Starting /dee2/code/volunteer_pipeline.sh SRR6958227 current disk space = 1550639079424 free memory = 1604308728 SRR6958227 SRAfilesize ec7b5f98df02bfb4cd8786bce72755e9 SRR6958227.sra SRR6958227.sra file validated SRR6958227 is paired end SRR6958227 is conventional basespace SRR6958227 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958227_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.45775 25.0 18.0 32.0 18.0 33.0 2 26.30125 28.0 18.0 31.0 18.0 33.0 3 27.07575 29.0 25.0 31.0 18.0 33.0 4 30.58 31.0 29.0 33.0 27.0 33.0 5 32.024 33.0 32.0 33.0 32.0 33.0 6 35.19575 37.0 34.0 38.0 29.0 38.0 7 36.50225 38.0 36.0 38.0 34.0 38.0 8 36.5825 38.0 37.0 38.0 34.0 38.0 9 37.32875 38.0 38.0 38.0 36.0 38.0 10-14 37.526500000000006 38.0 38.0 38.0 37.6 38.0 15-19 37.5355 38.0 38.0 38.0 37.8 38.0 20-24 37.47745 38.0 38.0 38.0 37.8 38.0 25-29 37.448 38.0 38.0 38.0 37.6 38.0 30-34 37.20405 38.0 38.0 38.0 36.6 38.0 35-39 37.61155 38.0 38.0 38.0 38.0 38.0 40-44 37.557050000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.513 38.0 38.0 38.0 37.8 38.0 50-54 37.2997 38.0 38.0 38.0 37.0 38.0 55-59 37.36525 38.0 38.0 38.0 37.0 38.0 60-64 37.469 38.0 38.0 38.0 37.0 38.0 65-69 37.1705 38.0 38.0 38.0 36.4 38.0 70-74 36.395900000000005 38.0 37.0 38.0 31.0 38.0 75-79 37.291700000000006 38.0 38.0 38.0 36.8 38.0 80-84 37.3699 38.0 38.0 38.0 37.0 38.0 85-89 36.391000000000005 38.0 37.2 38.0 32.8 38.0 90-94 34.55685 38.0 34.6 38.0 21.4 38.0 95-99 36.0281 38.0 37.2 38.0 31.8 38.0 100-104 35.656850000000006 38.0 36.6 38.0 30.0 38.0 105-109 35.901300000000006 38.0 36.6 38.0 31.6 38.0 110-114 35.9812 38.0 37.6 38.0 32.6 38.0 115-119 36.48485 38.0 38.0 38.0 34.0 38.0 120-124 36.6505 38.0 38.0 38.0 34.4 38.0 125-129 36.58685 38.0 38.0 38.0 34.4 38.0 130-134 36.521300000000004 38.0 38.0 38.0 34.2 38.0 135-139 36.22895 38.0 38.0 38.0 33.4 38.0 140-144 35.617000000000004 38.0 36.4 38.0 31.4 38.0 145-149 34.983450000000005 38.0 35.8 38.0 30.6 38.0 150-151 31.065875 35.5 30.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 1.0 22 3.0 23 2.0 24 5.0 25 5.0 26 11.0 27 15.0 28 19.0 29 28.0 30 40.0 31 47.0 32 79.0 33 106.0 34 187.0 35 310.0 36 1025.0 37 2111.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.50150396499863 13.64506426032267 8.340169537872573 39.51326223680612 2 23.025000000000002 13.125 32.05 31.8 3 19.650000000000002 21.099999999999998 23.974999999999998 35.275 4 26.224999999999998 25.924999999999997 21.5 26.35 5 24.625 28.849999999999998 23.674999999999997 22.85 6 22.075 32.225 23.875 21.825 7 17.75 22.075 40.175 20.0 8 19.7 23.225 30.225 26.85 9 20.65 21.075 32.525 25.75 10-14 23.015 26.085 26.025 24.875 15-19 22.975 25.085 26.855 25.085 20-24 22.72408963585434 25.280112044817926 26.24549819927971 25.75030012004802 25-29 22.911145557277866 25.391269563478176 26.31631581579079 25.38126906345317 30-34 23.155 25.585 26.115 25.145 35-39 23.096154807740387 25.38126906345317 26.346317315865793 25.17625881294065 40-44 22.776138806940345 25.51127556377819 25.571278563928196 26.14130706535327 45-49 22.555 25.825 25.374999999999996 26.245 50-54 22.869999999999997 25.615 26.085 25.430000000000003 55-59 23.401170058502927 25.396269813490672 25.701285064253216 25.501275063753187 60-64 22.95 25.669999999999998 25.56 25.82 65-69 22.965 25.185000000000002 26.405 25.445 70-74 23.356167808390417 24.8012400620031 26.49632481624081 25.346267313365665 75-79 22.99 25.145 26.064999999999998 25.8 80-84 23.625 25.22 25.790000000000003 25.365 85-89 23.419999999999998 25.14 25.39 26.05 90-94 23.84 25.34 25.69 25.130000000000003 95-99 22.96 25.235000000000003 25.965 25.840000000000003 100-104 23.294999999999998 25.39 25.835 25.480000000000004 105-109 23.474999999999998 25.52 25.735000000000003 25.27 110-114 23.65 25.045 25.540000000000003 25.765 115-119 23.335 25.264999999999997 25.6 25.8 120-124 23.625 25.47 25.119999999999997 25.785000000000004 125-129 24.365000000000002 25.355 25.405 24.875 130-134 23.515 24.67 26.040000000000003 25.775 135-139 23.77 25.779999999999998 25.15 25.3 140-144 24.36 24.775 25.66 25.205 145-149 23.880000000000003 25.105 25.369999999999997 25.645 150-151 23.8875 25.2125 25.0625 25.837500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 2.5 27 1.5 28 3.0 29 6.0 30 7.5 31 13.5 32 17.0 33 17.5 34 26.5 35 35.5 36 49.5 37 72.0 38 94.5 39 120.0 40 141.0 41 158.5 42 177.0 43 200.0 44 209.5 45 216.0 46 228.0 47 203.0 48 166.0 49 159.0 50 159.0 51 138.0 52 113.0 53 109.5 54 103.0 55 88.5 56 84.5 57 83.0 58 77.5 59 85.0 60 82.0 61 65.5 62 58.5 63 53.5 64 58.5 65 55.5 66 51.5 67 43.5 68 33.0 69 24.5 70 20.5 71 22.0 72 16.5 73 15.5 74 12.0 75 7.5 76 6.0 77 2.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.575000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.04 25-29 0.005 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21855306276784 98.4 2 0.7562389715149987 1.5 3 0.0 0.0 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.95 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.5999999999999996 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.1500000000000004 0.0 0.0 0.0 0.0 128-129 3.7125000000000004 0.0 0.0 0.0 0.0 130-131 4.35 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.5 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958227 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958227_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87075 33.0 33.0 34.0 32.0 34.0 2 33.1085 34.0 33.0 34.0 32.0 34.0 3 33.11175 34.0 33.0 34.0 32.0 34.0 4 33.09025 34.0 33.0 34.0 33.0 34.0 5 33.07725 34.0 33.0 34.0 33.0 34.0 6 37.30925 38.0 38.0 38.0 37.0 38.0 7 37.327 38.0 38.0 38.0 37.0 38.0 8 37.23375 38.0 38.0 38.0 37.0 38.0 9 37.1725 38.0 38.0 38.0 37.0 38.0 10-14 37.07395 38.0 38.0 38.0 36.8 38.0 15-19 36.98925 38.0 38.0 38.0 36.6 38.0 20-24 36.7487 38.0 38.0 38.0 35.8 38.0 25-29 36.838049999999996 38.0 38.0 38.0 35.8 38.0 30-34 37.023649999999996 38.0 38.0 38.0 36.6 38.0 35-39 36.97215 38.0 38.0 38.0 36.2 38.0 40-44 35.95155 38.0 36.2 38.0 31.6 38.0 45-49 36.74425 38.0 37.6 38.0 35.0 38.0 50-54 36.980549999999994 38.0 38.0 38.0 36.6 38.0 55-59 36.95625 38.0 38.0 38.0 36.6 38.0 60-64 35.430749999999996 38.0 35.4 38.0 30.4 38.0 65-69 35.66289999999999 38.0 36.0 38.0 30.8 38.0 70-74 34.73915 37.8 34.2 38.0 27.4 38.0 75-79 36.36395 38.0 38.0 38.0 34.2 38.0 80-84 36.30615 38.0 38.0 38.0 34.2 38.0 85-89 36.190650000000005 38.0 38.0 38.0 33.8 38.0 90-94 36.50505 38.0 38.0 38.0 34.6 38.0 95-99 36.61015 38.0 38.0 38.0 35.0 38.0 100-104 36.61255 38.0 38.0 38.0 35.0 38.0 105-109 36.38635 38.0 38.0 38.0 34.2 38.0 110-114 36.263450000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.04549999999999 38.0 38.0 38.0 33.6 38.0 120-124 35.443 38.0 37.0 38.0 30.4 38.0 125-129 35.275349999999996 38.0 36.2 38.0 29.8 38.0 130-134 35.635450000000006 38.0 36.8 38.0 32.6 38.0 135-139 35.2469 38.0 36.0 38.0 31.0 38.0 140-144 35.093199999999996 38.0 36.0 38.0 31.0 38.0 145-149 34.643299999999996 38.0 36.0 38.0 29.4 38.0 150-151 29.434625 34.5 27.0 38.0 12.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 3.0 5 5.0 6 0.0 7 2.0 8 2.0 9 1.0 10 2.0 11 1.0 12 3.0 13 2.0 14 1.0 15 1.0 16 3.0 17 2.0 18 5.0 19 6.0 20 5.0 21 6.0 22 8.0 23 5.0 24 8.0 25 11.0 26 19.0 27 26.0 28 29.0 29 26.0 30 37.0 31 61.0 32 89.0 33 87.0 34 156.0 35 287.0 36 711.0 37 2378.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.0 17.724999999999998 12.174999999999999 32.1 2 29.575000000000003 23.95 27.900000000000002 18.575 3 22.075 27.0 27.450000000000003 23.474999999999998 4 25.924999999999997 32.15 20.349999999999998 21.575 5 25.85 31.974999999999998 21.15 21.025 6 23.75 35.15 20.150000000000002 20.95 7 22.75 19.475 34.050000000000004 23.724999999999998 8 23.3 24.3 24.224999999999998 28.175 9 23.925 22.85 28.275 24.95 10-14 25.81 26.255 23.235 24.7 15-19 25.290000000000003 25.865 24.77 24.075 20-24 25.8 25.61 24.38 24.21 25-29 25.430000000000003 26.634999999999998 23.84 24.095 30-34 25.245 25.979999999999997 24.905 23.87 35-39 25.605 26.135 24.29 23.97 40-44 25.385 25.919999999999998 24.215 24.48 45-49 25.919999999999998 25.2 24.975 23.905 50-54 25.64 26.265 24.2 23.895 55-59 26.205000000000002 25.624999999999996 24.235 23.935000000000002 60-64 25.835 25.72 24.37 24.075 65-69 25.365 25.615 25.4 23.62 70-74 26.450000000000003 25.4 24.39 23.76 75-79 25.465 25.39 24.779999999999998 24.365000000000002 80-84 26.16 25.580000000000002 24.560000000000002 23.7 85-89 25.88 25.790000000000003 24.52 23.810000000000002 90-94 26.195 25.174999999999997 24.759999999999998 23.87 95-99 25.91 25.990000000000002 24.605 23.494999999999997 100-104 25.564999999999998 25.665 24.884999999999998 23.885 105-109 25.95 25.485000000000003 24.779999999999998 23.785 110-114 26.13 26.38 23.66 23.830000000000002 115-119 25.869999999999997 26.08 24.875 23.175 120-124 26.195 25.96 24.67 23.175 125-129 26.515 25.840000000000003 24.435000000000002 23.21 130-134 25.924999999999997 25.75 24.83 23.494999999999997 135-139 26.640000000000004 26.009999999999998 24.735 22.615 140-144 27.165 26.224999999999998 24.535 22.075 145-149 26.695 25.674999999999997 24.765 22.865 150-151 27.450000000000003 26.125 24.474999999999998 21.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 1.5 23 1.5 24 1.0 25 1.5 26 3.5 27 4.5 28 4.0 29 4.0 30 6.0 31 6.0 32 6.5 33 12.0 34 18.0 35 29.0 36 48.0 37 64.5 38 88.0 39 118.0 40 128.5 41 137.5 42 171.0 43 186.5 44 182.5 45 192.0 46 190.0 47 188.5 48 181.0 49 164.5 50 157.0 51 147.0 52 129.5 53 120.5 54 110.5 55 89.0 56 85.0 57 90.5 58 91.0 59 90.0 60 87.0 61 77.5 62 68.5 63 68.0 64 65.5 65 54.0 66 50.0 67 48.5 68 41.5 69 37.0 70 30.5 71 24.5 72 22.5 73 22.5 74 20.5 75 13.0 76 6.0 77 4.0 78 3.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14076320444781 98.075 2 0.6823351023502654 1.35 3 0.1263583522870862 0.375 4 0.050543340914834464 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.1625 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.6624999999999996 0.0 0.0 0.0 0.0 130-131 4.3 0.0 0.0 0.0 0.0 132-133 4.925000000000001 0.0 0.0 0.0 0.0 134-135 5.475 0.0 0.0 0.0 0.0 136-137 5.9375 0.0 0.0 0.0 0.0 138-139 6.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957752 spots for SRR6958227.sra Written 957752 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra Read 957748 spots for SRR6958227.sra Written 957748 spots for SRR6958227.sra SRR ids: ['SRR6958227.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hdhhm25e SRR6958227.sra spots: 19154964 blocks: [[1, 957748], [957749, 1915496], [1915497, 2873244], [2873245, 3830992], [3830993, 4788740], [4788741, 5746488], [5746489, 6704236], [6704237, 7661984], [7661985, 8619732], [8619733, 9577480], [9577481, 10535228], [10535229, 11492976], [11492977, 12450724], [12450725, 13408472], [13408473, 14366220], [14366221, 15323968], [15323969, 16281716], [16281717, 17239464], [17239465, 18197212], [18197213, 19154964]] SRR6958227 file size 6469288 SRR6958227 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958227 SRR6958227_1.fastq SRR6958227_2.fastq Input file: SRR6958227_1.fastq Paired file: SRR6958227_2.fastq trimmed: SRR6958227-trimmed-pair1.fastq, SRR6958227-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:50:19 2024 >> started Fri Dec 6 16:50:38 2024 >> done (19.758s) 19154964 read pairs processed; of these: 15420 ( 0.08%) short read pairs filtered out after trimming by size control 13841 ( 0.07%) empty read pairs filtered out after trimming by size control 19125703 (99.85%) read pairs available; of these: 7477936 (39.10%) trimmed read pairs available after processing 11647767 (60.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 7 0.00% 23 6 0.00% 24 2 0.00% 25 4 0.00% 26 0 0.00% 27 4 0.00% 28 6 0.00% 29 2 0.00% 30 5 0.00% 31 8 0.00% 32 5 0.00% 33 6 0.00% 34 3 0.00% 35 2 0.00% 36 5 0.00% 37 7 0.00% 38 6 0.00% 39 11 0.00% 40 11 0.00% 41 10 0.00% 42 10 0.00% 43 9 0.00% 44 10 0.00% 45 12 0.00% 46 19 0.00% 47 18 0.00% 48 14 0.00% 49 21 0.00% 50 29 0.00% 51 25 0.00% 52 29 0.00% 53 37 0.00% 54 40 0.00% 55 48 0.00% 56 58 0.00% 57 47 0.00% 58 48 0.00% 59 72 0.00% 60 81 0.00% 61 97 0.00% 62 99 0.00% 63 139 0.00% 64 117 0.00% 65 141 0.00% 66 159 0.00% 67 179 0.00% 68 216 0.00% 69 274 0.00% 70 287 0.00% 71 341 0.00% 72 415 0.00% 73 482 0.00% 74 506 0.00% 75 617 0.00% 76 696 0.00% 77 739 0.00% 78 831 0.00% 79 987 0.01% 80 1119 0.01% 81 1298 0.01% 82 1477 0.01% 83 1679 0.01% 84 2733 0.01% 85 3175 0.02% 86 3338 0.02% 87 3550 0.02% 88 3780 0.02% 89 4069 0.02% 90 4319 0.02% 91 4803 0.03% 92 5447 0.03% 93 5734 0.03% 94 6411 0.03% 95 6811 0.04% 96 7514 0.04% 97 8045 0.04% 98 8622 0.05% 99 9353 0.05% 100 10107 0.05% 101 10762 0.06% 102 11939 0.06% 103 13002 0.07% 104 14226 0.07% 105 15158 0.08% 106 16215 0.08% 107 16738 0.09% 108 17821 0.09% 109 18731 0.10% 110 19529 0.10% 111 21316 0.11% 112 22528 0.12% 113 24185 0.13% 114 25673 0.13% 115 27642 0.14% 116 29067 0.15% 117 30003 0.16% 118 31035 0.16% 119 32147 0.17% 120 33105 0.17% 121 34596 0.18% 122 36558 0.19% 123 39075 0.20% 124 41144 0.22% 125 43128 0.23% 126 44785 0.23% 127 46335 0.24% 128 47942 0.25% 129 49275 0.26% 130 50612 0.26% 131 52242 0.27% 132 54736 0.29% 133 57987 0.30% 134 60051 0.31% 135 63279 0.33% 136 66061 0.35% 137 68713 0.36% 138 70894 0.37% 139 74753 0.39% 140 77779 0.41% 141 81727 0.43% 142 88685 0.46% 143 96359 0.50% 144 107092 0.56% 145 121030 0.63% 146 144165 0.75% 147 183925 0.96% 148 268902 1.41% 149 537900 2.81% 150 4225927 22.10% 151 11647767 60.90% 19125703 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=20 prefix-density=0.80 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=32.50 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=15 prefix-density=0.50 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=100.69 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958227 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:51:21 Started mapping on | Dec 06 16:51:21 Finished on | Dec 06 16:53:40 Mapping speed, Million of reads per hour | 495.34 Number of input reads | 19125703 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18381594 Uniquely mapped reads % | 96.11% Average mapped length | 295.56 Number of splices: Total | 21139297 Number of splices: Annotated (sjdb) | 19870262 Number of splices: GT/AG | 20841531 Number of splices: GC/AG | 248719 Number of splices: AT/AC | 7714 Number of splices: Non-canonical | 41333 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 209954 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 13208 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.33% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 543740 543740 543740 N_multimapping 209954 209954 209954 N_noFeature 670711 17843824 814766 N_ambiguous 462261 2307 68975 UnstrandedReadsAssigned:17248622 PositiveStrandReadsAssigned:535463 NegativeStrandReadsAssigned:17497853 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958227 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958227-trimmed-pair1.fastq SRR6958227-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,125,703 reads, 17,495,785 reads pseudoaligned [quant] estimated average fragment length: 251.868 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52973 SRR6958227.ke.tsv 35125 SRR6958227.se.tsv 88098 total ==> SRR6958227.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.705 0 0 PNS24247 1044 793.132 53.8358 5.88543 PNS24249 1928 1677.13 60.6928 3.13778 PNS24246 1044 793.132 53.8358 5.88543 PNS24248 1044 793.132 53.8358 5.88543 PNS24244 1471 1220.13 32.7998 2.33086 PNS24243 293 92.9329 0 0 KQK14069 1603 1352.13 6782.26 434.918 KQK14071 474 237.88 140.904 51.359 ==> SRR6958227.se.tsv <== BRADI_1g14170v3 7776 BRADI_1g53295v3 1137 BRADI_1g59795v3 118 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 259 BRADI_1g74790v3 84 BRADI_1g09890v3 0 BRADI_1g77505v3 263 BRADI_1g48960v3 0 SRR6958227 completed mapping pipeline successfully