Starting /dee2/code/volunteer_pipeline.sh SRR6958228 current disk space = 1550600122368 free memory = 1601804692 SRR6958228 SRAfilesize 907837c0e8c378f903a62692cecc2f92 SRR6958228.sra SRR6958228.sra file validated SRR6958228 is paired end SRR6958228 is conventional basespace SRR6958228 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958228_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.97525 18.0 18.0 31.0 2.0 33.0 2 27.10325 28.0 25.0 31.0 18.0 33.0 3 29.76325 31.0 27.0 33.0 27.0 33.0 4 31.887 33.0 32.0 33.0 31.0 33.0 5 32.10625 33.0 33.0 33.0 32.0 34.0 6 36.20975 38.0 36.0 38.0 33.0 38.0 7 37.073 38.0 37.0 38.0 35.0 38.0 8 37.26375 38.0 38.0 38.0 36.0 38.0 9 37.4955 38.0 38.0 38.0 37.0 38.0 10-14 37.50064999999999 38.0 38.0 38.0 37.4 38.0 15-19 37.5297 38.0 38.0 38.0 37.8 38.0 20-24 37.464800000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.18235 38.0 38.0 38.0 36.6 38.0 30-34 37.23350000000001 38.0 38.0 38.0 36.6 38.0 35-39 37.59935 38.0 38.0 38.0 38.0 38.0 40-44 37.58415 38.0 38.0 38.0 38.0 38.0 45-49 37.436749999999996 38.0 38.0 38.0 37.2 38.0 50-54 37.4194 38.0 38.0 38.0 37.4 38.0 55-59 37.387600000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.419650000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.442099999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.3801 38.0 38.0 38.0 37.2 38.0 75-79 36.273300000000006 38.0 37.0 38.0 31.0 38.0 80-84 37.088499999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.848850000000006 38.0 38.0 38.0 35.2 38.0 90-94 36.61745 38.0 38.0 38.0 34.4 38.0 95-99 36.252250000000004 38.0 37.8 38.0 33.4 38.0 100-104 36.112199999999994 38.0 37.8 38.0 33.0 38.0 105-109 36.0772 38.0 37.6 38.0 32.6 38.0 110-114 36.0721 38.0 37.4 38.0 32.8 38.0 115-119 36.4756 38.0 38.0 38.0 34.0 38.0 120-124 36.66525 38.0 38.0 38.0 34.2 38.0 125-129 36.6221 38.0 38.0 38.0 33.8 38.0 130-134 36.4054 38.0 38.0 38.0 34.0 38.0 135-139 35.72795 38.0 36.2 38.0 31.4 38.0 140-144 35.61015 38.0 36.0 38.0 31.0 38.0 145-149 33.6271 38.0 33.0 38.0 22.2 38.0 150-151 29.2885 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 2.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 3.0 25 3.0 26 10.0 27 22.0 28 18.0 29 34.0 30 52.0 31 49.0 32 71.0 33 115.0 34 171.0 35 320.0 36 832.0 37 2293.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.07306190741773 16.843279419966535 8.365867261572783 41.717791411042946 2 25.674999999999997 13.775 31.424999999999997 29.125 3 21.025 18.725 22.5 37.75 4 24.8 24.9 22.625 27.675 5 25.3 29.049999999999997 24.474999999999998 21.175 6 22.475 32.05 23.65 21.825 7 17.65 23.775 39.225 19.35 8 21.0 23.625 28.075 27.3 9 19.55 20.95 34.300000000000004 25.2 10-14 22.825 26.44 26.31 24.425 15-19 22.11 25.945 26.295 25.650000000000002 20-24 22.61 26.284999999999997 26.305 24.8 25-29 22.5 25.445 26.5 25.555 30-34 22.36 25.485000000000003 26.674999999999997 25.480000000000004 35-39 22.67 25.555 26.515 25.259999999999998 40-44 22.745 25.485000000000003 26.700000000000003 25.069999999999997 45-49 22.62 25.755 26.525 25.1 50-54 22.485 26.005 26.240000000000002 25.27 55-59 22.605 25.915 26.02 25.46 60-64 22.765 25.295 26.085 25.855 65-69 22.884999999999998 25.715 26.009999999999998 25.39 70-74 23.095 25.564999999999998 25.94 25.4 75-79 22.259999999999998 25.41 26.325 26.005 80-84 22.655 25.56 26.035000000000004 25.75 85-89 23.175 24.915000000000003 26.35 25.56 90-94 23.044999999999998 25.259999999999998 25.979999999999997 25.715 95-99 22.93 25.785000000000004 25.44 25.845000000000002 100-104 23.369999999999997 25.669999999999998 25.655 25.305 105-109 23.54 24.795 25.985000000000003 25.679999999999996 110-114 23.36 25.28 25.835 25.525 115-119 23.72 25.035 26.27 24.975 120-124 23.46 25.575 25.845000000000002 25.119999999999997 125-129 23.565 24.89 26.22 25.324999999999996 130-134 23.405 24.85 25.695 26.05 135-139 23.485 25.75 25.564999999999998 25.2 140-144 23.395 25.52 25.83 25.255 145-149 23.275000000000002 25.61 25.290000000000003 25.825 150-151 23.35 25.6 25.5375 25.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 3.0 27 3.0 28 5.5 29 9.5 30 9.5 31 7.5 32 12.0 33 22.5 34 27.5 35 36.5 36 53.0 37 68.0 38 83.0 39 103.0 40 133.5 41 154.0 42 183.0 43 210.0 44 214.5 45 223.0 46 228.5 47 216.5 48 206.5 49 198.0 50 174.0 51 141.0 52 116.0 53 116.5 54 102.5 55 79.0 56 78.5 57 88.0 58 83.0 59 77.5 60 78.0 61 65.0 62 58.0 63 56.5 64 49.0 65 42.0 66 36.0 67 29.5 68 22.0 69 21.0 70 18.5 71 17.0 72 15.0 73 8.5 74 6.5 75 4.0 76 2.0 77 0.5 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9625 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.2374999999999998 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 2.0250000000000004 0.0 0.0 0.0 0.0 132-133 2.3625 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.0999999999999996 0.0 0.0 0.0 0.0 138-139 3.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTAGAG 10 0.006846698 144.88751 7 >>END_MODULE SRR6958228 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958228_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00325 33.0 33.0 34.0 32.0 34.0 2 33.1315 34.0 33.0 34.0 32.0 34.0 3 33.2225 34.0 33.0 34.0 33.0 34.0 4 33.15925 34.0 33.0 34.0 33.0 34.0 5 33.21 34.0 33.0 34.0 33.0 34.0 6 37.3635 38.0 38.0 38.0 37.0 38.0 7 37.2075 38.0 38.0 38.0 37.0 38.0 8 37.25125 38.0 38.0 38.0 37.0 38.0 9 37.29125 38.0 38.0 38.0 37.0 38.0 10-14 37.1016 38.0 38.0 38.0 36.6 38.0 15-19 37.00675 38.0 38.0 38.0 36.4 38.0 20-24 37.00025 38.0 38.0 38.0 36.2 38.0 25-29 37.1443 38.0 38.0 38.0 36.8 38.0 30-34 37.29600000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.38015 38.0 38.0 38.0 38.0 38.0 40-44 37.365300000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.25455 38.0 38.0 38.0 37.2 38.0 50-54 36.93755 38.0 38.0 38.0 36.0 38.0 55-59 36.9949 38.0 38.0 38.0 36.0 38.0 60-64 36.9752 38.0 38.0 38.0 36.2 38.0 65-69 36.91705 38.0 38.0 38.0 35.8 38.0 70-74 36.8283 38.0 38.0 38.0 35.6 38.0 75-79 36.586 38.0 38.0 38.0 35.2 38.0 80-84 36.3167 38.0 38.0 38.0 33.6 38.0 85-89 36.157799999999995 38.0 38.0 38.0 33.8 38.0 90-94 36.54145 38.0 38.0 38.0 34.4 38.0 95-99 36.6529 38.0 38.0 38.0 35.0 38.0 100-104 36.75915 38.0 38.0 38.0 35.0 38.0 105-109 36.64125 38.0 38.0 38.0 34.6 38.0 110-114 36.47935 38.0 38.0 38.0 34.6 38.0 115-119 34.06755 37.4 32.8 38.0 25.8 38.0 120-124 32.55 36.6 28.4 38.0 20.2 38.0 125-129 34.7447 38.0 35.2 38.0 26.4 38.0 130-134 33.5669 37.6 32.2 38.0 22.4 38.0 135-139 30.06345 33.6 24.6 38.0 16.6 38.0 140-144 34.6554 38.0 35.2 38.0 28.0 38.0 145-149 33.8557 38.0 35.0 38.0 24.2 38.0 150-151 27.903875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 0.0 5 1.0 6 0.0 7 2.0 8 1.0 9 1.0 10 1.0 11 2.0 12 1.0 13 2.0 14 1.0 15 1.0 16 2.0 17 1.0 18 2.0 19 2.0 20 4.0 21 6.0 22 11.0 23 11.0 24 9.0 25 14.0 26 14.0 27 32.0 28 34.0 29 39.0 30 41.0 31 69.0 32 95.0 33 119.0 34 201.0 35 390.0 36 997.0 37 1885.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.775 19.075 13.3 33.85 2 30.925000000000004 23.65 27.725 17.7 3 22.625 26.125 27.275 23.974999999999998 4 25.025 31.6 21.5 21.875 5 26.450000000000003 32.574999999999996 20.349999999999998 20.625 6 22.675 36.35 20.925 20.05 7 22.3 19.900000000000002 35.449999999999996 22.35 8 24.275 21.825 25.15 28.749999999999996 9 23.075000000000003 22.45 28.825 25.650000000000002 10-14 25.52 26.3 23.849999999999998 24.33 15-19 25.255 25.985000000000003 24.945 23.815 20-24 25.369999999999997 26.484999999999996 24.44 23.705000000000002 25-29 25.465 26.32 24.240000000000002 23.974999999999998 30-34 25.7 25.929999999999996 24.610000000000003 23.76 35-39 25.405 26.029999999999998 24.11 24.455 40-44 25.509999999999998 26.040000000000003 24.765 23.685000000000002 45-49 25.1 26.669999999999998 24.445 23.785 50-54 25.965 25.535000000000004 24.84 23.66 55-59 25.729999999999997 25.47 24.875 23.925 60-64 25.7 25.55 24.834999999999997 23.915 65-69 25.97 26.08 24.535 23.415 70-74 26.009999999999998 25.790000000000003 24.51 23.69 75-79 25.490000000000002 25.81 24.635 24.065 80-84 25.735000000000003 25.515 25.22 23.53 85-89 25.435000000000002 26.055 24.834999999999997 23.674999999999997 90-94 25.755 25.629999999999995 24.88 23.735 95-99 25.590000000000003 26.334999999999997 24.68 23.395 100-104 26.340000000000003 25.679999999999996 24.955 23.025000000000002 105-109 25.080000000000002 25.935000000000002 25.580000000000002 23.405 110-114 25.55 26.195 25.56 22.695 115-119 25.650000000000002 26.345000000000002 24.215 23.79 120-124 26.025 25.919999999999998 24.98 23.075000000000003 125-129 26.155 26.169999999999998 24.740000000000002 22.935 130-134 26.169999999999998 25.46 25.09 23.28 135-139 26.22 26.615 24.575 22.59 140-144 25.95 26.650000000000002 24.68 22.720000000000002 145-149 26.540000000000003 25.979999999999997 24.279999999999998 23.200000000000003 150-151 25.837500000000002 25.9625 25.424999999999997 22.775000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.5 24 0.5 25 1.0 26 2.5 27 2.0 28 3.0 29 4.5 30 4.5 31 8.5 32 15.5 33 17.5 34 17.5 35 34.0 36 50.0 37 59.5 38 73.0 39 93.5 40 116.0 41 155.5 42 186.0 43 196.0 44 213.5 45 207.5 46 190.5 47 184.5 48 174.5 49 174.0 50 179.0 51 160.0 52 134.0 53 111.5 54 97.0 55 98.5 56 99.5 57 94.5 58 84.0 59 72.5 60 83.5 61 80.5 62 62.5 63 62.5 64 54.0 65 44.5 66 44.5 67 43.0 68 43.5 69 42.5 70 33.5 71 22.0 72 18.5 73 15.0 74 8.5 75 7.0 76 5.5 77 3.0 78 2.5 79 2.5 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85989359006841 97.55 2 1.064099315936154 2.1 3 0.02533569799847986 0.075 4 0.0 0.0 5 0.02533569799847986 0.125 6 0.02533569799847986 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.2000000000000002 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.4874999999999998 0.0 0.0 0.0 0.0 130-131 1.6625 0.0 0.0 0.0 0.0 132-133 1.925 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGACA 10 0.006830828 145.0 7 >>END_MODULE Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129235 spots for SRR6958228.sra Written 1129235 spots for SRR6958228.sra Read 1129238 spots for SRR6958228.sra Written 1129238 spots for SRR6958228.sra SRR ids: ['SRR6958228.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_48dbxj6s SRR6958228.sra spots: 22584703 blocks: [[1, 1129235], [1129236, 2258470], [2258471, 3387705], [3387706, 4516940], [4516941, 5646175], [5646176, 6775410], [6775411, 7904645], [7904646, 9033880], [9033881, 10163115], [10163116, 11292350], [11292351, 12421585], [12421586, 13550820], [13550821, 14680055], [14680056, 15809290], [15809291, 16938525], [16938526, 18067760], [18067761, 19196995], [19196996, 20326230], [20326231, 21455465], [21455466, 22584703]] SRR6958228 file size 7631514 SRR6958228 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958228 SRR6958228_1.fastq SRR6958228_2.fastq Input file: SRR6958228_1.fastq Paired file: SRR6958228_2.fastq trimmed: SRR6958228-trimmed-pair1.fastq, SRR6958228-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:53:12 2024 >> started Fri Dec 6 16:53:36 2024 >> done (24.237s) 22584703 read pairs processed; of these: 13401 ( 0.06%) short read pairs filtered out after trimming by size control 11014 ( 0.05%) empty read pairs filtered out after trimming by size control 22560288 (99.89%) read pairs available; of these: 7062766 (31.31%) trimmed read pairs available after processing 15497522 (68.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 2 0.00% 24 5 0.00% 25 10 0.00% 26 7 0.00% 27 4 0.00% 28 8 0.00% 29 2 0.00% 30 5 0.00% 31 5 0.00% 32 4 0.00% 33 6 0.00% 34 5 0.00% 35 10 0.00% 36 12 0.00% 37 10 0.00% 38 9 0.00% 39 6 0.00% 40 9 0.00% 41 8 0.00% 42 13 0.00% 43 19 0.00% 44 22 0.00% 45 9 0.00% 46 12 0.00% 47 20 0.00% 48 17 0.00% 49 17 0.00% 50 16 0.00% 51 26 0.00% 52 20 0.00% 53 20 0.00% 54 38 0.00% 55 30 0.00% 56 37 0.00% 57 45 0.00% 58 46 0.00% 59 65 0.00% 60 61 0.00% 61 78 0.00% 62 91 0.00% 63 105 0.00% 64 121 0.00% 65 104 0.00% 66 138 0.00% 67 154 0.00% 68 167 0.00% 69 177 0.00% 70 225 0.00% 71 251 0.00% 72 266 0.00% 73 308 0.00% 74 405 0.00% 75 428 0.00% 76 463 0.00% 77 535 0.00% 78 649 0.00% 79 689 0.00% 80 827 0.00% 81 897 0.00% 82 1093 0.00% 83 1239 0.01% 84 1881 0.01% 85 2442 0.01% 86 2474 0.01% 87 2707 0.01% 88 2765 0.01% 89 2907 0.01% 90 3211 0.01% 91 3393 0.02% 92 3733 0.02% 93 4150 0.02% 94 4373 0.02% 95 4707 0.02% 96 5102 0.02% 97 5409 0.02% 98 5556 0.02% 99 6027 0.03% 100 6466 0.03% 101 6924 0.03% 102 7607 0.03% 103 8095 0.04% 104 8963 0.04% 105 9126 0.04% 106 9978 0.04% 107 10561 0.05% 108 10829 0.05% 109 11557 0.05% 110 12222 0.05% 111 12914 0.06% 112 13881 0.06% 113 14836 0.07% 114 15708 0.07% 115 16570 0.07% 116 17716 0.08% 117 18293 0.08% 118 19128 0.08% 119 19458 0.09% 120 20971 0.09% 121 21578 0.10% 122 22581 0.10% 123 24533 0.11% 124 25811 0.11% 125 27050 0.12% 126 28334 0.13% 127 29400 0.13% 128 30373 0.13% 129 31039 0.14% 130 33114 0.15% 131 34891 0.15% 132 36535 0.16% 133 38909 0.17% 134 41027 0.18% 135 43503 0.19% 136 45879 0.20% 137 48605 0.22% 138 51320 0.23% 139 54386 0.24% 140 58452 0.26% 141 63212 0.28% 142 70658 0.31% 143 78721 0.35% 144 90159 0.40% 145 106478 0.47% 146 128896 0.57% 147 172185 0.76% 148 259878 1.15% 149 544140 2.41% 150 4478391 19.85% 151 15497522 68.69% 22560288 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=21 prefix-density=0.61 prefix-fanout=2.7 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=85.44 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.3 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=61.28 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=12.0 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958228 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:54:28 Started mapping on | Dec 06 16:54:28 Finished on | Dec 06 16:56:50 Mapping speed, Million of reads per hour | 571.95 Number of input reads | 22560288 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21826459 Uniquely mapped reads % | 96.75% Average mapped length | 297.85 Number of splices: Total | 26119648 Number of splices: Annotated (sjdb) | 24636234 Number of splices: GT/AG | 25758314 Number of splices: GC/AG | 304322 Number of splices: AT/AC | 10616 Number of splices: Non-canonical | 46396 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278329 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 14824 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 464501 464501 464501 N_multimapping 278329 278329 278329 N_noFeature 768566 21181757 925511 N_ambiguous 569967 2822 83337 UnstrandedReadsAssigned:20487926 PositiveStrandReadsAssigned:641880 NegativeStrandReadsAssigned:20817611 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958228 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958228-trimmed-pair1.fastq SRR6958228-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,560,288 reads, 20,794,305 reads pseudoaligned [quant] estimated average fragment length: 276.158 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52973 SRR6958228.ke.tsv 35125 SRR6958228.se.tsv 88098 total ==> SRR6958228.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.266 0 0 PNS24247 1044 768.842 70.358 6.60144 PNS24249 1928 1652.84 43.7923 1.9113 PNS24246 1044 768.842 70.358 6.60144 PNS24248 1044 768.842 70.358 6.60144 PNS24244 1471 1195.84 36.1336 2.17972 PNS24243 293 80.214 0 0 KQK14069 1603 1327.84 5152.53 279.922 KQK14071 474 217.106 77.9234 25.8916 ==> SRR6958228.se.tsv <== BRADI_1g14170v3 5837 BRADI_1g53295v3 1330 BRADI_1g59795v3 135 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 453 BRADI_1g74790v3 98 BRADI_1g09890v3 1 BRADI_1g77505v3 342 BRADI_1g48960v3 0 SRR6958228 completed mapping pipeline successfully