Starting /dee2/code/volunteer_pipeline.sh SRR6958230 current disk space = 1550578810880 free memory = 1597597292 SRR6958230 SRAfilesize 7f7a9c6f842e8c444fd5dbaff45c40ed SRR6958230.sra SRR6958230.sra file validated SRR6958230 is paired end SRR6958230 is conventional basespace SRR6958230 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958230_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.24975 27.0 18.0 33.0 18.0 33.0 2 25.4765 27.0 18.0 31.0 18.0 33.0 3 30.018 31.0 29.0 33.0 27.0 33.0 4 32.347 33.0 32.0 33.0 32.0 33.0 5 32.4915 33.0 33.0 33.0 32.0 34.0 6 36.50225 38.0 37.0 38.0 34.0 38.0 7 36.7815 38.0 37.0 38.0 34.0 38.0 8 35.888 38.0 37.0 38.0 31.0 38.0 9 37.08275 38.0 38.0 38.0 36.0 38.0 10-14 36.48265 38.0 37.0 38.0 31.4 38.0 15-19 37.36645 38.0 38.0 38.0 37.2 38.0 20-24 37.561499999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.4954 38.0 38.0 38.0 38.0 38.0 30-34 37.507349999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.284200000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.412549999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.4199 38.0 38.0 38.0 37.4 38.0 50-54 36.630100000000006 38.0 37.6 38.0 33.8 38.0 55-59 37.146950000000004 38.0 38.0 38.0 36.6 38.0 60-64 37.26445 38.0 38.0 38.0 37.0 38.0 65-69 37.2448 38.0 38.0 38.0 36.8 38.0 70-74 37.274899999999995 38.0 38.0 38.0 37.0 38.0 75-79 36.80305 38.0 37.8 38.0 34.8 38.0 80-84 37.013999999999996 38.0 38.0 38.0 35.6 38.0 85-89 37.1869 38.0 38.0 38.0 36.4 38.0 90-94 35.7055 38.0 35.6 38.0 29.8 38.0 95-99 36.803200000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.85245 38.0 38.0 38.0 35.0 38.0 105-109 36.715050000000005 38.0 38.0 38.0 34.8 38.0 110-114 36.575149999999994 38.0 38.0 38.0 34.6 38.0 115-119 36.22405 38.0 37.4 38.0 32.4 38.0 120-124 36.13755 38.0 37.6 38.0 33.4 38.0 125-129 36.138250000000006 38.0 38.0 38.0 33.4 38.0 130-134 36.07525 38.0 37.6 38.0 33.2 38.0 135-139 35.903549999999996 38.0 37.6 38.0 32.2 38.0 140-144 35.469049999999996 38.0 36.0 38.0 31.0 38.0 145-149 34.818650000000005 38.0 35.8 38.0 30.2 38.0 150-151 30.54975 35.5 29.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 3.0 20 2.0 21 2.0 22 4.0 23 5.0 24 4.0 25 12.0 26 13.0 27 10.0 28 23.0 29 34.0 30 37.0 31 50.0 32 70.0 33 82.0 34 146.0 35 261.0 36 772.0 37 2462.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.51633650630306 13.558013892462053 6.148700797530228 40.776948803704656 2 23.3 16.05 31.7 28.95 3 21.475 15.825 22.325 40.375 4 25.8 23.175 21.675 29.349999999999998 5 26.950000000000003 27.975 22.75 22.325 6 21.05 32.550000000000004 24.0 22.400000000000002 7 17.675 23.5 38.85 19.975 8 19.425 24.7 29.15 26.724999999999998 9 19.875 20.375 34.300000000000004 25.45 10-14 22.735 26.44 26.009999999999998 24.815 15-19 23.115 25.230000000000004 26.06 25.595000000000002 20-24 22.650000000000002 25.86 26.19 25.3 25-29 22.925 25.540000000000003 25.805 25.729999999999997 30-34 22.895 25.15 26.090000000000003 25.865 35-39 22.445 25.525 26.06 25.97 40-44 22.445 25.245 26.455000000000002 25.855 45-49 22.895 25.205 25.615 26.284999999999997 50-54 22.814999999999998 25.355 26.22 25.61 55-59 22.835 24.9 26.590000000000003 25.674999999999997 60-64 23.095 25.619999999999997 25.919999999999998 25.365 65-69 22.745 25.319999999999997 26.150000000000002 25.785000000000004 70-74 23.16 25.335 25.569999999999997 25.935000000000002 75-79 22.865 24.875 25.745 26.515 80-84 23.494999999999997 25.195 25.25 26.06 85-89 23.200000000000003 25.135 25.865 25.8 90-94 22.869999999999997 25.224999999999998 26.064999999999998 25.840000000000003 95-99 23.415 24.7 26.265 25.619999999999997 100-104 23.465 24.759999999999998 25.69 26.085 105-109 23.75 24.985 25.865 25.4 110-114 23.765 25.259999999999998 25.41 25.564999999999998 115-119 24.145 25.569999999999997 25.424999999999997 24.86 120-124 23.955000000000002 25.3 25.290000000000003 25.455 125-129 23.505000000000003 25.295 25.855 25.345000000000002 130-134 23.995 25.324999999999996 25.490000000000002 25.19 135-139 24.404999999999998 24.905 24.845 25.845000000000002 140-144 24.34 25.405 24.525 25.729999999999997 145-149 24.305 25.679999999999996 25.005 25.009999999999998 150-151 22.95 25.275 25.775 26.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 1.5 28 3.0 29 5.0 30 7.5 31 9.5 32 13.5 33 19.0 34 25.0 35 41.0 36 50.0 37 57.5 38 86.0 39 108.5 40 128.0 41 153.0 42 166.0 43 175.5 44 199.0 45 206.0 46 206.5 47 213.5 48 204.5 49 186.5 50 178.0 51 157.5 52 126.0 53 120.0 54 111.5 55 99.0 56 93.5 57 87.5 58 78.5 59 75.5 60 73.5 61 71.0 62 58.0 63 45.5 64 46.5 65 48.5 66 49.5 67 40.0 68 32.5 69 29.5 70 23.5 71 20.0 72 15.5 73 13.5 74 13.5 75 9.0 76 6.5 77 3.5 78 1.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.5999999999999996 0.0 0.0 0.0 0.0 124-125 3.9625000000000004 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 5.012499999999999 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 5.9875 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 7.0875 0.0 0.0 0.0 0.0 138-139 8.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCCAC 10 0.006830828 145.0 9 >>END_MODULE SRR6958230 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958230_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90975 33.0 33.0 34.0 32.0 34.0 2 33.06625 34.0 33.0 34.0 32.0 34.0 3 33.10225 34.0 33.0 34.0 33.0 34.0 4 33.016 34.0 33.0 34.0 33.0 34.0 5 32.82375 34.0 33.0 34.0 32.0 34.0 6 37.06025 38.0 38.0 38.0 37.0 38.0 7 37.16025 38.0 38.0 38.0 37.0 38.0 8 37.1255 38.0 38.0 38.0 37.0 38.0 9 37.17925 38.0 38.0 38.0 37.0 38.0 10-14 37.13855 38.0 38.0 38.0 37.0 38.0 15-19 37.16945 38.0 38.0 38.0 37.0 38.0 20-24 37.18665 38.0 38.0 38.0 37.0 38.0 25-29 37.026149999999994 38.0 38.0 38.0 36.6 38.0 30-34 37.12405 38.0 38.0 38.0 36.8 38.0 35-39 36.5214 38.0 38.0 38.0 34.2 38.0 40-44 36.4921 38.0 38.0 38.0 34.2 38.0 45-49 36.48524999999999 38.0 38.0 38.0 34.8 38.0 50-54 36.8313 38.0 38.0 38.0 35.8 38.0 55-59 35.60765000000001 38.0 36.8 38.0 28.0 38.0 60-64 36.85185 38.0 38.0 38.0 35.8 38.0 65-69 36.80245 38.0 38.0 38.0 36.0 38.0 70-74 36.805600000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.373400000000004 38.0 37.8 38.0 33.8 38.0 80-84 36.649249999999995 38.0 38.0 38.0 35.0 38.0 85-89 35.8298 38.0 37.0 38.0 29.8 38.0 90-94 36.02745 38.0 37.6 38.0 32.6 38.0 95-99 36.19205 38.0 38.0 38.0 33.8 38.0 100-104 36.21255000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.272499999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.05114999999999 38.0 38.0 38.0 33.4 38.0 115-119 35.9853 38.0 38.0 38.0 33.4 38.0 120-124 35.4769 38.0 37.0 38.0 30.4 38.0 125-129 35.1757 38.0 36.2 38.0 30.6 38.0 130-134 33.9882 38.0 33.6 38.0 25.4 38.0 135-139 33.18195 38.0 32.4 38.0 20.0 38.0 140-144 34.1141 38.0 34.8 38.0 25.4 38.0 145-149 33.2857 38.0 33.6 38.0 17.6 38.0 150-151 27.893124999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 3.0 5 2.0 6 1.0 7 2.0 8 1.0 9 1.0 10 2.0 11 2.0 12 2.0 13 2.0 14 1.0 15 3.0 16 3.0 17 0.0 18 1.0 19 3.0 20 8.0 21 14.0 22 12.0 23 11.0 24 15.0 25 13.0 26 21.0 27 26.0 28 35.0 29 42.0 30 44.0 31 62.0 32 95.0 33 115.0 34 162.0 35 301.0 36 669.0 37 2314.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.574999999999996 18.725 9.925 31.775 2 30.375000000000004 23.35 27.6 18.675 3 24.375 24.675 27.900000000000002 23.05 4 26.174999999999997 29.625 20.150000000000002 24.05 5 27.625 33.425 20.125 18.825 6 22.075 38.125 20.1 19.7 7 22.2 19.650000000000002 34.925 23.225 8 24.875 23.0 25.1 27.025 9 23.200000000000003 23.45 28.025 25.324999999999996 10-14 25.905 26.179999999999996 23.34 24.575 15-19 25.645 25.455 24.5 24.4 20-24 25.04375656348452 26.23393509026354 24.673701055158272 24.048607291093663 25-29 25.245 25.525 24.505 24.725 30-34 25.369999999999997 25.47 24.43 24.73 35-39 25.025 26.07 24.615000000000002 24.29 40-44 25.979999999999997 25.505 24.21 24.305 45-49 25.615 25.55 24.740000000000002 24.095 50-54 26.224999999999998 25.485000000000003 24.435000000000002 23.855 55-59 25.840000000000003 25.465 24.275 24.42 60-64 25.86 25.740000000000002 24.529999999999998 23.87 65-69 26.02890433565035 25.978896834525177 24.498674801220183 23.49352402860429 70-74 26.029999999999998 24.91 25.0 24.060000000000002 75-79 26.06 25.724999999999998 24.75 23.465 80-84 26.415 25.424999999999997 24.77 23.39 85-89 25.676419104776194 25.74143535883971 24.74118529632408 23.840960240060017 90-94 25.869999999999997 25.905 24.92 23.305 95-99 25.540000000000003 26.14 24.77 23.549999999999997 100-104 26.35 25.66 24.205 23.785 105-109 26.075 25.509999999999998 24.705 23.71 110-114 26.090000000000003 25.86 24.895 23.155 115-119 26.926731682920728 25.76144036009002 24.031007751937985 23.280820205051263 120-124 26.44 25.474999999999998 24.93 23.155 125-129 26.55 26.21 24.54 22.7 130-134 26.607660766076606 26.367636763676366 24.497449744974496 22.52725272527253 135-139 27.524128619292892 26.118917837675653 24.30864629694454 22.048307246086914 140-144 27.689999999999998 25.790000000000003 24.474999999999998 22.045 145-149 27.405 26.009999999999998 24.715 21.87 150-151 27.237499999999997 26.387500000000003 25.45 20.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.5 27 2.0 28 1.5 29 5.5 30 7.5 31 10.0 32 15.0 33 15.0 34 20.5 35 33.0 36 42.0 37 53.0 38 68.5 39 89.5 40 117.5 41 143.5 42 172.5 43 194.5 44 181.0 45 172.0 46 184.5 47 197.5 48 200.0 49 194.5 50 173.0 51 146.5 52 143.0 53 134.5 54 105.5 55 94.5 56 102.5 57 88.0 58 85.5 59 89.5 60 74.5 61 67.5 62 63.0 63 65.5 64 65.5 65 54.0 66 49.0 67 48.5 68 53.0 69 41.5 70 29.5 71 29.0 72 20.5 73 15.0 74 13.0 75 9.0 76 6.0 77 3.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.015 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01290812452544 97.8 2 0.8099215388509239 1.6 3 0.10124019235636549 0.3 4 0.07593014426727411 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.8875000000000002 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 3.925 0.0 0.0 0.0 0.0 126-127 4.3375 0.0 0.0 0.0 0.0 128-129 4.824999999999999 0.0 0.0 0.0 0.0 130-131 5.2125 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.15 0.0 0.0 0.0 0.0 136-137 6.7375 0.0 0.0 0.0 0.0 138-139 7.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGCATG 10 0.006830828 145.0 9 >>END_MODULE Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114820 spots for SRR6958230.sra Written 1114820 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra Read 1114802 spots for SRR6958230.sra Written 1114802 spots for SRR6958230.sra SRR ids: ['SRR6958230.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ojvq6la SRR6958230.sra spots: 22296058 blocks: [[1, 1114802], [1114803, 2229604], [2229605, 3344406], [3344407, 4459208], [4459209, 5574010], [5574011, 6688812], [6688813, 7803614], [7803615, 8918416], [8918417, 10033218], [10033219, 11148020], [11148021, 12262822], [12262823, 13377624], [13377625, 14492426], [14492427, 15607228], [15607229, 16722030], [16722031, 17836832], [17836833, 18951634], [18951635, 20066436], [20066437, 21181238], [21181239, 22296058]] SRR6958230 file size 7533702 SRR6958230 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958230 SRR6958230_1.fastq SRR6958230_2.fastq Input file: SRR6958230_1.fastq Paired file: SRR6958230_2.fastq trimmed: SRR6958230-trimmed-pair1.fastq, SRR6958230-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:57:54 2024 >> started Fri Dec 6 16:58:16 2024 >> done (22.067s) 22296058 read pairs processed; of these: 19267 ( 0.09%) short read pairs filtered out after trimming by size control 15891 ( 0.07%) empty read pairs filtered out after trimming by size control 22260900 (99.84%) read pairs available; of these: 8749592 (39.30%) trimmed read pairs available after processing 13511308 (60.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 12 0.00% 20 6 0.00% 21 9 0.00% 22 9 0.00% 23 11 0.00% 24 5 0.00% 25 10 0.00% 26 11 0.00% 27 15 0.00% 28 16 0.00% 29 12 0.00% 30 18 0.00% 31 21 0.00% 32 16 0.00% 33 23 0.00% 34 29 0.00% 35 13 0.00% 36 20 0.00% 37 16 0.00% 38 32 0.00% 39 23 0.00% 40 36 0.00% 41 33 0.00% 42 30 0.00% 43 26 0.00% 44 27 0.00% 45 51 0.00% 46 38 0.00% 47 45 0.00% 48 55 0.00% 49 55 0.00% 50 100 0.00% 51 74 0.00% 52 107 0.00% 53 107 0.00% 54 133 0.00% 55 136 0.00% 56 151 0.00% 57 156 0.00% 58 187 0.00% 59 185 0.00% 60 233 0.00% 61 281 0.00% 62 310 0.00% 63 314 0.00% 64 365 0.00% 65 421 0.00% 66 412 0.00% 67 501 0.00% 68 587 0.00% 69 609 0.00% 70 747 0.00% 71 876 0.00% 72 1051 0.00% 73 1082 0.00% 74 1245 0.01% 75 1362 0.01% 76 1591 0.01% 77 1813 0.01% 78 2028 0.01% 79 2290 0.01% 80 2512 0.01% 81 2928 0.01% 82 3225 0.01% 83 3685 0.02% 84 4717 0.02% 85 5729 0.03% 86 6217 0.03% 87 6653 0.03% 88 7217 0.03% 89 7666 0.03% 90 8257 0.04% 91 9191 0.04% 92 9696 0.04% 93 10326 0.05% 94 11547 0.05% 95 12452 0.06% 96 13441 0.06% 97 14407 0.06% 98 15194 0.07% 99 16430 0.07% 100 17803 0.08% 101 19138 0.09% 102 20290 0.09% 103 21725 0.10% 104 23134 0.10% 105 24664 0.11% 106 26071 0.12% 107 27137 0.12% 108 28948 0.13% 109 30349 0.14% 110 31791 0.14% 111 33562 0.15% 112 35353 0.16% 113 37097 0.17% 114 39310 0.18% 115 41020 0.18% 116 43173 0.19% 117 44752 0.20% 118 46623 0.21% 119 47868 0.22% 120 49631 0.22% 121 50950 0.23% 122 53482 0.24% 123 55312 0.25% 124 58122 0.26% 125 60234 0.27% 126 62467 0.28% 127 64567 0.29% 128 65682 0.30% 129 68166 0.31% 130 70338 0.32% 131 72858 0.33% 132 75090 0.34% 133 79448 0.36% 134 81590 0.37% 135 83499 0.38% 136 87037 0.39% 137 89601 0.40% 138 92358 0.41% 139 97922 0.44% 140 102389 0.46% 141 108466 0.49% 142 117262 0.53% 143 125620 0.56% 144 138440 0.62% 145 158086 0.71% 146 185957 0.84% 147 234020 1.05% 148 333684 1.50% 149 638441 2.87% 150 4357387 19.57% 151 13511308 60.70% 22260900 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=24 prefix-density=0.69 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=48.14 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=25 prefix-density=0.53 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=60.96 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.4 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958230 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 16:58:57 Started mapping on | Dec 06 16:58:57 Finished on | Dec 06 17:00:36 Mapping speed, Million of reads per hour | 809.49 Number of input reads | 22260900 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21879135 Uniquely mapped reads % | 98.29% Average mapped length | 294.58 Number of splices: Total | 24808642 Number of splices: Annotated (sjdb) | 23262629 Number of splices: GT/AG | 24493093 Number of splices: GC/AG | 284628 Number of splices: AT/AC | 9730 Number of splices: Non-canonical | 21191 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 146311 % of reads mapped to multiple loci | 0.66% Number of reads mapped to too many loci | 10734 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.75% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 248398 248398 248398 N_multimapping 146311 146311 146311 N_noFeature 813216 21253487 1017870 N_ambiguous 498800 2990 78760 UnstrandedReadsAssigned:20567119 PositiveStrandReadsAssigned:622658 NegativeStrandReadsAssigned:20782505 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958230 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958230-trimmed-pair1.fastq SRR6958230-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,260,900 reads, 20,823,730 reads pseudoaligned [quant] estimated average fragment length: 247.048 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR6958230.ke.tsv 35125 SRR6958230.se.tsv 88098 total ==> SRR6958230.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.484 0 0 PNS24247 1044 797.952 64.5289 5.97496 PNS24249 1928 1681.95 46.7266 2.05262 PNS24246 1044 797.952 64.5289 5.97496 PNS24248 1044 797.952 64.5289 5.97496 PNS24244 1471 1224.95 28.6867 1.73029 PNS24243 293 96.8202 0 0 KQK14069 1603 1356.95 2555.8 139.162 KQK14071 474 243.457 65.3658 19.8375 ==> SRR6958230.se.tsv <== BRADI_1g14170v3 2960 BRADI_1g53295v3 351 BRADI_1g59795v3 290 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 318 BRADI_1g74790v3 158 BRADI_1g09890v3 0 BRADI_1g77505v3 247 BRADI_1g48960v3 0 SRR6958230 completed mapping pipeline successfully