Starting /dee2/code/volunteer_pipeline.sh SRR6958234 current disk space = 1550702837760 free memory = 1603580504 SRR6958234 SRAfilesize 2ce898bdd8145c5aaa28a01665ee26c7 SRR6958234.sra SRR6958234.sra file validated SRR6958234 is paired end SRR6958234 is conventional basespace SRR6958234 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958234_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.55075 18.0 18.0 33.0 18.0 33.0 2 27.57325 28.0 25.0 31.0 18.0 33.0 3 29.045 30.0 27.0 33.0 25.0 33.0 4 30.884 31.0 30.0 33.0 28.0 33.0 5 32.12125 33.0 32.0 33.0 31.0 33.0 6 36.20175 37.0 36.0 38.0 33.0 38.0 7 36.9 38.0 37.0 38.0 35.0 38.0 8 35.86125 38.0 37.0 38.0 31.0 38.0 9 36.98775 38.0 37.0 38.0 35.0 38.0 10-14 37.3575 38.0 38.0 38.0 36.6 38.0 15-19 37.43395 38.0 38.0 38.0 37.0 38.0 20-24 37.38335 38.0 38.0 38.0 36.8 38.0 25-29 37.55525 38.0 38.0 38.0 38.0 38.0 30-34 37.622749999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.562400000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.5486 38.0 38.0 38.0 38.0 38.0 45-49 37.5001 38.0 38.0 38.0 37.8 38.0 50-54 37.28375 38.0 38.0 38.0 36.8 38.0 55-59 37.09165 38.0 38.0 38.0 36.0 38.0 60-64 37.056000000000004 38.0 38.0 38.0 35.6 38.0 65-69 37.1539 38.0 38.0 38.0 36.0 38.0 70-74 37.19875 38.0 38.0 38.0 36.0 38.0 75-79 37.15025 38.0 38.0 38.0 36.0 38.0 80-84 37.0612 38.0 38.0 38.0 36.0 38.0 85-89 37.06585 38.0 38.0 38.0 35.8 38.0 90-94 36.9898 38.0 38.0 38.0 35.4 38.0 95-99 36.83075 38.0 38.0 38.0 34.8 38.0 100-104 36.697500000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.547450000000005 38.0 37.8 38.0 34.0 38.0 110-114 36.37365 38.0 37.8 38.0 34.0 38.0 115-119 36.27895 38.0 37.2 38.0 33.8 38.0 120-124 36.054950000000005 38.0 36.8 38.0 32.8 38.0 125-129 35.8695 38.0 36.2 38.0 32.2 38.0 130-134 35.8016 38.0 36.0 38.0 32.0 38.0 135-139 35.4763 38.0 36.0 38.0 31.0 38.0 140-144 35.039750000000005 38.0 34.6 38.0 29.2 38.0 145-149 34.265699999999995 38.0 33.6 38.0 27.0 38.0 150-151 30.260749999999998 35.5 27.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 0.0 17 0.0 18 2.0 19 0.0 20 1.0 21 3.0 22 4.0 23 2.0 24 2.0 25 4.0 26 6.0 27 14.0 28 23.0 29 19.0 30 31.0 31 36.0 32 69.0 33 111.0 34 190.0 35 357.0 36 938.0 37 2185.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.935400516795866 37.02842377260982 6.5891472868217065 31.44702842377261 2 23.549999999999997 13.25 33.45 29.75 3 19.7 19.6 25.5 35.199999999999996 4 24.875 28.275 22.075 24.775 5 22.925 32.425 24.075 20.575 6 22.2 34.65 22.650000000000002 20.5 7 17.875 23.9 40.925 17.299999999999997 8 17.625 25.1 31.474999999999998 25.8 9 18.65 22.675 33.925 24.75 10-14 22.225 28.02 26.575 23.18 15-19 22.314999999999998 27.58 26.619999999999997 23.485 20-24 22.325 27.939999999999998 26.075 23.66 25-29 22.09 27.465 26.790000000000003 23.655 30-34 22.35 27.169999999999998 26.715 23.765 35-39 22.065 26.805 27.075 24.055 40-44 22.785 27.295 26.495 23.425 45-49 21.995 27.685 26.275 24.044999999999998 50-54 21.790000000000003 27.37 26.229999999999997 24.610000000000003 55-59 22.41 26.884999999999998 26.395000000000003 24.310000000000002 60-64 22.606782034610383 26.83805141542463 26.512953886165853 24.04221266379914 65-69 22.112211221122113 26.452645264526453 26.542654265426542 24.892489248924893 70-74 22.45 27.58 25.605 24.365000000000002 75-79 22.215 26.955000000000002 26.93 23.9 80-84 22.395 26.650000000000002 26.305 24.65 85-89 22.53 26.83 26.565 24.075 90-94 22.48 26.76 26.490000000000002 24.27 95-99 22.575 26.27 26.640000000000004 24.515 100-104 22.695 27.47 26.045 23.79 105-109 22.355 27.12 26.41 24.115000000000002 110-114 23.044999999999998 26.705000000000002 25.759999999999998 24.490000000000002 115-119 22.59 27.055 26.26 24.095 120-124 22.759999999999998 27.18 25.86 24.2 125-129 22.235 27.3 25.41 25.055 130-134 23.05 26.88 25.83 24.240000000000002 135-139 23.24 27.375 25.405 23.98 140-144 22.475 26.375 26.0 25.15 145-149 23.075000000000003 26.265 25.929999999999996 24.73 150-151 22.025 26.937499999999996 25.362499999999997 25.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 2.5 27 3.5 28 4.5 29 5.5 30 7.0 31 12.0 32 20.5 33 28.5 34 33.5 35 55.5 36 73.0 37 91.5 38 116.0 39 131.0 40 177.5 41 210.5 42 228.5 43 241.5 44 233.0 45 241.5 46 235.5 47 214.0 48 200.5 49 182.0 50 160.5 51 141.5 52 117.5 53 101.0 54 86.5 55 76.5 56 71.5 57 71.5 58 65.5 59 47.5 60 46.5 61 41.5 62 33.5 63 30.5 64 30.0 65 30.0 66 23.5 67 15.5 68 12.5 69 11.5 70 9.0 71 8.5 72 8.0 73 4.0 74 2.0 75 1.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.03 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4526024641689716 0.8999999999999999 3 0.025144581342720643 0.075 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.4000000000000004 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.5250000000000004 0.0 0.0 0.0 0.0 120-121 3.85 0.0 0.0 0.0 0.0 122-123 4.325 0.0 0.0 0.0 0.0 124-125 4.65 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.675000000000001 0.0 0.0 0.0 0.0 130-131 6.25 0.0 0.0 0.0 0.0 132-133 6.75 0.0 0.0 0.0 0.0 134-135 7.5625 0.0 0.0 0.0 0.0 136-137 8.162500000000001 0.0 0.0 0.0 0.0 138-139 8.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGTA 10 0.006832588 144.9875 4 ACTCCCT 10 0.006832588 144.9875 145 TTCTCCG 10 0.006832588 144.9875 7 TACTGGT 10 0.006832588 144.9875 4 TCTCCGG 10 0.006832588 144.9875 8 ACTGGTG 10 0.006832588 144.9875 5 AATGTCT 10 0.006832588 144.9875 5 CTCCGGC 10 0.006832588 144.9875 9 >>END_MODULE SRR6958234 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958234_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.17375 33.0 33.0 34.0 33.0 34.0 2 33.26675 34.0 33.0 34.0 33.0 34.0 3 33.33 34.0 33.0 34.0 33.0 34.0 4 33.28525 34.0 33.0 34.0 33.0 34.0 5 33.35475 34.0 33.0 34.0 33.0 34.0 6 37.3945 38.0 38.0 38.0 38.0 38.0 7 37.465 38.0 38.0 38.0 38.0 38.0 8 37.4645 38.0 38.0 38.0 38.0 38.0 9 37.446 38.0 38.0 38.0 38.0 38.0 10-14 37.424400000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.42125 38.0 38.0 38.0 38.0 38.0 20-24 36.9562 38.0 38.0 38.0 35.4 38.0 25-29 37.440250000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.4708 38.0 38.0 38.0 38.0 38.0 35-39 36.74715 38.0 37.8 38.0 34.4 38.0 40-44 37.38505 38.0 38.0 38.0 38.0 38.0 45-49 37.39985 38.0 38.0 38.0 38.0 38.0 50-54 37.38995 38.0 38.0 38.0 38.0 38.0 55-59 36.6583 38.0 37.6 38.0 34.4 38.0 60-64 37.3101 38.0 38.0 38.0 37.8 38.0 65-69 37.32815 38.0 38.0 38.0 38.0 38.0 70-74 37.26485 38.0 38.0 38.0 37.2 38.0 75-79 37.204899999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.162099999999995 38.0 38.0 38.0 37.0 38.0 85-89 37.1547 38.0 38.0 38.0 37.0 38.0 90-94 37.04 38.0 38.0 38.0 36.8 38.0 95-99 37.030649999999994 38.0 38.0 38.0 36.4 38.0 100-104 36.6764 38.0 38.0 38.0 34.8 38.0 105-109 35.82085000000001 38.0 36.6 38.0 31.0 38.0 110-114 35.8543 38.0 37.2 38.0 31.6 38.0 115-119 36.583299999999994 38.0 38.0 38.0 34.8 38.0 120-124 35.11274999999999 38.0 36.4 38.0 27.4 38.0 125-129 35.78075 38.0 37.2 38.0 32.0 38.0 130-134 35.18344999999999 38.0 36.2 38.0 27.8 38.0 135-139 32.5089 36.6 29.8 38.0 20.8 38.0 140-144 34.734249999999996 38.0 35.2 38.0 29.6 38.0 145-149 34.49945 38.0 36.0 38.0 28.2 38.0 150-151 28.603625 34.5 19.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 3.0 11 1.0 12 2.0 13 1.0 14 1.0 15 3.0 16 1.0 17 6.0 18 3.0 19 4.0 20 2.0 21 4.0 22 3.0 23 8.0 24 7.0 25 13.0 26 12.0 27 20.0 28 18.0 29 14.0 30 20.0 31 32.0 32 41.0 33 80.0 34 146.0 35 252.0 36 885.0 37 2408.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.325 21.05 8.05 24.575 2 27.900000000000002 24.2 28.999999999999996 18.9 3 22.35 24.525 31.1 22.025 4 25.5 31.974999999999998 21.15 21.375 5 27.0 34.625 19.15 19.225 6 22.625 36.55 21.175 19.650000000000002 7 22.325 20.724999999999998 36.0 20.95 8 22.650000000000002 24.575 25.95 26.825 9 24.125 22.55 28.549999999999997 24.775 10-14 25.27 27.705000000000002 24.825 22.2 15-19 24.654999999999998 26.465 26.265 22.615 20-24 24.515 26.979999999999997 25.665 22.84 25-29 25.240000000000002 26.41 25.88 22.470000000000002 30-34 24.474999999999998 26.205000000000002 26.185000000000002 23.135 35-39 25.259999999999998 27.089999999999996 25.275 22.375 40-44 24.795 26.035000000000004 26.1 23.07 45-49 24.47 26.090000000000003 26.3 23.14 50-54 24.695 26.669999999999998 26.174999999999997 22.46 55-59 25.03 26.32 25.995 22.655 60-64 24.805 26.055 26.174999999999997 22.965 65-69 24.8 25.974999999999998 26.47 22.755 70-74 24.13 26.735 26.38 22.755 75-79 24.69 26.31 26.44 22.56 80-84 24.67 26.534999999999997 26.215 22.58 85-89 24.355 26.529999999999998 26.565 22.55 90-94 24.72 26.655 26.3 22.325 95-99 24.25 26.72 26.474999999999998 22.555 100-104 25.105 26.455000000000002 25.965 22.475 105-109 24.64 26.840000000000003 26.365 22.155 110-114 24.73 26.895000000000003 26.43 21.945 115-119 25.115 26.484999999999996 25.919999999999998 22.48 120-124 24.98 26.935 26.505000000000003 21.58 125-129 25.174999999999997 26.490000000000002 26.265 22.07 130-134 25.790000000000003 26.3 26.040000000000003 21.87 135-139 25.419999999999998 27.29 26.365 20.925 140-144 26.39 26.11 26.565 20.935000000000002 145-149 25.895000000000003 26.345000000000002 26.169999999999998 21.59 150-151 25.4 27.224999999999998 26.700000000000003 20.674999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.5 27 3.0 28 4.5 29 6.0 30 7.5 31 8.5 32 14.5 33 30.0 34 34.5 35 38.5 36 56.0 37 69.5 38 92.5 39 119.0 40 150.5 41 176.0 42 203.0 43 221.5 44 208.0 45 228.5 46 235.0 47 207.0 48 209.0 49 206.5 50 183.5 51 147.0 52 114.5 53 112.0 54 101.5 55 90.5 56 88.5 57 82.5 58 78.5 59 63.0 60 54.0 61 48.0 62 45.5 63 47.0 64 40.5 65 32.5 66 23.0 67 20.0 68 20.5 69 21.0 70 18.5 71 12.0 72 8.0 73 5.0 74 3.0 75 2.0 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.395008822788 98.575 2 0.45374338290899924 0.8999999999999999 3 0.10083186286866651 0.3 4 0.025207965717166627 0.1 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.3875000000000002 0.0 0.0 0.0 0.0 106-107 1.5499999999999998 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.3 0.0 0.0 0.0 0.0 120-121 3.6 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.3375 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.175000000000001 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.05 0.0 0.0 0.0 0.0 134-135 6.675000000000001 0.0 0.0 0.0 0.0 136-137 7.074999999999999 0.0 0.0 0.0 0.0 138-139 7.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGTTT 10 0.006830828 145.0 5 CAGTGGT 10 0.006830828 145.0 4 >>END_MODULE Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608644 spots for SRR6958234.sra Written 608644 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra Read 608636 spots for SRR6958234.sra Written 608636 spots for SRR6958234.sra SRR ids: ['SRR6958234.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9xse0z75 SRR6958234.sra spots: 12172728 blocks: [[1, 608636], [608637, 1217272], [1217273, 1825908], [1825909, 2434544], [2434545, 3043180], [3043181, 3651816], [3651817, 4260452], [4260453, 4869088], [4869089, 5477724], [5477725, 6086360], [6086361, 6694996], [6694997, 7303632], [7303633, 7912268], [7912269, 8520904], [8520905, 9129540], [9129541, 9738176], [9738177, 10346812], [10346813, 10955448], [10955449, 11564084], [11564085, 12172728]] SRR6958234 file size 4103237 SRR6958234 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958234 SRR6958234_1.fastq SRR6958234_2.fastq Input file: SRR6958234_1.fastq Paired file: SRR6958234_2.fastq trimmed: SRR6958234-trimmed-pair1.fastq, SRR6958234-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:09:17 2024 >> started Fri Dec 6 17:09:32 2024 >> done (14.909s) 12172728 read pairs processed; of these: 6366 ( 0.05%) short read pairs filtered out after trimming by size control 6915 ( 0.06%) empty read pairs filtered out after trimming by size control 12159447 (99.89%) read pairs available; of these: 6758797 (55.58%) trimmed read pairs available after processing 5400650 (44.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 10 0.00% 21 6 0.00% 22 4 0.00% 23 4 0.00% 24 7 0.00% 25 13 0.00% 26 11 0.00% 27 5 0.00% 28 5 0.00% 29 10 0.00% 30 11 0.00% 31 9 0.00% 32 10 0.00% 33 12 0.00% 34 16 0.00% 35 15 0.00% 36 12 0.00% 37 15 0.00% 38 20 0.00% 39 17 0.00% 40 21 0.00% 41 16 0.00% 42 32 0.00% 43 28 0.00% 44 23 0.00% 45 41 0.00% 46 31 0.00% 47 26 0.00% 48 38 0.00% 49 44 0.00% 50 54 0.00% 51 44 0.00% 52 51 0.00% 53 78 0.00% 54 68 0.00% 55 68 0.00% 56 75 0.00% 57 104 0.00% 58 121 0.00% 59 148 0.00% 60 135 0.00% 61 158 0.00% 62 174 0.00% 63 222 0.00% 64 226 0.00% 65 232 0.00% 66 295 0.00% 67 296 0.00% 68 350 0.00% 69 386 0.00% 70 448 0.00% 71 487 0.00% 72 554 0.00% 73 678 0.01% 74 738 0.01% 75 834 0.01% 76 1040 0.01% 77 1171 0.01% 78 1112 0.01% 79 1278 0.01% 80 1455 0.01% 81 1714 0.01% 82 1803 0.01% 83 2219 0.02% 84 2499 0.02% 85 2918 0.02% 86 3116 0.03% 87 3308 0.03% 88 3684 0.03% 89 3987 0.03% 90 4239 0.03% 91 4808 0.04% 92 5332 0.04% 93 5657 0.05% 94 6157 0.05% 95 6759 0.06% 96 7181 0.06% 97 7572 0.06% 98 7954 0.07% 99 8780 0.07% 100 9879 0.08% 101 11225 0.09% 102 11145 0.09% 103 11723 0.10% 104 12656 0.10% 105 13458 0.11% 106 14219 0.12% 107 14860 0.12% 108 15285 0.13% 109 16368 0.13% 110 17178 0.14% 111 18260 0.15% 112 19213 0.16% 113 20404 0.17% 114 21871 0.18% 115 22714 0.19% 116 23644 0.19% 117 24578 0.20% 118 24873 0.20% 119 25751 0.21% 120 27023 0.22% 121 28207 0.23% 122 29893 0.25% 123 31707 0.26% 124 33169 0.27% 125 34676 0.29% 126 35940 0.30% 127 37337 0.31% 128 38282 0.31% 129 40136 0.33% 130 42689 0.35% 131 44220 0.36% 132 46506 0.38% 133 49599 0.41% 134 52143 0.43% 135 55889 0.46% 136 58221 0.48% 137 61178 0.50% 138 65077 0.54% 139 70917 0.58% 140 75117 0.62% 141 82770 0.68% 142 92449 0.76% 143 104258 0.86% 144 119373 0.98% 145 144593 1.19% 146 180646 1.49% 147 241566 1.99% 148 362031 2.98% 149 724366 5.96% 150 3296220 27.11% 151 5400650 44.42% 12159447 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=20 prefix-density=0.63 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=75.44 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.03 fanout-score-rank=17 prefix-density=0.39 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=22.05 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958234 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:10:18 Started mapping on | Dec 06 17:10:18 Finished on | Dec 06 17:11:11 Mapping speed, Million of reads per hour | 825.92 Number of input reads | 12159447 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11945047 Uniquely mapped reads % | 98.24% Average mapped length | 293.52 Number of splices: Total | 13440746 Number of splices: Annotated (sjdb) | 12627341 Number of splices: GT/AG | 13263866 Number of splices: GC/AG | 158953 Number of splices: AT/AC | 5540 Number of splices: Non-canonical | 12387 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.46 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 84849 % of reads mapped to multiple loci | 0.70% Number of reads mapped to too many loci | 8642 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.62% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 133664 133664 133664 N_multimapping 84849 84849 84849 N_noFeature 559487 11604469 673306 N_ambiguous 270127 1497 44037 UnstrandedReadsAssigned:11115433 PositiveStrandReadsAssigned:339081 NegativeStrandReadsAssigned:11227704 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958234 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958234-trimmed-pair1.fastq SRR6958234-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,159,447 reads, 11,249,038 reads pseudoaligned [quant] estimated average fragment length: 225.815 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR6958234.ke.tsv 35125 SRR6958234.se.tsv 88098 total ==> SRR6958234.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 711.616 0 0 PNS24247 1044 819.185 45.558 7.88461 PNS24249 1928 1703.19 18.413 1.53272 PNS24246 1044 819.185 45.558 7.88461 PNS24248 1044 819.185 45.558 7.88461 PNS24244 1471 1246.19 19.913 2.26543 PNS24243 293 96.4563 0 0 KQK14069 1603 1378.19 2515.97 258.819 KQK14071 474 253.521 56.2473 31.4547 ==> SRR6958234.se.tsv <== BRADI_1g14170v3 3114 BRADI_1g53295v3 321 BRADI_1g59795v3 400 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 209 BRADI_1g74790v3 75 BRADI_1g09890v3 0 BRADI_1g77505v3 158 BRADI_1g48960v3 0 SRR6958234 completed mapping pipeline successfully