AGAAGAAGGGCATCATGGACAAGAT SRR6958226 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:06:49 Started mapping on | Dec 12 03:06:49 Finished on | Dec 12 03:09:02 Mapping speed, Million of reads per hour | 617.24 Number of input reads | 22803675 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 21749670 Uniquely mapped reads % | 95.38% Average mapped length | 292.13 Number of splices: Total | 25059285 Number of splices: Annotated (sjdb) | 23569676 Number of splices: GT/AG | 24713563 Number of splices: GC/AG | 278399 Number of splices: AT/AC | 13288 Number of splices: Non-canonical | 54035 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299131 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 6881 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.10% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 805506 805506 805506 N_multimapping 299131 299131 299131 N_noFeature 943246 21226865 1116237 N_ambiguous 421296 2929 73279 UnstrandedReadsAssigned:20385128 PositiveStrandReadsAssigned:519876 NegativeStrandReadsAssigned:20560154 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR6958226 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958226-trimmed-pair1.fastq SRR6958226-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,803,675 reads, 20,583,009 reads pseudoaligned [quant] estimated average fragment length: 262.494 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR6958226.ke.tsv 35125 SRR6958226.se.tsv 88098 total ==> SRR6958226.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.976 116.621 12.9834 PNS24247 1044 782.506 19.1927 1.84311 PNS24249 1928 1666.51 87.0813 3.92663 PNS24246 1044 782.506 19.1927 1.84311 PNS24248 1044 782.506 19.1927 1.84311 PNS24244 1471 1209.51 61.7199 3.83459 PNS24243 293 92.5982 0 0 KQK14069 1603 1341.51 488.39 27.3575 KQK14071 474 231.315 1.64732 0.535152 ==> SRR6958226.se.tsv <== BRADI_1g14170v3 517 BRADI_1g53295v3 1444 BRADI_1g59795v3 81 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 932 BRADI_1g74790v3 355 BRADI_1g09890v3 0 BRADI_1g77505v3 273 BRADI_1g48960v3 3 SRR6958226 completed mapping pipeline successfully