Starting /dee2/code/volunteer_pipeline.sh SRR6958232 current disk space = 1550631092224 free memory = 1598288592 SRR6958232 SRAfilesize 9319becb5845ea8464f215170f576f22 SRR6958232.sra SRR6958232.sra file validated SRR6958232 is paired end SRR6958232 is conventional basespace SRR6958232 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958232_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.86475 18.0 18.0 32.0 18.0 33.0 2 27.54425 28.0 25.0 31.0 18.0 33.0 3 28.73475 29.0 27.0 33.0 25.0 33.0 4 31.16375 33.0 31.0 33.0 29.0 33.0 5 32.8215 33.0 33.0 33.0 32.0 34.0 6 36.85025 38.0 37.0 38.0 35.0 38.0 7 37.21625 38.0 38.0 38.0 36.0 38.0 8 37.31375 38.0 38.0 38.0 36.0 38.0 9 37.47225 38.0 38.0 38.0 37.0 38.0 10-14 37.53515 38.0 38.0 38.0 37.6 38.0 15-19 37.478500000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.39585000000001 38.0 38.0 38.0 36.8 38.0 25-29 37.566700000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.52355000000001 38.0 38.0 38.0 37.8 38.0 35-39 37.631299999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.61725 38.0 38.0 38.0 38.0 38.0 45-49 37.519349999999996 38.0 38.0 38.0 37.6 38.0 50-54 37.3928 38.0 38.0 38.0 37.2 38.0 55-59 37.3309 38.0 38.0 38.0 37.0 38.0 60-64 37.322649999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.27034999999999 38.0 38.0 38.0 36.8 38.0 70-74 37.18665 38.0 38.0 38.0 36.0 38.0 75-79 37.01685 38.0 38.0 38.0 35.8 38.0 80-84 35.431349999999995 38.0 35.0 38.0 29.4 38.0 85-89 36.950450000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.90725 38.0 38.0 38.0 35.0 38.0 95-99 36.715199999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.4702 38.0 38.0 38.0 34.0 38.0 105-109 36.476 38.0 38.0 38.0 34.0 38.0 110-114 36.441950000000006 38.0 37.8 38.0 33.8 38.0 115-119 36.092650000000006 38.0 36.8 38.0 33.0 38.0 120-124 35.852 38.0 36.6 38.0 32.2 38.0 125-129 35.79825 38.0 36.6 38.0 31.8 38.0 130-134 35.5789 38.0 36.0 38.0 31.0 38.0 135-139 35.37965 38.0 35.8 38.0 30.6 38.0 140-144 34.8855 38.0 34.8 38.0 29.4 38.0 145-149 34.159800000000004 38.0 34.2 38.0 25.4 38.0 150-151 29.745125 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 3.0 20 1.0 21 1.0 22 2.0 23 4.0 24 6.0 25 9.0 26 14.0 27 8.0 28 16.0 29 36.0 30 29.0 31 53.0 32 71.0 33 116.0 34 178.0 35 334.0 36 965.0 37 2152.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.84366719660837 26.70906200317965 6.756756756756757 31.69051404345522 2 24.575 13.225000000000001 33.4 28.799999999999997 3 20.724999999999998 19.650000000000002 25.4 34.225 4 24.525 27.025 23.375 25.074999999999996 5 25.25 31.624999999999996 23.674999999999997 19.45 6 20.325 33.775 25.124999999999996 20.775 7 15.950000000000001 24.224999999999998 42.6 17.224999999999998 8 18.65 23.849999999999998 31.6 25.900000000000002 9 19.35 22.175 32.95 25.525 10-14 22.0 27.83 26.44 23.73 15-19 22.365 27.334999999999997 26.590000000000003 23.71 20-24 22.046102305115255 27.541377068853446 26.811340567028353 23.60118005900295 25-29 22.02 26.825 26.884999999999998 24.27 30-34 22.314999999999998 27.325 27.265 23.095 35-39 21.709999999999997 27.11 26.729999999999997 24.45 40-44 22.115000000000002 27.145000000000003 26.855 23.885 45-49 22.285 27.005000000000003 26.279999999999998 24.43 50-54 22.215 27.0 26.584999999999997 24.2 55-59 22.06 27.450000000000003 27.195000000000004 23.294999999999998 60-64 22.045 27.025 26.784999999999997 24.145 65-69 22.395 26.85 26.96 23.794999999999998 70-74 22.17 26.82 26.825 24.185000000000002 75-79 22.505 26.974999999999998 26.640000000000004 23.880000000000003 80-84 21.89 26.68 27.045 24.385 85-89 22.38 27.224999999999998 26.36 24.035 90-94 22.33 27.02 26.44 24.21 95-99 21.86 27.250000000000004 26.58 24.310000000000002 100-104 21.79326899034855 27.13407011051658 26.694004100615093 24.378656798519778 105-109 22.295 26.82 26.284999999999997 24.6 110-114 21.834999999999997 26.974999999999998 27.224999999999998 23.965 115-119 22.471123556177808 27.2013600680034 26.26131306565328 24.066203310165506 120-124 22.145 27.515 26.06 24.279999999999998 125-129 22.33 27.334999999999997 26.240000000000002 24.095 130-134 22.509999999999998 26.68 25.83 24.98 135-139 22.86 26.095000000000002 26.545 24.5 140-144 22.42 26.775 26.395000000000003 24.41 145-149 22.93 26.479999999999997 26.235000000000003 24.355 150-151 22.900000000000002 26.724999999999998 24.975 25.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 1.0 26 2.0 27 4.5 28 4.5 29 7.5 30 13.0 31 18.0 32 27.5 33 35.0 34 41.5 35 60.0 36 81.0 37 97.0 38 117.0 39 139.0 40 168.0 41 183.0 42 202.5 43 226.0 44 238.5 45 245.0 46 236.0 47 219.5 48 198.0 49 190.0 50 171.5 51 145.0 52 126.0 53 109.5 54 87.0 55 65.0 56 72.5 57 72.5 58 53.0 59 38.5 60 35.0 61 35.0 62 32.0 63 32.0 64 27.0 65 24.5 66 23.0 67 21.5 68 19.5 69 13.5 70 11.5 71 10.0 72 6.5 73 3.5 74 3.0 75 2.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0125 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0125 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.0625 0.025 0.0 0.0 0.0 82-83 0.1 0.025 0.0 0.0 0.0 84-85 0.16249999999999998 0.025 0.0 0.0 0.0 86-87 0.1875 0.025 0.0 0.0 0.0 88-89 0.225 0.025 0.0 0.0 0.0 90-91 0.3375 0.025 0.0 0.0 0.0 92-93 0.42500000000000004 0.025 0.0 0.0 0.0 94-95 0.5 0.025 0.0 0.0 0.0 96-97 0.6000000000000001 0.025 0.0 0.0 0.0 98-99 0.7 0.025 0.0 0.0 0.0 100-101 0.7875000000000001 0.025 0.0 0.0 0.0 102-103 0.8374999999999999 0.025 0.0 0.0 0.0 104-105 0.9874999999999999 0.025 0.0 0.0 0.0 106-107 1.075 0.025 0.0 0.0 0.0 108-109 1.275 0.025 0.0 0.0 0.0 110-111 1.475 0.025 0.0 0.0 0.0 112-113 1.6375 0.025 0.0 0.0 0.0 114-115 1.725 0.025 0.0 0.0 0.0 116-117 2.0250000000000004 0.025 0.0 0.0 0.0 118-119 2.3625 0.025 0.0 0.0 0.0 120-121 2.625 0.025 0.0 0.0 0.0 122-123 2.95 0.025 0.0 0.0 0.0 124-125 3.4124999999999996 0.025 0.0 0.0 0.0 126-127 3.825 0.025 0.0 0.0 0.0 128-129 4.1 0.025 0.0 0.0 0.0 130-131 4.512499999999999 0.025 0.0 0.0 0.0 132-133 5.0 0.025 0.0 0.0 0.0 134-135 5.4625 0.025 0.0 0.0 0.0 136-137 6.1 0.025 0.0 0.0 0.0 138-139 6.6125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958232 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958232_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14175 33.0 33.0 34.0 33.0 34.0 2 33.26825 34.0 33.0 34.0 33.0 34.0 3 33.2885 34.0 33.0 34.0 33.0 34.0 4 33.275 34.0 33.0 34.0 33.0 34.0 5 33.32525 34.0 33.0 34.0 33.0 34.0 6 37.5155 38.0 38.0 38.0 38.0 38.0 7 37.4725 38.0 38.0 38.0 38.0 38.0 8 37.45875 38.0 38.0 38.0 38.0 38.0 9 37.504 38.0 38.0 38.0 38.0 38.0 10-14 37.46355 38.0 38.0 38.0 38.0 38.0 15-19 36.43335 38.0 37.4 38.0 33.2 38.0 20-24 36.14375 38.0 36.8 38.0 30.0 38.0 25-29 37.3055 38.0 38.0 38.0 37.2 38.0 30-34 37.41 38.0 38.0 38.0 38.0 38.0 35-39 37.324400000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.36605 38.0 38.0 38.0 37.8 38.0 45-49 37.3646 38.0 38.0 38.0 38.0 38.0 50-54 37.205600000000004 38.0 38.0 38.0 37.6 38.0 55-59 37.24210000000001 38.0 38.0 38.0 37.4 38.0 60-64 37.228300000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.182599999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.1338 38.0 38.0 38.0 37.0 38.0 75-79 37.0942 38.0 38.0 38.0 37.0 38.0 80-84 37.0392 38.0 38.0 38.0 36.8 38.0 85-89 37.02125 38.0 38.0 38.0 36.6 38.0 90-94 35.9211 38.0 36.8 38.0 30.0 38.0 95-99 34.57285 37.8 34.2 38.0 24.8 38.0 100-104 34.366150000000005 37.6 33.2 38.0 26.8 38.0 105-109 36.4531 38.0 37.8 38.0 34.4 38.0 110-114 36.23375 38.0 37.8 38.0 32.8 38.0 115-119 35.858200000000004 38.0 37.2 38.0 31.4 38.0 120-124 35.48055 38.0 36.6 38.0 30.0 38.0 125-129 35.4402 38.0 36.4 38.0 30.8 38.0 130-134 33.13085 37.0 29.4 38.0 24.0 38.0 135-139 34.5923 38.0 35.2 38.0 26.2 38.0 140-144 33.56625 38.0 34.2 38.0 21.2 38.0 145-149 33.8211 38.0 33.8 38.0 24.2 38.0 150-151 29.351374999999997 35.5 18.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 5.0 5 1.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 1.0 13 6.0 14 0.0 15 1.0 16 1.0 17 2.0 18 2.0 19 1.0 20 4.0 21 7.0 22 1.0 23 11.0 24 7.0 25 13.0 26 16.0 27 21.0 28 20.0 29 19.0 30 41.0 31 42.0 32 69.0 33 108.0 34 190.0 35 366.0 36 1069.0 37 1966.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.074999999999996 22.175 8.75 25.0 2 30.775000000000002 23.45 28.349999999999998 17.424999999999997 3 21.7 25.7 31.55 21.05 4 24.95 32.824999999999996 22.375 19.85 5 27.400000000000002 33.95 19.675 18.975 6 21.95 37.125 20.849999999999998 20.075000000000003 7 21.8 21.8 36.375 20.025000000000002 8 23.150000000000002 23.599999999999998 26.424999999999997 26.825 9 23.425 22.85 27.925 25.8 10-14 24.985 27.485 24.825 22.705000000000002 15-19 24.29 27.105 25.814999999999998 22.79 20-24 24.735 27.060000000000002 25.564999999999998 22.64 25-29 24.34 26.939999999999998 26.305 22.415 30-34 24.64 25.924999999999997 26.555 22.88 35-39 23.990000000000002 26.47 26.41 23.13 40-44 24.77 26.55 25.825 22.855 45-49 24.474999999999998 26.375 27.339999999999996 21.81 50-54 24.65088342759898 26.97332198808749 26.207517893788477 22.16827669052505 55-59 24.641962944416626 26.41462193289935 25.793690535803705 23.14972458688032 60-64 24.76214321482223 26.695042563845767 26.374561842764145 22.16825237856785 65-69 24.38059962961109 26.678011912508133 26.878222133239905 22.063166324640875 70-74 24.757135703555335 26.675012518778168 26.314471707561342 22.25338007010516 75-79 24.341644137378594 26.489436267147294 26.70972263943126 22.459196956042856 80-84 23.946696057311758 26.69705926556786 26.99263563949702 22.363609037623366 85-89 25.065117210979764 26.637948306952513 26.387497495491886 21.909436986575837 90-94 24.496946641305435 27.009710681749926 25.98858744619081 22.50475523075383 95-99 24.48948948948949 27.42242242242242 25.730730730730734 22.35735735735736 100-104 24.528207438554336 26.95099364268909 26.15007258347099 22.37072633528558 105-109 24.750938673341675 26.327909887359198 26.9837296620776 21.937421777221527 110-114 25.05881764028633 27.30139660609701 26.004905641487714 21.634880112128947 115-119 25.413036948032442 26.72474216481426 26.06388304796235 21.79833783919095 120-124 24.187978579650668 27.34597867974576 26.224913667984584 22.241129072618985 125-129 24.924924924924923 27.27727727727728 26.03103103103103 21.766766766766768 130-134 25.524038221021563 27.50512782030117 25.699134523988192 21.27169943468908 135-139 24.704586420989386 26.872621670338475 26.81754456238734 21.6052473462848 140-144 25.110176282051285 26.963141025641026 26.517427884615387 21.409254807692307 145-149 25.338007010515774 27.616424636955433 25.84376564847271 21.20180270405608 150-151 26.042318767997997 26.480530862651808 26.242644296982597 21.234506072367598 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 2.5 27 3.0 28 4.5 29 12.0 30 16.0 31 18.0 32 22.0 33 25.0 34 35.5 35 50.5 36 59.5 37 70.0 38 93.5 39 128.5 40 162.0 41 189.5 42 207.0 43 222.5 44 233.0 45 226.5 46 214.0 47 211.5 48 206.0 49 191.0 50 165.0 51 142.5 52 132.0 53 117.0 54 97.5 55 77.0 56 69.5 57 67.0 58 66.0 59 63.0 60 60.5 61 53.5 62 40.0 63 35.0 64 37.0 65 33.0 66 29.0 67 24.5 68 19.5 69 16.0 70 12.5 71 13.0 72 8.5 73 4.5 74 3.5 75 3.0 76 2.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.105 55-59 0.15 60-64 0.15 65-69 0.105 70-74 0.15 75-79 0.13 80-84 0.19499999999999998 85-89 0.18 90-94 0.11 95-99 0.1 100-104 0.11499999999999999 105-109 0.125 110-114 0.11499999999999999 115-119 0.13 120-124 0.095 125-129 0.1 130-134 0.055 135-139 0.13999999999999999 140-144 0.16 145-149 0.15 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.5125000000000002 0.0 0.0 0.0 0.0 116-117 1.7625000000000002 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.2125 0.0 0.0 0.0 0.0 130-131 3.575 0.0 0.0 0.0 0.0 132-133 3.975 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.9625 0.0 0.0 0.0 0.0 138-139 5.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815710 spots for SRR6958232.sra Written 815710 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra Read 815700 spots for SRR6958232.sra Written 815700 spots for SRR6958232.sra SRR ids: ['SRR6958232.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__pzeh_8c SRR6958232.sra spots: 16314010 blocks: [[1, 815700], [815701, 1631400], [1631401, 2447100], [2447101, 3262800], [3262801, 4078500], [4078501, 4894200], [4894201, 5709900], [5709901, 6525600], [6525601, 7341300], [7341301, 8157000], [8157001, 8972700], [8972701, 9788400], [9788401, 10604100], [10604101, 11419800], [11419801, 12235500], [12235501, 13051200], [13051201, 13866900], [13866901, 14682600], [14682601, 15498300], [15498301, 16314010]] SRR6958232 file size 5506582 SRR6958232 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958232 SRR6958232_1.fastq SRR6958232_2.fastq Input file: SRR6958232_1.fastq Paired file: SRR6958232_2.fastq trimmed: SRR6958232-trimmed-pair1.fastq, SRR6958232-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:00:41 2024 >> started Fri Dec 6 17:00:57 2024 >> done (16.736s) 16314010 read pairs processed; of these: 9607 ( 0.06%) short read pairs filtered out after trimming by size control 12265 ( 0.08%) empty read pairs filtered out after trimming by size control 16292138 (99.87%) read pairs available; of these: 9421403 (57.83%) trimmed read pairs available after processing 6870735 (42.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 5 0.00% 21 7 0.00% 22 7 0.00% 23 4 0.00% 24 11 0.00% 25 5 0.00% 26 11 0.00% 27 12 0.00% 28 11 0.00% 29 10 0.00% 30 20 0.00% 31 12 0.00% 32 9 0.00% 33 13 0.00% 34 19 0.00% 35 10 0.00% 36 12 0.00% 37 13 0.00% 38 15 0.00% 39 26 0.00% 40 17 0.00% 41 18 0.00% 42 25 0.00% 43 41 0.00% 44 28 0.00% 45 30 0.00% 46 44 0.00% 47 42 0.00% 48 44 0.00% 49 53 0.00% 50 69 0.00% 51 78 0.00% 52 73 0.00% 53 80 0.00% 54 110 0.00% 55 100 0.00% 56 138 0.00% 57 102 0.00% 58 137 0.00% 59 184 0.00% 60 196 0.00% 61 236 0.00% 62 264 0.00% 63 261 0.00% 64 341 0.00% 65 293 0.00% 66 371 0.00% 67 467 0.00% 68 498 0.00% 69 543 0.00% 70 645 0.00% 71 773 0.00% 72 859 0.01% 73 931 0.01% 74 1137 0.01% 75 1285 0.01% 76 1425 0.01% 77 1488 0.01% 78 1686 0.01% 79 1980 0.01% 80 2271 0.01% 81 2417 0.01% 82 2672 0.02% 83 2990 0.02% 84 3779 0.02% 85 4317 0.03% 86 4665 0.03% 87 4990 0.03% 88 5320 0.03% 89 5731 0.04% 90 6332 0.04% 91 6788 0.04% 92 7540 0.05% 93 8257 0.05% 94 9038 0.06% 95 9561 0.06% 96 10356 0.06% 97 11023 0.07% 98 12116 0.07% 99 13483 0.08% 100 17428 0.11% 101 18803 0.12% 102 14617 0.09% 103 15626 0.10% 104 16890 0.10% 105 17602 0.11% 106 18489 0.11% 107 19607 0.12% 108 20453 0.13% 109 21257 0.13% 110 22123 0.14% 111 23604 0.14% 112 25086 0.15% 113 25989 0.16% 114 28067 0.17% 115 29869 0.18% 116 31001 0.19% 117 32221 0.20% 118 32441 0.20% 119 34038 0.21% 120 35734 0.22% 121 37355 0.23% 122 39152 0.24% 123 41587 0.26% 124 43397 0.27% 125 45737 0.28% 126 47922 0.29% 127 49356 0.30% 128 51802 0.32% 129 54035 0.33% 130 56597 0.35% 131 58175 0.36% 132 61959 0.38% 133 65376 0.40% 134 69901 0.43% 135 74204 0.46% 136 78632 0.48% 137 83087 0.51% 138 88341 0.54% 139 95230 0.58% 140 103254 0.63% 141 113534 0.70% 142 125519 0.77% 143 142914 0.88% 144 166012 1.02% 145 204623 1.26% 146 258595 1.59% 147 354326 2.17% 148 523439 3.21% 149 1016197 6.24% 150 4619211 28.35% 151 6870735 42.17% 16292138 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=18 prefix-density=0.43 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=272.93 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=12.7 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=26 prefix-density=0.37 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=71.20 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=10.2 sequence=AGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGCGTCGCCAACGGAACCCT SRR6958232 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:01:37 Started mapping on | Dec 06 17:01:37 Finished on | Dec 06 17:02:40 Mapping speed, Million of reads per hour | 930.98 Number of input reads | 16292138 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15919377 Uniquely mapped reads % | 97.71% Average mapped length | 293.37 Number of splices: Total | 16877078 Number of splices: Annotated (sjdb) | 15810057 Number of splices: GT/AG | 16659918 Number of splices: GC/AG | 193085 Number of splices: AT/AC | 7547 Number of splices: Non-canonical | 16528 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 141567 % of reads mapped to multiple loci | 0.87% Number of reads mapped to too many loci | 15330 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.78% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 238613 238613 238613 N_multimapping 141567 141567 141567 N_noFeature 887412 15452240 1061466 N_ambiguous 354943 2414 62366 UnstrandedReadsAssigned:14677022 PositiveStrandReadsAssigned:464723 NegativeStrandReadsAssigned:14795545 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958232 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958232-trimmed-pair1.fastq SRR6958232-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,292,138 reads, 14,833,622 reads pseudoaligned [quant] estimated average fragment length: 238.105 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR6958232.ke.tsv 35125 SRR6958232.se.tsv 88098 total ==> SRR6958232.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.26 0 0 PNS24247 1044 806.895 67.4661 9.15416 PNS24249 1928 1690.9 42.4438 2.7482 PNS24246 1044 806.895 67.4661 9.15416 PNS24248 1044 806.895 67.4661 9.15416 PNS24244 1471 1233.9 87.1578 7.73353 PNS24243 293 93.7845 0 0 KQK14069 1603 1365.9 3771.98 302.345 KQK14071 474 243.849 97.6495 43.8429 ==> SRR6958232.se.tsv <== BRADI_1g14170v3 4815 BRADI_1g53295v3 463 BRADI_1g59795v3 521 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 307 BRADI_1g74790v3 177 BRADI_1g09890v3 0 BRADI_1g77505v3 229 BRADI_1g48960v3 0 SRR6958232 completed mapping pipeline successfully