Starting /dee2/code/volunteer_pipeline.sh SRR6958231 current disk space = 1550629154816 free memory = 1598620196 SRR6958231 SRAfilesize a0c938f083a8282875ad8f363a155e52 SRR6958231.sra SRR6958231.sra file validated SRR6958231 is paired end SRR6958231 is conventional basespace SRR6958231 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958231_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.7675 18.0 18.0 18.0 18.0 28.0 2 28.16425 28.0 27.0 30.0 25.0 31.0 3 29.55225 31.0 29.0 33.0 25.0 33.0 4 31.908 33.0 31.0 33.0 29.0 33.0 5 32.8705 33.0 33.0 33.0 32.0 34.0 6 36.90825 38.0 37.0 38.0 36.0 38.0 7 37.41125 38.0 38.0 38.0 37.0 38.0 8 37.51275 38.0 38.0 38.0 37.0 38.0 9 37.588 38.0 38.0 38.0 37.0 38.0 10-14 37.59105 38.0 38.0 38.0 38.0 38.0 15-19 37.49079999999999 38.0 38.0 38.0 37.4 38.0 20-24 37.4252 38.0 38.0 38.0 36.8 38.0 25-29 37.49835 38.0 38.0 38.0 37.4 38.0 30-34 37.4671 38.0 38.0 38.0 37.6 38.0 35-39 37.5673 38.0 38.0 38.0 38.0 38.0 40-44 37.51935 38.0 38.0 38.0 37.8 38.0 45-49 37.49195 38.0 38.0 38.0 37.4 38.0 50-54 37.294200000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.2414 38.0 38.0 38.0 36.6 38.0 60-64 37.2628 38.0 38.0 38.0 36.2 38.0 65-69 37.19835 38.0 38.0 38.0 36.0 38.0 70-74 37.09255 38.0 38.0 38.0 36.0 38.0 75-79 36.87545 38.0 38.0 38.0 35.2 38.0 80-84 35.140600000000006 37.8 34.4 38.0 28.8 38.0 85-89 36.74905 38.0 38.0 38.0 34.8 38.0 90-94 36.775150000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.600750000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.272450000000006 38.0 37.4 38.0 33.8 38.0 105-109 36.295249999999996 38.0 37.8 38.0 34.0 38.0 110-114 36.17615000000001 38.0 37.4 38.0 33.6 38.0 115-119 35.8596 38.0 36.6 38.0 32.2 38.0 120-124 35.56355 38.0 36.0 38.0 31.4 38.0 125-129 35.4966 38.0 35.8 38.0 30.4 38.0 130-134 35.210800000000006 38.0 35.6 38.0 29.0 38.0 135-139 35.08875 38.0 35.6 38.0 29.0 38.0 140-144 34.5485 38.0 33.8 38.0 27.2 38.0 145-149 33.83155000000001 38.0 33.6 38.0 23.8 38.0 150-151 28.999499999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 6.0 20 3.0 21 8.0 22 1.0 23 9.0 24 5.0 25 3.0 26 11.0 27 13.0 28 18.0 29 33.0 30 34.0 31 56.0 32 82.0 33 134.0 34 185.0 35 385.0 36 1010.0 37 1997.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.32854482575153 10.800744878957168 23.03804203245544 30.83266826283586 2 26.35 12.3 33.300000000000004 28.050000000000004 3 22.7 17.299999999999997 27.1 32.9 4 27.0 24.675 23.05 25.275 5 24.75 30.55 24.8 19.900000000000002 6 21.575 33.800000000000004 24.3 20.325 7 16.5 23.875 41.075 18.55 8 18.875 23.5 30.349999999999998 27.275 9 18.575 22.425 34.425 24.575 10-14 22.919999999999998 27.065 26.22 23.794999999999998 15-19 21.990000000000002 25.905 27.12 24.985 20-24 22.264999999999997 26.179999999999996 27.11 24.445 25-29 22.13 26.674999999999997 26.965 24.23 30-34 22.21 26.015 26.77 25.005 35-39 22.415 26.445 26.77 24.37 40-44 22.245 26.465 26.66 24.63 45-49 22.615 25.580000000000002 26.85 24.955 50-54 22.685 25.915 26.435 24.965 55-59 22.555 26.305 25.885 25.255 60-64 22.53 26.355 26.334999999999997 24.779999999999998 65-69 22.53 26.619999999999997 25.995 24.855 70-74 22.99 25.785000000000004 26.479999999999997 24.745 75-79 22.11 26.045 27.145000000000003 24.7 80-84 22.134999999999998 26.435 26.474999999999998 24.955 85-89 22.45 25.929999999999996 26.575 25.045 90-94 22.61 26.705000000000002 26.125 24.560000000000002 95-99 22.475 26.345000000000002 26.474999999999998 24.705 100-104 22.890722680670166 25.771442860715176 26.691672918229557 24.646161540385098 105-109 22.495 26.06 26.565 24.88 110-114 22.48 25.814999999999998 27.115000000000002 24.59 115-119 23.04 26.419999999999998 25.919999999999998 24.62 120-124 23.105 26.63 25.22 25.045 125-129 22.189999999999998 26.915 25.8 25.095 130-134 23.425 27.310000000000002 24.92 24.345 135-139 22.545 26.77 25.515 25.169999999999998 140-144 22.49 26.245 25.735000000000003 25.53 145-149 22.93 26.650000000000002 25.21 25.21 150-151 23.0875 26.724999999999998 24.6 25.587500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.5 26 3.0 27 2.5 28 3.5 29 8.5 30 12.5 31 15.5 32 24.5 33 30.0 34 38.5 35 46.5 36 56.5 37 80.5 38 103.0 39 127.5 40 145.0 41 167.0 42 193.0 43 214.0 44 220.5 45 215.0 46 213.0 47 206.0 48 208.0 49 200.5 50 170.5 51 163.5 52 152.5 53 114.5 54 93.5 55 95.0 56 85.0 57 71.0 58 69.0 59 64.0 60 55.5 61 44.5 62 36.0 63 32.0 64 36.0 65 34.5 66 28.0 67 29.0 68 21.5 69 15.5 70 12.5 71 9.0 72 10.5 73 7.5 74 4.5 75 2.5 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.0249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.7375 0.0 0.0 0.0 0.0 118-119 3.15 0.0 0.0 0.0 0.0 120-121 3.4749999999999996 0.0 0.0 0.0 0.0 122-123 4.0125 0.0 0.0 0.0 0.0 124-125 4.525 0.0 0.0 0.0 0.0 126-127 4.9375 0.0 0.0 0.0 0.0 128-129 5.4125 0.0 0.0 0.0 0.0 130-131 5.887499999999999 0.0 0.0 0.0 0.0 132-133 6.475 0.0 0.0 0.0 0.0 134-135 7.0375 0.0 0.0 0.0 0.0 136-137 7.6625 0.0 0.0 0.0 0.0 138-139 8.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCACAT 10 0.0060887975 150.61038 1 CAGTTCA 10 0.006836113 144.9625 4 GATGAGT 10 0.006836113 144.9625 5 >>END_MODULE SRR6958231 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958231_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16425 33.0 33.0 34.0 33.0 34.0 2 33.263 34.0 33.0 34.0 33.0 34.0 3 33.3105 34.0 33.0 34.0 33.0 34.0 4 33.249 34.0 33.0 34.0 33.0 34.0 5 33.26425 34.0 33.0 34.0 33.0 34.0 6 37.39775 38.0 38.0 38.0 38.0 38.0 7 37.4795 38.0 38.0 38.0 38.0 38.0 8 37.385 38.0 38.0 38.0 38.0 38.0 9 37.39775 38.0 38.0 38.0 38.0 38.0 10-14 37.388850000000005 38.0 38.0 38.0 38.0 38.0 15-19 36.34599999999999 38.0 37.2 38.0 31.8 38.0 20-24 36.19304999999999 38.0 37.2 38.0 30.0 38.0 25-29 37.26180000000001 38.0 38.0 38.0 37.4 38.0 30-34 37.3299 38.0 38.0 38.0 38.0 38.0 35-39 37.2469 38.0 38.0 38.0 37.4 38.0 40-44 37.32835 38.0 38.0 38.0 37.8 38.0 45-49 37.349450000000004 38.0 38.0 38.0 37.8 38.0 50-54 37.1554 38.0 38.0 38.0 37.2 38.0 55-59 37.147149999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.1238 38.0 38.0 38.0 37.0 38.0 65-69 37.064449999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.02595 38.0 38.0 38.0 37.0 38.0 75-79 37.006550000000004 38.0 38.0 38.0 36.8 38.0 80-84 36.90115 38.0 38.0 38.0 36.2 38.0 85-89 36.9105 38.0 38.0 38.0 36.2 38.0 90-94 35.90025 38.0 37.0 38.0 30.2 38.0 95-99 34.5523 38.0 34.6 38.0 24.6 38.0 100-104 34.0431 37.6 31.4 38.0 26.0 38.0 105-109 36.23965 38.0 37.8 38.0 34.2 38.0 110-114 35.998000000000005 38.0 37.6 38.0 32.0 38.0 115-119 35.709900000000005 38.0 37.4 38.0 31.2 38.0 120-124 35.26325 38.0 36.2 38.0 30.0 38.0 125-129 35.24365 38.0 35.6 38.0 29.4 38.0 130-134 32.7955 36.6 29.4 38.0 24.0 38.0 135-139 34.5835 38.0 35.2 38.0 25.6 38.0 140-144 33.3573 38.0 33.8 38.0 20.6 38.0 145-149 33.6708 38.0 33.6 38.0 23.2 38.0 150-151 29.070500000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 6.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 2.0 11 2.0 12 1.0 13 10.0 14 3.0 15 1.0 16 1.0 17 3.0 18 2.0 19 2.0 20 9.0 21 3.0 22 3.0 23 4.0 24 12.0 25 9.0 26 9.0 27 16.0 28 24.0 29 36.0 30 37.0 31 56.0 32 83.0 33 100.0 34 184.0 35 364.0 36 1044.0 37 1963.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.35 22.0 8.95 22.7 2 29.95 22.85 28.425 18.775 3 22.25 24.925 30.8 22.025 4 25.825 32.300000000000004 21.025 20.849999999999998 5 26.8 35.275 19.900000000000002 18.025 6 24.0 36.925000000000004 19.625 19.45 7 21.5 20.549999999999997 36.675000000000004 21.275 8 22.900000000000002 24.55 24.9 27.650000000000002 9 24.025 22.900000000000002 27.725 25.35 10-14 25.595000000000002 27.565 23.73 23.11 15-19 25.31 26.650000000000002 25.3 22.74 20-24 24.755 26.905 25.27 23.07 25-29 25.395 26.369999999999997 25.115 23.119999999999997 30-34 25.36 26.575 25.47 22.595000000000002 35-39 24.709999999999997 26.44 25.88 22.97 40-44 24.695 26.515 25.35 23.44 45-49 24.11 26.584999999999997 26.029999999999998 23.275000000000002 50-54 25.170306551793225 26.172109797635745 25.556000801442597 23.101582849128434 55-59 25.09898260913146 26.93329323911191 25.16914749661705 22.798576655139577 60-64 24.857200120252532 26.38039883755887 25.463473293917225 23.29892774827137 65-69 24.793388429752067 26.972201352366643 25.509641873278238 22.724768344603056 70-74 25.083964108476614 26.703092886861494 25.454910020552408 22.75803298410948 75-79 24.924834636199638 26.889156143515734 25.65143315293646 22.534576067348166 80-84 24.87587140779377 26.280154471136967 26.24504739455339 22.598926726515874 85-89 25.409877162196036 26.959137628478313 25.119077463023316 22.51190774630233 90-94 25.040056078509913 26.737432405367517 25.886240737031844 22.33627077909073 95-99 25.12268402603906 26.544817225838756 26.164246369554334 22.16825237856785 100-104 25.477037111233535 27.134772374417786 24.951169429558774 22.437021084789905 105-109 25.444438880264407 26.61625519555311 25.64474936151034 22.294556562672142 110-114 25.334201171581633 26.66099233965854 25.609572923446656 22.395233565313173 115-119 25.916649969945905 26.297335203366057 25.310559006211182 22.47545582047686 120-124 25.340408490188228 27.152583099719664 25.545654785742894 21.96135362434922 125-129 25.596996245306634 27.389236545682106 25.23654568210263 21.777221526908637 130-134 25.90572457966373 27.216773418734984 24.75480384307446 22.12269815852682 135-139 25.4595542198848 27.312797395442022 24.91860756323566 22.309040821437513 140-144 25.576267789136097 27.174784525957108 25.55622369212267 21.692723992784124 145-149 25.922213311948678 26.839414595028067 25.295709703287887 21.942662389735364 150-151 26.488654882788015 27.240817349880906 24.771217249592578 21.499310517738497 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 0.5 25 2.0 26 3.5 27 4.0 28 5.0 29 8.0 30 9.5 31 12.5 32 20.0 33 23.5 34 27.0 35 33.0 36 46.5 37 72.0 38 97.0 39 122.5 40 153.5 41 173.0 42 183.5 43 192.5 44 205.5 45 209.0 46 210.5 47 228.5 48 225.5 49 199.0 50 167.5 51 151.5 52 142.5 53 115.0 54 95.5 55 87.5 56 81.5 57 82.5 58 74.5 59 61.0 60 60.0 61 54.5 62 47.0 63 48.5 64 44.5 65 42.5 66 36.0 67 29.0 68 28.0 69 22.5 70 15.5 71 11.5 72 10.0 73 7.0 74 5.5 75 3.5 76 1.5 77 2.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.18 55-59 0.23500000000000001 60-64 0.21 65-69 0.17500000000000002 70-74 0.255 75-79 0.22 80-84 0.305 85-89 0.27499999999999997 90-94 0.13999999999999999 95-99 0.15 100-104 0.165 105-109 0.155 110-114 0.135 115-119 0.18 120-124 0.12 125-129 0.125 130-134 0.08 135-139 0.17500000000000002 140-144 0.22 145-149 0.24 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.444724886421 98.5 2 0.35335689045936397 0.7000000000000001 3 0.10095911155981827 0.3 4 0.05047955577990913 0.2 5 0.025239777889954566 0.125 6 0.0 0.0 7 0.025239777889954566 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.9625000000000004 0.0 0.0 0.0 0.0 120-121 3.2750000000000004 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.3625 0.0 0.0 0.0 0.0 128-129 4.8 0.0 0.0 0.0 0.0 130-131 5.199999999999999 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.3625 0.0 0.0 0.0 0.0 136-137 6.949999999999999 0.0 0.0 0.0 0.0 138-139 7.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797630 spots for SRR6958231.sra Written 797630 spots for SRR6958231.sra Read 797640 spots for SRR6958231.sra Written 797640 spots for SRR6958231.sra SRR ids: ['SRR6958231.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l4hmdw_f SRR6958231.sra spots: 15952610 blocks: [[1, 797630], [797631, 1595260], [1595261, 2392890], [2392891, 3190520], [3190521, 3988150], [3988151, 4785780], [4785781, 5583410], [5583411, 6381040], [6381041, 7178670], [7178671, 7976300], [7976301, 8773930], [8773931, 9571560], [9571561, 10369190], [10369191, 11166820], [11166821, 11964450], [11964451, 12762080], [12762081, 13559710], [13559711, 14357340], [14357341, 15154970], [15154971, 15952610]] SRR6958231 file size 5384115 SRR6958231 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958231 SRR6958231_1.fastq SRR6958231_2.fastq Input file: SRR6958231_1.fastq Paired file: SRR6958231_2.fastq trimmed: SRR6958231-trimmed-pair1.fastq, SRR6958231-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 16:58:50 2024 >> started Fri Dec 6 16:59:08 2024 >> done (18.049s) 15952610 read pairs processed; of these: 10646 ( 0.07%) short read pairs filtered out after trimming by size control 16751 ( 0.11%) empty read pairs filtered out after trimming by size control 15925213 (99.83%) read pairs available; of these: 9460704 (59.41%) trimmed read pairs available after processing 6464509 (40.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 9 0.00% 21 9 0.00% 22 6 0.00% 23 6 0.00% 24 12 0.00% 25 12 0.00% 26 15 0.00% 27 12 0.00% 28 16 0.00% 29 13 0.00% 30 13 0.00% 31 18 0.00% 32 19 0.00% 33 15 0.00% 34 18 0.00% 35 17 0.00% 36 21 0.00% 37 29 0.00% 38 22 0.00% 39 25 0.00% 40 23 0.00% 41 25 0.00% 42 31 0.00% 43 33 0.00% 44 37 0.00% 45 32 0.00% 46 39 0.00% 47 67 0.00% 48 40 0.00% 49 82 0.00% 50 71 0.00% 51 82 0.00% 52 95 0.00% 53 100 0.00% 54 125 0.00% 55 138 0.00% 56 149 0.00% 57 169 0.00% 58 172 0.00% 59 206 0.00% 60 269 0.00% 61 269 0.00% 62 339 0.00% 63 332 0.00% 64 381 0.00% 65 415 0.00% 66 464 0.00% 67 547 0.00% 68 622 0.00% 69 748 0.00% 70 782 0.00% 71 988 0.01% 72 1067 0.01% 73 1199 0.01% 74 1400 0.01% 75 1654 0.01% 76 1936 0.01% 77 1934 0.01% 78 2044 0.01% 79 2446 0.02% 80 2890 0.02% 81 2909 0.02% 82 3488 0.02% 83 3769 0.02% 84 4619 0.03% 85 5126 0.03% 86 5677 0.04% 87 6148 0.04% 88 6505 0.04% 89 6817 0.04% 90 7633 0.05% 91 8302 0.05% 92 8945 0.06% 93 9685 0.06% 94 10629 0.07% 95 11366 0.07% 96 12534 0.08% 97 13383 0.08% 98 14676 0.09% 99 16078 0.10% 100 20292 0.13% 101 21649 0.14% 102 16889 0.11% 103 18040 0.11% 104 19137 0.12% 105 20405 0.13% 106 21241 0.13% 107 22135 0.14% 108 23083 0.14% 109 24353 0.15% 110 25711 0.16% 111 27027 0.17% 112 28741 0.18% 113 30244 0.19% 114 31981 0.20% 115 33755 0.21% 116 34897 0.22% 117 36094 0.23% 118 37443 0.24% 119 38891 0.24% 120 40490 0.25% 121 42571 0.27% 122 44072 0.28% 123 46757 0.29% 124 49346 0.31% 125 51825 0.33% 126 54147 0.34% 127 56083 0.35% 128 57749 0.36% 129 60627 0.38% 130 63440 0.40% 131 65444 0.41% 132 68840 0.43% 133 73162 0.46% 134 77385 0.49% 135 82208 0.52% 136 87209 0.55% 137 91444 0.57% 138 96806 0.61% 139 104342 0.66% 140 112028 0.70% 141 123502 0.78% 142 136001 0.85% 143 153542 0.96% 144 177192 1.11% 145 216563 1.36% 146 271120 1.70% 147 365797 2.30% 148 531324 3.34% 149 1003967 6.30% 150 4340660 27.26% 151 6464509 40.59% 15925213 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=21 prefix-density=0.70 prefix-fanout=3.0 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=52.30 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.6 sequence=CTTCTGCTTGGC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=31 prefix-density=0.35 prefix-fanout=2.4 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=212.53 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=11.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958231 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:00:03 Started mapping on | Dec 06 17:00:04 Finished on | Dec 06 17:01:46 Mapping speed, Million of reads per hour | 562.07 Number of input reads | 15925213 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15474088 Uniquely mapped reads % | 97.17% Average mapped length | 291.96 Number of splices: Total | 16816400 Number of splices: Annotated (sjdb) | 15737026 Number of splices: GT/AG | 16583012 Number of splices: GC/AG | 199515 Number of splices: AT/AC | 7107 Number of splices: Non-canonical | 26766 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 158988 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 7583 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 300828 300828 300828 N_multimapping 158988 158988 158988 N_noFeature 662418 15018817 806306 N_ambiguous 374369 2210 63384 UnstrandedReadsAssigned:14437301 PositiveStrandReadsAssigned:453061 NegativeStrandReadsAssigned:14604398 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958231 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958231-trimmed-pair1.fastq SRR6958231-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,925,213 reads, 14,639,119 reads pseudoaligned [quant] estimated average fragment length: 229.839 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR6958231.ke.tsv 35125 SRR6958231.se.tsv 88098 total ==> SRR6958231.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.396 0.923754 0.136116 PNS24247 1044 815.161 55.7228 7.12532 PNS24249 1928 1699.16 39.2323 2.40671 PNS24246 1044 815.161 55.7228 7.12532 PNS24248 1044 815.161 55.7228 7.12532 PNS24244 1471 1242.16 57.6754 4.8398 PNS24243 293 97.8713 0 0 KQK14069 1603 1374.16 5784.3 438.761 KQK14071 474 250.799 158.604 65.918 ==> SRR6958231.se.tsv <== BRADI_1g14170v3 6802 BRADI_1g53295v3 297 BRADI_1g59795v3 656 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 194 BRADI_1g74790v3 78 BRADI_1g09890v3 0 BRADI_1g77505v3 271 BRADI_1g48960v3 0 SRR6958231 completed mapping pipeline successfully