Starting /dee2/code/volunteer_pipeline.sh SRR6958233 current disk space = 1550703783936 free memory = 1326885320 SRR6958233 SRAfilesize 7376b47bbc5c00b5062c49c5ab6810d7 SRR6958233.sra SRR6958233.sra file validated SRR6958233 is paired end SRR6958233 is conventional basespace SRR6958233 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958233_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.559 33.0 25.0 33.0 18.0 33.0 2 29.52275 31.0 28.0 33.0 25.0 34.0 3 30.95925 33.0 31.0 33.0 28.0 33.0 4 32.05675 33.0 32.0 33.0 31.0 33.0 5 32.703 33.0 33.0 33.0 32.0 34.0 6 36.78525 38.0 37.0 38.0 35.0 38.0 7 37.40175 38.0 38.0 38.0 37.0 38.0 8 37.39175 38.0 38.0 38.0 37.0 38.0 9 37.5305 38.0 38.0 38.0 37.0 38.0 10-14 36.982800000000005 38.0 38.0 38.0 35.0 38.0 15-19 35.74065 37.8 35.0 38.0 31.0 38.0 20-24 35.8797 38.0 36.6 38.0 29.0 38.0 25-29 37.45575 38.0 38.0 38.0 37.4 38.0 30-34 37.53855 38.0 38.0 38.0 38.0 38.0 35-39 37.4691 38.0 38.0 38.0 38.0 38.0 40-44 37.55315 38.0 38.0 38.0 38.0 38.0 45-49 37.5435 38.0 38.0 38.0 38.0 38.0 50-54 37.55715 38.0 38.0 38.0 38.0 38.0 55-59 37.4639 38.0 38.0 38.0 37.8 38.0 60-64 37.424049999999994 38.0 38.0 38.0 37.4 38.0 65-69 37.40265000000001 38.0 38.0 38.0 37.0 38.0 70-74 37.3793 38.0 38.0 38.0 37.2 38.0 75-79 36.5785 38.0 37.6 38.0 33.6 38.0 80-84 37.2494 38.0 38.0 38.0 37.0 38.0 85-89 37.26195 38.0 38.0 38.0 37.0 38.0 90-94 36.6867 38.0 37.8 38.0 34.8 38.0 95-99 37.145300000000006 38.0 38.0 38.0 36.0 38.0 100-104 37.094049999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.98405 38.0 38.0 38.0 35.8 38.0 110-114 36.97765 38.0 38.0 38.0 35.4 38.0 115-119 36.776650000000004 38.0 38.0 38.0 35.0 38.0 120-124 36.4868 38.0 38.0 38.0 34.2 38.0 125-129 36.50260000000001 38.0 38.0 38.0 34.2 38.0 130-134 36.45585 38.0 38.0 38.0 34.0 38.0 135-139 36.34185 38.0 38.0 38.0 34.0 38.0 140-144 36.1519 38.0 38.0 38.0 33.4 38.0 145-149 35.802299999999995 38.0 37.8 38.0 32.4 38.0 150-151 31.93 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 3.0 19 3.0 20 2.0 21 0.0 22 0.0 23 1.0 24 6.0 25 9.0 26 9.0 27 8.0 28 20.0 29 14.0 30 25.0 31 31.0 32 45.0 33 80.0 34 119.0 35 203.0 36 643.0 37 2771.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 55.6175500887649 9.383717981232564 5.24980978950038 29.748922140502152 2 26.75 12.425 31.474999999999998 29.349999999999998 3 20.674999999999997 18.4 27.474999999999998 33.45 4 26.825 24.6 23.150000000000002 25.424999999999997 5 25.6 30.625000000000004 22.05 21.725 6 22.975 31.75 23.225 22.05 7 16.75 23.1 40.325 19.825 8 19.35 22.650000000000002 29.475 28.525 9 19.825 20.65 34.125 25.4 10-14 23.61 25.540000000000003 25.724999999999998 25.124999999999996 15-19 23.705000000000002 24.695 26.545 25.055 20-24 23.345 24.63 26.575 25.45 25-29 23.385 24.905 26.38 25.330000000000002 30-34 23.477347734773478 25.18751875187519 25.762576257625764 25.57255725572557 35-39 23.527352735273528 24.71747174717472 25.89258925892589 25.862586258625864 40-44 23.61 25.165 25.679999999999996 25.545 45-49 23.47 25.05 25.395 26.085 50-54 23.465 24.59 25.865 26.08 55-59 23.955000000000002 24.9 25.395 25.75 60-64 23.445 25.040000000000003 25.679999999999996 25.835 65-69 24.207420742074206 25.30753075307531 25.54755475547555 24.937493749374937 70-74 24.237423742374236 24.242424242424242 25.477547754775475 26.042604260426046 75-79 24.03 24.75 25.235000000000003 25.985000000000003 80-84 23.751187559377968 24.901245062253114 25.621281064053203 25.726286314315715 85-89 23.974999999999998 24.92 25.155 25.95 90-94 24.195 24.955 25.46 25.39 95-99 24.159831966393277 24.52990598119624 25.69013802760552 25.620124024804962 100-104 23.830000000000002 25.095 25.635 25.44 105-109 24.48122406120306 25.09125456272814 25.19625981299065 25.231261563078156 110-114 24.331216560828043 25.05125256262813 25.206260313015648 25.411270563528177 115-119 24.032403240324033 25.552555255525554 25.227522752275227 25.18751875187519 120-124 23.96 24.925 25.174999999999997 25.94 125-129 24.312431243124312 25.26252625262526 25.107510751075107 25.317531753175317 130-134 23.605 25.64 24.935 25.82 135-139 24.104999999999997 25.380000000000003 24.52 25.995 140-144 24.505 25.495 24.47 25.53 145-149 23.96 25.679999999999996 24.474999999999998 25.885 150-151 23.525 25.025 24.925 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 2.0 26 2.0 27 2.5 28 5.0 29 4.5 30 6.0 31 12.5 32 17.0 33 22.0 34 26.0 35 29.0 36 41.0 37 53.5 38 70.0 39 90.0 40 114.0 41 139.5 42 157.5 43 188.0 44 201.0 45 197.5 46 201.5 47 183.0 48 166.0 49 173.5 50 160.0 51 149.5 52 144.5 53 124.5 54 104.0 55 97.5 56 104.0 57 103.5 58 96.5 59 97.0 60 101.0 61 90.5 62 74.5 63 61.0 64 61.5 65 60.0 66 48.5 67 42.5 68 35.5 69 25.0 70 21.0 71 20.0 72 17.5 73 13.0 74 10.5 75 9.5 76 8.0 77 4.0 78 1.0 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.02 100-104 0.0 105-109 0.005 110-114 0.005 115-119 0.01 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.45271629778672035 0.8999999999999999 3 0.07545271629778671 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.5250000000000004 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.3375000000000004 0.0 0.0 0.0 0.0 120-121 3.875 0.0 0.0 0.0 0.0 122-123 4.237500000000001 0.0 0.0 0.0 0.0 124-125 4.75 0.0 0.0 0.0 0.0 126-127 5.2 0.0 0.0 0.0 0.0 128-129 5.675 0.0 0.0 0.0 0.0 130-131 6.2125 0.0 0.0 0.0 0.0 132-133 6.7875 0.0 0.0 0.0 0.0 134-135 7.449999999999999 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958233 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958233_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7595 33.0 33.0 34.0 32.0 34.0 2 33.042 33.0 33.0 34.0 32.0 34.0 3 33.1445 34.0 33.0 34.0 33.0 34.0 4 33.15225 34.0 33.0 34.0 33.0 34.0 5 31.485 33.0 32.0 34.0 27.0 34.0 6 36.89875 38.0 38.0 38.0 36.0 38.0 7 37.168 38.0 38.0 38.0 37.0 38.0 8 37.27175 38.0 38.0 38.0 37.0 38.0 9 37.27125 38.0 38.0 38.0 37.0 38.0 10-14 37.2953 38.0 38.0 38.0 37.8 38.0 15-19 37.31705 38.0 38.0 38.0 38.0 38.0 20-24 37.33075 38.0 38.0 38.0 38.0 38.0 25-29 37.28365000000001 38.0 38.0 38.0 37.8 38.0 30-34 37.3052 38.0 38.0 38.0 38.0 38.0 35-39 37.129250000000006 38.0 38.0 38.0 37.6 38.0 40-44 36.9508 38.0 38.0 38.0 36.8 38.0 45-49 36.8867 38.0 38.0 38.0 36.6 38.0 50-54 37.0916 38.0 38.0 38.0 36.8 38.0 55-59 37.229099999999995 38.0 38.0 38.0 37.8 38.0 60-64 37.14919999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.1816 38.0 38.0 38.0 37.0 38.0 70-74 37.1216 38.0 38.0 38.0 37.0 38.0 75-79 37.09 38.0 38.0 38.0 37.0 38.0 80-84 36.970000000000006 38.0 38.0 38.0 36.8 38.0 85-89 36.879850000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.81655 38.0 38.0 38.0 36.0 38.0 95-99 36.50735 38.0 38.0 38.0 34.6 38.0 100-104 36.6577 38.0 38.0 38.0 35.0 38.0 105-109 36.626000000000005 38.0 38.0 38.0 35.0 38.0 110-114 36.506449999999994 38.0 38.0 38.0 35.0 38.0 115-119 36.34455 38.0 38.0 38.0 34.2 38.0 120-124 35.526250000000005 38.0 36.6 38.0 29.4 38.0 125-129 36.023700000000005 38.0 38.0 38.0 33.8 38.0 130-134 35.871500000000005 38.0 38.0 38.0 33.0 38.0 135-139 35.613350000000004 38.0 37.6 38.0 32.2 38.0 140-144 35.10844999999999 38.0 36.2 38.0 30.4 38.0 145-149 34.559900000000006 38.0 36.0 38.0 29.0 38.0 150-151 28.37525 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 4.0 5 0.0 6 3.0 7 1.0 8 3.0 9 0.0 10 2.0 11 3.0 12 1.0 13 0.0 14 1.0 15 1.0 16 3.0 17 3.0 18 2.0 19 4.0 20 3.0 21 7.0 22 2.0 23 5.0 24 12.0 25 10.0 26 7.0 27 16.0 28 20.0 29 16.0 30 30.0 31 42.0 32 64.0 33 78.0 34 113.0 35 181.0 36 474.0 37 2875.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.525 19.225 7.575 24.675 2 30.025000000000002 22.55 26.8 20.625 3 23.280820205051263 23.53088272068017 30.207551887971995 22.980745186296573 4 26.775 31.075000000000003 20.325 21.825 5 26.900000000000002 35.15 18.475 19.475 6 23.724999999999998 36.225 19.650000000000002 20.4 7 23.175 19.6 34.4 22.825 8 23.275000000000002 24.0 24.224999999999998 28.499999999999996 9 24.175 22.275 27.3 26.25 10-14 25.95 26.064999999999998 23.255 24.73 15-19 25.8 25.53 23.75 24.92 20-24 25.869999999999997 25.525 24.755 23.849999999999998 25-29 25.759999999999998 25.430000000000003 24.085 24.725 30-34 25.485000000000003 25.595000000000002 24.07 24.85 35-39 25.629999999999995 25.869999999999997 24.37 24.13 40-44 26.465 25.074999999999996 24.46 24.0 45-49 25.580000000000002 25.705 24.115000000000002 24.6 50-54 25.645 25.445 24.545 24.365000000000002 55-59 26.125 25.1 24.245 24.529999999999998 60-64 26.47 25.495 24.345 23.69 65-69 25.215 25.735000000000003 24.47 24.58 70-74 25.230000000000004 24.759999999999998 25.335 24.675 75-79 25.41 24.935 24.48 25.174999999999997 80-84 25.665 24.855 24.93 24.55 85-89 25.75 25.805 24.025 24.42 90-94 25.814999999999998 25.395 24.635 24.154999999999998 95-99 26.31 25.174999999999997 24.099999999999998 24.415 100-104 25.865 25.895000000000003 24.64 23.599999999999998 105-109 26.229999999999997 25.61 24.240000000000002 23.919999999999998 110-114 26.075 26.005 24.310000000000002 23.61 115-119 26.705000000000002 25.515 23.595 24.185000000000002 120-124 26.69 25.624999999999996 23.885 23.799999999999997 125-129 27.195000000000004 25.619999999999997 23.98 23.205000000000002 130-134 26.979999999999997 25.874999999999996 23.82 23.325000000000003 135-139 27.125 25.759999999999998 24.12 22.994999999999997 140-144 26.87 26.424999999999997 24.215 22.49 145-149 27.215 26.025 24.29 22.470000000000002 150-151 27.712500000000002 25.924999999999997 24.087500000000002 22.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 3.5 27 5.0 28 4.5 29 3.0 30 6.0 31 10.5 32 14.5 33 16.5 34 23.5 35 38.5 36 46.0 37 49.0 38 63.5 39 91.5 40 114.5 41 137.0 42 164.5 43 177.0 44 172.5 45 166.0 46 186.5 47 198.0 48 161.0 49 145.5 50 154.0 51 147.5 52 132.0 53 119.5 54 123.5 55 114.5 56 97.0 57 96.5 58 90.0 59 91.0 60 97.5 61 90.5 62 86.0 63 86.0 64 83.0 65 72.0 66 55.5 67 45.0 68 51.0 69 46.5 70 28.5 71 20.0 72 20.0 73 18.0 74 14.0 75 8.0 76 3.0 77 2.0 78 1.5 79 2.0 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83248730964466 97.35000000000001 2 0.9644670050761422 1.9 3 0.12690355329949238 0.375 4 0.0 0.0 5 0.07614213197969542 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0125 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0125 0.0 0.0 0.0 0.025 74-75 0.025 0.0 0.0 0.0 0.025 76-77 0.025 0.0 0.0 0.0 0.025 78-79 0.025 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.05 0.0 0.0 0.0 0.025 86-87 0.1125 0.0 0.0 0.0 0.025 88-89 0.1875 0.0 0.0 0.0 0.025 90-91 0.2 0.0 0.0 0.0 0.025 92-93 0.25 0.0 0.0 0.0 0.025 94-95 0.30000000000000004 0.0 0.0 0.0 0.025 96-97 0.375 0.0 0.0 0.0 0.025 98-99 0.525 0.0 0.0 0.0 0.025 100-101 0.7250000000000001 0.0 0.0 0.0 0.025 102-103 0.8875 0.0 0.0 0.0 0.025 104-105 1.1125 0.0 0.0 0.0 0.025 106-107 1.4625 0.0 0.0 0.0 0.025 108-109 1.7125 0.0 0.0 0.0 0.025 110-111 1.9625 0.0 0.0 0.0 0.025 112-113 2.2625 0.0 0.0 0.0 0.025 114-115 2.575 0.0 0.0 0.0 0.025 116-117 2.9749999999999996 0.0 0.0 0.0 0.025 118-119 3.3875 0.0 0.0 0.0 0.025 120-121 3.9125 0.0 0.0 0.0 0.025 122-123 4.262499999999999 0.0 0.0 0.0 0.025 124-125 4.8 0.0 0.0 0.0 0.025 126-127 5.25 0.0 0.0 0.0 0.025 128-129 5.725 0.0 0.0 0.0 0.025 130-131 6.2625 0.0 0.0 0.0 0.025 132-133 6.824999999999999 0.0 0.0 0.0 0.025 134-135 7.475 0.0 0.0 0.0 0.025 136-137 8.087499999999999 0.0 0.0 0.0 0.025 138-139 8.775 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTGC 10 0.006830828 145.0 6 CAAATCT 10 0.006830828 145.0 145 GGAAACA 10 0.006830828 145.0 145 >>END_MODULE Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994402 spots for SRR6958233.sra Written 994402 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra Read 994386 spots for SRR6958233.sra Written 994386 spots for SRR6958233.sra SRR ids: ['SRR6958233.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kxnjr7yu SRR6958233.sra spots: 19887736 blocks: [[1, 994386], [994387, 1988772], [1988773, 2983158], [2983159, 3977544], [3977545, 4971930], [4971931, 5966316], [5966317, 6960702], [6960703, 7955088], [7955089, 8949474], [8949475, 9943860], [9943861, 10938246], [10938247, 11932632], [11932633, 12927018], [12927019, 13921404], [13921405, 14915790], [14915791, 15910176], [15910177, 16904562], [16904563, 17898948], [17898949, 18893334], [18893335, 19887736]] SRR6958233 file size 6717600 SRR6958233 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958233 SRR6958233_1.fastq SRR6958233_2.fastq Input file: SRR6958233_1.fastq Paired file: SRR6958233_2.fastq trimmed: SRR6958233-trimmed-pair1.fastq, SRR6958233-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:09:50 2024 >> started Fri Dec 6 17:10:12 2024 >> done (22.013s) 19887736 read pairs processed; of these: 21869 ( 0.11%) short read pairs filtered out after trimming by size control 18437 ( 0.09%) empty read pairs filtered out after trimming by size control 19847430 (99.80%) read pairs available; of these: 7548105 (38.03%) trimmed read pairs available after processing 12299325 (61.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 13 0.00% 20 17 0.00% 21 22 0.00% 22 24 0.00% 23 35 0.00% 24 28 0.00% 25 28 0.00% 26 29 0.00% 27 29 0.00% 28 31 0.00% 29 25 0.00% 30 22 0.00% 31 26 0.00% 32 39 0.00% 33 13 0.00% 34 30 0.00% 35 33 0.00% 36 26 0.00% 37 35 0.00% 38 52 0.00% 39 57 0.00% 40 45 0.00% 41 49 0.00% 42 47 0.00% 43 53 0.00% 44 42 0.00% 45 39 0.00% 46 55 0.00% 47 57 0.00% 48 75 0.00% 49 83 0.00% 50 118 0.00% 51 109 0.00% 52 110 0.00% 53 133 0.00% 54 150 0.00% 55 153 0.00% 56 179 0.00% 57 186 0.00% 58 203 0.00% 59 261 0.00% 60 340 0.00% 61 337 0.00% 62 412 0.00% 63 396 0.00% 64 427 0.00% 65 490 0.00% 66 517 0.00% 67 699 0.00% 68 773 0.00% 69 872 0.00% 70 982 0.00% 71 1127 0.01% 72 1311 0.01% 73 1458 0.01% 74 1596 0.01% 75 1679 0.01% 76 1847 0.01% 77 2192 0.01% 78 2451 0.01% 79 2733 0.01% 80 3079 0.02% 81 3560 0.02% 82 4133 0.02% 83 4682 0.02% 84 6151 0.03% 85 7233 0.04% 86 7755 0.04% 87 8937 0.05% 88 9346 0.05% 89 9981 0.05% 90 10623 0.05% 91 11466 0.06% 92 12270 0.06% 93 13223 0.07% 94 13782 0.07% 95 14834 0.07% 96 15494 0.08% 97 16391 0.08% 98 17071 0.09% 99 18470 0.09% 100 19847 0.10% 101 21362 0.11% 102 22687 0.11% 103 24619 0.12% 104 25942 0.13% 105 27134 0.14% 106 28269 0.14% 107 28917 0.15% 108 30258 0.15% 109 31829 0.16% 110 33446 0.17% 111 35487 0.18% 112 37503 0.19% 113 39028 0.20% 114 41718 0.21% 115 43098 0.22% 116 44389 0.22% 117 45449 0.23% 118 45797 0.23% 119 46781 0.24% 120 48917 0.25% 121 50679 0.26% 122 52244 0.26% 123 55283 0.28% 124 57949 0.29% 125 59498 0.30% 126 61500 0.31% 127 61652 0.31% 128 62448 0.31% 129 63869 0.32% 130 65743 0.33% 131 67811 0.34% 132 70451 0.35% 133 73588 0.37% 134 75932 0.38% 135 79807 0.40% 136 80683 0.41% 137 81421 0.41% 138 83602 0.42% 139 86891 0.44% 140 89400 0.45% 141 94072 0.47% 142 100141 0.50% 143 107343 0.54% 144 118327 0.60% 145 132014 0.67% 146 152220 0.77% 147 189021 0.95% 148 259482 1.31% 149 483053 2.43% 150 3575616 18.02% 151 12299325 61.97% 19847430 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=29 prefix-density=0.72 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=32.11 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=16 prefix-density=0.72 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=81.83 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGC SRR6958233 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:11:02 Started mapping on | Dec 06 17:11:02 Finished on | Dec 06 17:13:11 Mapping speed, Million of reads per hour | 553.88 Number of input reads | 19847430 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19134121 Uniquely mapped reads % | 96.41% Average mapped length | 293.10 Number of splices: Total | 21031083 Number of splices: Annotated (sjdb) | 19726157 Number of splices: GT/AG | 20738227 Number of splices: GC/AG | 241412 Number of splices: AT/AC | 7159 Number of splices: Non-canonical | 44285 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205696 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 9781 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.28% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 530631 530631 530631 N_multimapping 205696 205696 205696 N_noFeature 698441 18489269 882657 N_ambiguous 532611 2518 72959 UnstrandedReadsAssigned:17903069 PositiveStrandReadsAssigned:642334 NegativeStrandReadsAssigned:18178505 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958233 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958233-trimmed-pair1.fastq SRR6958233-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,847,430 reads, 18,171,836 reads pseudoaligned [quant] estimated average fragment length: 247.792 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR6958233.ke.tsv 35125 SRR6958233.se.tsv 88098 total ==> SRR6958233.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.839 0 0 PNS24247 1044 797.208 43.3715 4.437 PNS24249 1928 1681.21 23.2504 1.12789 PNS24246 1044 797.208 43.3715 4.437 PNS24248 1044 797.208 43.3715 4.437 PNS24244 1471 1224.21 12.6352 0.841749 PNS24243 293 100.251 0 0 KQK14069 1603 1356.21 4752.13 285.772 KQK14071 474 246.807 92.8855 30.6936 ==> SRR6958233.se.tsv <== BRADI_1g14170v3 5760 BRADI_1g53295v3 1330 BRADI_1g59795v3 113 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 395 BRADI_1g74790v3 114 BRADI_1g09890v3 0 BRADI_1g77505v3 184 BRADI_1g48960v3 0 SRR6958233 completed mapping pipeline successfully