Starting /dee2/code/volunteer_pipeline.sh SRR6958229 current disk space = 1550559313920 free memory = 1475502004 SRR6958229 SRAfilesize 55408aa45a926530fa01dc4e778581ed SRR6958229.sra SRR6958229.sra file validated SRR6958229 is paired end SRR6958229 is conventional basespace SRR6958229 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958229_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.44875 32.0 18.0 33.0 18.0 33.0 2 27.8565 29.0 25.0 33.0 18.0 33.0 3 29.6215 31.0 29.0 33.0 25.0 33.0 4 31.455 33.0 32.0 33.0 28.0 33.0 5 32.49225 33.0 33.0 33.0 32.0 34.0 6 36.46475 38.0 37.0 38.0 34.0 38.0 7 37.213 38.0 38.0 38.0 36.0 38.0 8 36.0415 38.0 38.0 38.0 31.0 38.0 9 37.21975 38.0 38.0 38.0 36.0 38.0 10-14 36.485850000000006 38.0 37.0 38.0 31.4 38.0 15-19 37.41435 38.0 38.0 38.0 37.2 38.0 20-24 37.59765 38.0 38.0 38.0 38.0 38.0 25-29 37.55114999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.49425 38.0 38.0 38.0 38.0 38.0 35-39 37.30075 38.0 38.0 38.0 37.0 38.0 40-44 37.408699999999996 38.0 38.0 38.0 37.2 38.0 45-49 37.47055 38.0 38.0 38.0 37.6 38.0 50-54 36.6293 38.0 37.6 38.0 32.0 38.0 55-59 37.20145 38.0 38.0 38.0 36.6 38.0 60-64 37.27675 38.0 38.0 38.0 37.0 38.0 65-69 37.34925 38.0 38.0 38.0 36.8 38.0 70-74 37.3355 38.0 38.0 38.0 37.0 38.0 75-79 36.89815 38.0 37.8 38.0 34.8 38.0 80-84 37.038650000000004 38.0 38.0 38.0 35.4 38.0 85-89 37.1739 38.0 38.0 38.0 36.0 38.0 90-94 35.5884 38.0 35.6 38.0 29.8 38.0 95-99 36.844350000000006 38.0 38.0 38.0 34.8 38.0 100-104 36.8861 38.0 38.0 38.0 35.2 38.0 105-109 36.7354 38.0 38.0 38.0 34.6 38.0 110-114 36.70505 38.0 38.0 38.0 34.6 38.0 115-119 36.3405 38.0 37.6 38.0 33.0 38.0 120-124 36.2586 38.0 37.6 38.0 33.6 38.0 125-129 36.12590000000001 38.0 37.8 38.0 33.2 38.0 130-134 36.13925 38.0 37.6 38.0 33.4 38.0 135-139 35.936249999999994 38.0 37.4 38.0 32.2 38.0 140-144 35.6445 38.0 36.0 38.0 31.0 38.0 145-149 34.91175 38.0 35.8 38.0 30.2 38.0 150-151 30.816875000000003 35.5 29.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 4.0 22 3.0 23 7.0 24 5.0 25 9.0 26 12.0 27 16.0 28 22.0 29 22.0 30 35.0 31 46.0 32 73.0 33 73.0 34 151.0 35 280.0 36 782.0 37 2455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.19321685508736 8.787255909558068 8.453237410071942 38.56628982528263 2 26.8 12.174999999999999 33.375 27.650000000000002 3 21.825 16.975 25.25 35.949999999999996 4 26.875 23.925 22.025 27.175 5 26.224999999999998 29.4 22.425 21.95 6 21.725 32.824999999999996 24.6 20.849999999999998 7 17.75 22.900000000000002 40.625 18.725 8 20.05 22.625 31.175000000000004 26.150000000000002 9 19.25 21.05 34.525 25.174999999999997 10-14 23.59 25.900000000000002 25.615 24.895 15-19 21.875 25.259999999999998 26.86 26.005 20-24 22.8 25.28 26.474999999999998 25.445 25-29 23.369999999999997 25.235000000000003 25.669999999999998 25.724999999999998 30-34 23.09 25.509999999999998 26.025 25.374999999999996 35-39 22.895 25.445 25.865 25.795 40-44 23.119999999999997 25.619999999999997 26.035000000000004 25.224999999999998 45-49 23.1 26.045 25.290000000000003 25.564999999999998 50-54 22.905 25.895000000000003 26.025 25.174999999999997 55-59 23.425 25.330000000000002 26.165 25.080000000000002 60-64 22.994999999999997 25.19 26.465 25.35 65-69 22.98 25.505 26.25 25.264999999999997 70-74 23.325000000000003 25.46 25.6 25.615 75-79 23.485 25.615 25.72 25.180000000000003 80-84 23.44 25.415 25.885 25.259999999999998 85-89 23.075000000000003 25.945 25.095 25.885 90-94 23.48 26.035000000000004 25.480000000000004 25.005 95-99 23.745 24.275 26.200000000000003 25.779999999999998 100-104 24.005000000000003 25.290000000000003 25.7 25.005 105-109 23.34 25.540000000000003 25.66 25.46 110-114 23.485 25.36 25.935000000000002 25.22 115-119 23.544999999999998 24.955 25.575 25.924999999999997 120-124 23.36 25.495 25.679999999999996 25.465 125-129 23.745 24.959999999999997 25.569999999999997 25.724999999999998 130-134 23.875 25.44 25.19 25.495 135-139 23.849999999999998 25.505 25.335 25.31 140-144 23.195 25.745 24.84 26.22 145-149 23.635 24.72 25.775 25.869999999999997 150-151 23.65 25.912499999999998 25.05 25.387500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 2.0 28 4.5 29 7.5 30 10.5 31 13.5 32 15.0 33 22.5 34 32.5 35 33.5 36 35.5 37 57.5 38 79.0 39 95.0 40 125.0 41 167.0 42 192.0 43 199.0 44 212.0 45 224.5 46 220.5 47 196.0 48 193.5 49 187.5 50 158.5 51 141.0 52 129.5 53 119.0 54 102.0 55 90.5 56 89.0 57 85.5 58 80.0 59 74.0 60 67.5 61 58.5 62 62.0 63 59.0 64 55.0 65 55.5 66 44.5 67 36.5 68 30.5 69 31.5 70 28.5 71 23.5 72 18.5 73 10.5 74 9.5 75 7.5 76 2.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.4875 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.375 0.0 0.0 0.0 0.0 134-135 5.95 0.0 0.0 0.0 0.0 136-137 6.3625 0.0 0.0 0.0 0.0 138-139 6.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958229 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958229_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88775 33.0 33.0 34.0 32.0 34.0 2 33.015 34.0 33.0 34.0 32.0 34.0 3 33.06075 34.0 33.0 34.0 32.0 34.0 4 32.97825 34.0 33.0 34.0 32.0 34.0 5 32.85275 34.0 33.0 34.0 32.0 34.0 6 37.10225 38.0 38.0 38.0 37.0 38.0 7 37.083 38.0 38.0 38.0 37.0 38.0 8 37.07225 38.0 38.0 38.0 37.0 38.0 9 37.149 38.0 38.0 38.0 37.0 38.0 10-14 37.170100000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.1981 38.0 38.0 38.0 37.0 38.0 20-24 37.24875 38.0 38.0 38.0 37.0 38.0 25-29 37.08895 38.0 38.0 38.0 36.6 38.0 30-34 37.117149999999995 38.0 38.0 38.0 36.8 38.0 35-39 36.62265000000001 38.0 38.0 38.0 34.6 38.0 40-44 36.52285 38.0 38.0 38.0 34.6 38.0 45-49 36.4813 38.0 38.0 38.0 34.6 38.0 50-54 36.8798 38.0 38.0 38.0 35.6 38.0 55-59 35.67645 38.0 36.8 38.0 28.6 38.0 60-64 36.868700000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.85185 38.0 38.0 38.0 36.0 38.0 70-74 36.86105 38.0 38.0 38.0 36.0 38.0 75-79 36.42235 38.0 37.8 38.0 34.0 38.0 80-84 36.69325 38.0 38.0 38.0 35.0 38.0 85-89 35.88085 38.0 37.0 38.0 29.6 38.0 90-94 36.09135 38.0 37.6 38.0 32.8 38.0 95-99 36.26989999999999 38.0 38.0 38.0 33.6 38.0 100-104 36.2909 38.0 38.0 38.0 34.0 38.0 105-109 36.251599999999996 38.0 38.0 38.0 33.8 38.0 110-114 36.098650000000006 38.0 38.0 38.0 33.6 38.0 115-119 35.990300000000005 38.0 38.0 38.0 33.2 38.0 120-124 35.558699999999995 38.0 36.8 38.0 31.2 38.0 125-129 35.3052 38.0 36.2 38.0 30.6 38.0 130-134 34.19405 38.0 33.6 38.0 25.8 38.0 135-139 33.4548 38.0 32.6 38.0 21.2 38.0 140-144 34.2698 38.0 35.2 38.0 26.2 38.0 145-149 33.367399999999996 38.0 33.8 38.0 18.6 38.0 150-151 27.879875 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 1.0 5 0.0 6 2.0 7 3.0 8 0.0 9 1.0 10 3.0 11 0.0 12 1.0 13 2.0 14 1.0 15 2.0 16 2.0 17 6.0 18 4.0 19 4.0 20 5.0 21 1.0 22 8.0 23 6.0 24 20.0 25 15.0 26 20.0 27 35.0 28 27.0 29 40.0 30 39.0 31 57.0 32 74.0 33 145.0 34 179.0 35 308.0 36 684.0 37 2292.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.375 19.525000000000002 10.925 31.175000000000004 2 31.324999999999996 22.375 27.3 19.0 3 22.05 26.525 28.125 23.3 4 25.775 32.225 19.875 22.125 5 27.35 31.900000000000002 19.8 20.95 6 22.625 35.475 21.5 20.4 7 22.575 19.45 35.625 22.35 8 23.549999999999997 23.575 24.775 28.1 9 23.474999999999998 22.35 29.7 24.474999999999998 10-14 25.724999999999998 26.295 23.544999999999998 24.435000000000002 15-19 25.40754075407541 25.85758575857586 24.49244924492449 24.242424242424242 20-24 25.512551255125516 25.552555255525554 24.73747374737474 24.197419741974198 25-29 25.669999999999998 25.855 24.34 24.135 30-34 25.25 26.185000000000002 24.485 24.08 35-39 25.316265813290666 25.99129956497825 24.366218310915546 24.32621631081554 40-44 25.5 24.775 25.275 24.45 45-49 25.28 25.319999999999997 24.535 24.865000000000002 50-54 25.91 26.009999999999998 24.48 23.599999999999998 55-59 25.865 25.865 24.085 24.185000000000002 60-64 25.740000000000002 25.380000000000003 25.040000000000003 23.84 65-69 25.597559755975595 25.69256925692569 24.872487248724873 23.837383738373838 70-74 25.75 25.009999999999998 24.55 24.69 75-79 26.064999999999998 25.515 24.884999999999998 23.535 80-84 25.825 25.785000000000004 24.48 23.91 85-89 25.962596259625965 25.522552255225524 24.557455745574558 23.957395739573958 90-94 25.540000000000003 25.455 25.569999999999997 23.435 95-99 25.019999999999996 26.035000000000004 25.0 23.945 100-104 25.54127706385319 26.196309815490775 24.17120856042802 24.09120456022801 105-109 26.275 25.71 24.68 23.335 110-114 25.7025702570257 26.027602760276025 24.3974397439744 23.87238723872387 115-119 26.37263726372637 26.27762776277628 24.21242124212421 23.137313731373137 120-124 25.895000000000003 26.290000000000003 24.745 23.07 125-129 26.064999999999998 25.915 24.8 23.22 130-134 26.62266226622662 26.122612261226124 24.702470247024703 22.55225522552255 135-139 26.762676267626762 25.83258325832583 24.51745174517452 22.887288728872885 140-144 26.895000000000003 26.77 24.395 21.94 145-149 26.779999999999998 26.25 24.585 22.384999999999998 150-151 27.200000000000003 26.650000000000002 24.0625 22.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 4.5 28 5.0 29 5.5 30 5.0 31 9.5 32 15.5 33 17.0 34 23.5 35 35.0 36 46.0 37 51.5 38 72.5 39 97.0 40 128.5 41 157.5 42 156.5 43 174.5 44 195.5 45 201.5 46 190.0 47 177.0 48 172.0 49 161.0 50 159.5 51 159.0 52 148.5 53 123.0 54 103.5 55 101.5 56 94.0 57 91.5 58 94.0 59 88.0 60 79.5 61 73.0 62 75.5 63 71.0 64 68.0 65 64.5 66 56.5 67 52.5 68 47.5 69 34.5 70 27.0 71 29.0 72 19.5 73 10.0 74 8.0 75 6.5 76 4.0 77 1.5 78 1.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.01 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21717171717171 98.225 2 0.6818181818181818 1.35 3 0.050505050505050504 0.15 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025252525252525252 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0125 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.0625 0.025 0.0 0.0 0.0 84-85 0.11249999999999999 0.025 0.0 0.0 0.0 86-87 0.16249999999999998 0.025 0.0 0.0 0.0 88-89 0.225 0.025 0.0 0.0 0.0 90-91 0.25 0.025 0.0 0.0 0.0 92-93 0.30000000000000004 0.025 0.0 0.0 0.0 94-95 0.3875 0.025 0.0 0.0 0.0 96-97 0.44999999999999996 0.025 0.0 0.0 0.0 98-99 0.55 0.025 0.0 0.0 0.0 100-101 0.7625 0.025 0.0 0.0 0.0 102-103 0.875 0.025 0.0 0.0 0.0 104-105 0.9624999999999999 0.025 0.0 0.0 0.0 106-107 1.0125 0.025 0.0 0.0 0.0 108-109 1.125 0.025 0.0 0.0 0.0 110-111 1.2374999999999998 0.025 0.0 0.0 0.0 112-113 1.5 0.025 0.0 0.0 0.0 114-115 1.8375 0.025 0.0 0.0 0.0 116-117 2.3 0.025 0.0 0.0 0.0 118-119 2.5875 0.025 0.0 0.0 0.0 120-121 2.925 0.025 0.0 0.0 0.0 122-123 3.3125 0.025 0.0 0.0 0.0 124-125 3.5875 0.025 0.0 0.0 0.0 126-127 3.9000000000000004 0.025 0.0 0.0 0.0 128-129 4.35 0.025 0.0 0.0 0.0 130-131 4.737500000000001 0.025 0.0 0.0 0.0 132-133 5.175000000000001 0.025 0.0 0.0 0.0 134-135 5.75 0.025 0.0 0.0 0.0 136-137 6.175000000000001 0.025 0.0 0.0 0.0 138-139 6.5625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATATAC 10 0.006830828 145.0 3 GGATATA 10 0.006830828 145.0 2 TGGATAT 10 0.006830828 145.0 1 CTTCTTC 10 0.006830828 145.0 7 >>END_MODULE Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046445 spots for SRR6958229.sra Written 1046445 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra Read 1046438 spots for SRR6958229.sra Written 1046438 spots for SRR6958229.sra SRR ids: ['SRR6958229.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7pfbvazw SRR6958229.sra spots: 20928767 blocks: [[1, 1046438], [1046439, 2092876], [2092877, 3139314], [3139315, 4185752], [4185753, 5232190], [5232191, 6278628], [6278629, 7325066], [7325067, 8371504], [8371505, 9417942], [9417943, 10464380], [10464381, 11510818], [11510819, 12557256], [12557257, 13603694], [13603695, 14650132], [14650133, 15696570], [15696571, 16743008], [16743009, 17789446], [17789447, 18835884], [18835885, 19882322], [19882323, 20928767]] SRR6958229 file size 7070372 SRR6958229 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958229 SRR6958229_1.fastq SRR6958229_2.fastq Input file: SRR6958229_1.fastq Paired file: SRR6958229_2.fastq trimmed: SRR6958229-trimmed-pair1.fastq, SRR6958229-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:58:04 2024 >> started Fri Dec 6 17:02:01 2024 >> done (237.338s) 20928767 read pairs processed; of these: 18641 ( 0.09%) short read pairs filtered out after trimming by size control 17020 ( 0.08%) empty read pairs filtered out after trimming by size control 20893106 (99.83%) read pairs available; of these: 8016875 (38.37%) trimmed read pairs available after processing 12876231 (61.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 10 0.00% 20 4 0.00% 21 8 0.00% 22 3 0.00% 23 11 0.00% 24 9 0.00% 25 19 0.00% 26 9 0.00% 27 10 0.00% 28 9 0.00% 29 12 0.00% 30 16 0.00% 31 8 0.00% 32 11 0.00% 33 7 0.00% 34 11 0.00% 35 17 0.00% 36 21 0.00% 37 19 0.00% 38 31 0.00% 39 25 0.00% 40 25 0.00% 41 35 0.00% 42 31 0.00% 43 42 0.00% 44 26 0.00% 45 36 0.00% 46 39 0.00% 47 55 0.00% 48 44 0.00% 49 61 0.00% 50 81 0.00% 51 69 0.00% 52 81 0.00% 53 113 0.00% 54 93 0.00% 55 112 0.00% 56 125 0.00% 57 124 0.00% 58 148 0.00% 59 165 0.00% 60 188 0.00% 61 239 0.00% 62 270 0.00% 63 291 0.00% 64 273 0.00% 65 354 0.00% 66 388 0.00% 67 443 0.00% 68 513 0.00% 69 559 0.00% 70 670 0.00% 71 669 0.00% 72 841 0.00% 73 995 0.00% 74 1099 0.01% 75 1267 0.01% 76 1395 0.01% 77 1519 0.01% 78 1731 0.01% 79 1924 0.01% 80 2143 0.01% 81 2520 0.01% 82 2903 0.01% 83 3148 0.02% 84 4349 0.02% 85 5143 0.02% 86 5369 0.03% 87 5883 0.03% 88 6416 0.03% 89 6906 0.03% 90 7287 0.03% 91 7905 0.04% 92 8480 0.04% 93 9508 0.05% 94 9982 0.05% 95 10797 0.05% 96 11311 0.05% 97 12242 0.06% 98 12975 0.06% 99 13907 0.07% 100 15064 0.07% 101 15827 0.08% 102 16974 0.08% 103 18236 0.09% 104 19396 0.09% 105 20183 0.10% 106 21572 0.10% 107 22407 0.11% 108 23776 0.11% 109 24665 0.12% 110 26165 0.13% 111 27474 0.13% 112 28876 0.14% 113 30111 0.14% 114 31890 0.15% 115 33639 0.16% 116 34742 0.17% 117 36299 0.17% 118 37533 0.18% 119 37825 0.18% 120 39901 0.19% 121 41022 0.20% 122 42852 0.21% 123 44946 0.22% 124 46608 0.22% 125 48469 0.23% 126 50161 0.24% 127 51674 0.25% 128 52934 0.25% 129 54616 0.26% 130 56949 0.27% 131 58900 0.28% 132 61168 0.29% 133 64291 0.31% 134 66729 0.32% 135 68688 0.33% 136 71108 0.34% 137 73924 0.35% 138 76882 0.37% 139 81670 0.39% 140 85934 0.41% 141 91313 0.44% 142 100008 0.48% 143 107806 0.52% 144 121785 0.58% 145 139479 0.67% 146 169731 0.81% 147 218028 1.04% 148 316382 1.51% 149 622003 2.98% 150 4201681 20.11% 151 12876231 61.63% 20893106 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=15 prefix-density=0.74 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=245.01 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=11.2 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=24 prefix-density=0.56 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=63.41 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=12.7 sequence=GCCGCCGCCGCC SRR6958229 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:07:28 Started mapping on | Dec 06 17:07:29 Finished on | Dec 06 17:29:34 Mapping speed, Million of reads per hour | 56.77 Number of input reads | 20893106 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20525967 Uniquely mapped reads % | 98.24% Average mapped length | 295.34 Number of splices: Total | 22692660 Number of splices: Annotated (sjdb) | 21256369 Number of splices: GT/AG | 22395288 Number of splices: GC/AG | 267219 Number of splices: AT/AC | 9530 Number of splices: Non-canonical | 20623 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 132804 % of reads mapped to multiple loci | 0.64% Number of reads mapped to too many loci | 11069 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.76% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 247181 247181 247181 N_multimapping 132804 132804 132804 N_noFeature 847050 19920462 1046461 N_ambiguous 488626 2909 83750 UnstrandedReadsAssigned:19190291 PositiveStrandReadsAssigned:602596 NegativeStrandReadsAssigned:19395756 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958229 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958229-trimmed-pair1.fastq SRR6958229-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,893,106 reads, 19,430,722 reads pseudoaligned [quant] estimated average fragment length: 263.738 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR6958229.ke.tsv 35125 SRR6958229.se.tsv 88098 total ==> SRR6958229.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.864 0 0 PNS24247 1044 781.262 88.0356 8.93316 PNS24249 1928 1665.26 59.1325 2.81505 PNS24246 1044 781.262 88.0356 8.93316 PNS24248 1044 781.262 88.0356 8.93316 PNS24244 1471 1208.26 55.7607 3.65856 PNS24243 293 93.0508 0 0 KQK14069 1603 1340.26 6107.19 361.239 KQK14071 474 232.536 132.781 45.2677 ==> SRR6958229.se.tsv <== BRADI_1g14170v3 7111 BRADI_1g53295v3 407 BRADI_1g59795v3 540 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 341 BRADI_1g74790v3 166 BRADI_1g09890v3 0 BRADI_1g77505v3 287 BRADI_1g48960v3 0 SRR6958229 completed mapping pipeline successfully