Starting /dee2/code/volunteer_pipeline.sh SRR6958235 current disk space = 1550655283200 free memory = 1604889416 SRR6958235 SRAfilesize c7b2e088f827acc38d56d2a59111602d SRR6958235.sra SRR6958235.sra file validated SRR6958235 is paired end SRR6958235 is conventional basespace SRR6958235 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958235_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.659 18.0 18.0 18.0 18.0 18.0 2 26.678 27.0 27.0 28.0 25.0 30.0 3 28.94925 29.0 27.0 31.0 25.0 33.0 4 31.04025 31.0 30.0 33.0 29.0 33.0 5 32.23175 33.0 32.0 33.0 32.0 33.0 6 35.6235 37.0 35.0 38.0 31.0 38.0 7 36.67275 38.0 37.0 38.0 34.0 38.0 8 36.10175 38.0 37.0 38.0 33.0 38.0 9 37.00825 38.0 38.0 38.0 35.0 38.0 10-14 37.2359 38.0 38.0 38.0 36.0 38.0 15-19 37.23125 38.0 38.0 38.0 36.2 38.0 20-24 37.21825 38.0 38.0 38.0 36.4 38.0 25-29 37.37845 38.0 38.0 38.0 37.0 38.0 30-34 37.5455 38.0 38.0 38.0 37.6 38.0 35-39 37.44335 38.0 38.0 38.0 37.2 38.0 40-44 37.41915 38.0 38.0 38.0 37.0 38.0 45-49 37.3998 38.0 38.0 38.0 36.8 38.0 50-54 37.01375 38.0 38.0 38.0 35.6 38.0 55-59 36.77374999999999 38.0 38.0 38.0 34.8 38.0 60-64 36.816599999999994 38.0 38.0 38.0 35.0 38.0 65-69 36.81465 38.0 37.8 38.0 35.0 38.0 70-74 36.92659999999999 38.0 38.0 38.0 35.2 38.0 75-79 36.87169999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.7555 38.0 38.0 38.0 34.8 38.0 85-89 36.842499999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.727450000000005 38.0 38.0 38.0 34.6 38.0 95-99 36.505399999999995 38.0 37.6 38.0 34.0 38.0 100-104 36.402699999999996 38.0 37.0 38.0 33.8 38.0 105-109 36.24829999999999 38.0 37.0 38.0 33.8 38.0 110-114 35.97715 38.0 36.8 38.0 32.0 38.0 115-119 35.8192 38.0 36.2 38.0 31.4 38.0 120-124 35.65325 38.0 35.8 38.0 31.0 38.0 125-129 35.329499999999996 38.0 35.2 38.0 29.8 38.0 130-134 35.256899999999995 38.0 35.2 38.0 30.0 38.0 135-139 34.672200000000004 38.0 34.6 38.0 27.4 38.0 140-144 34.12715 38.0 34.2 38.0 24.2 38.0 145-149 33.41435 38.0 33.2 38.0 22.6 38.0 150-151 29.2205 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 4.0 20 1.0 21 4.0 22 3.0 23 4.0 24 3.0 25 8.0 26 5.0 27 14.0 28 23.0 29 38.0 30 37.0 31 47.0 32 96.0 33 140.0 34 256.0 35 503.0 36 1177.0 37 1632.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.994879672299028 7.578084997439836 33.05171530977983 39.37532002048131 2 21.525 11.25 39.7 27.525 3 21.575 16.125 26.625 35.675000000000004 4 26.0 24.125 22.175 27.700000000000003 5 24.95 29.45 25.025 20.575 6 19.875 33.650000000000006 24.925 21.55 7 16.0 23.65 41.05 19.3 8 19.55 23.7 31.574999999999996 25.174999999999997 9 18.5 22.175 35.0 24.325 10-14 21.709999999999997 28.144999999999996 26.71 23.435 15-19 22.1 26.490000000000002 26.985 24.425 20-24 21.335 27.229999999999997 27.54 23.895 25-29 22.45 26.63 26.889999999999997 24.03 30-34 22.375 27.125 26.334999999999997 24.165 35-39 22.145 26.25 27.189999999999998 24.415 40-44 22.14 26.605 26.51 24.745 45-49 21.86 26.674999999999997 27.045 24.42 50-54 22.134999999999998 26.740000000000002 27.145000000000003 23.98 55-59 21.584999999999997 27.27 26.38 24.765 60-64 21.488223233485023 27.389108366254938 26.88903335500325 24.233635045256786 65-69 22.211110555527778 26.251312565628282 27.281364068203413 24.25621281064053 70-74 22.195 26.790000000000003 26.625 24.39 75-79 21.745 26.11 27.169999999999998 24.975 80-84 22.009999999999998 26.905 26.57 24.515 85-89 22.255 26.715 26.63 24.4 90-94 22.68 26.47 26.834999999999997 24.015 95-99 22.325 26.46 26.919999999999998 24.295 100-104 22.155 26.8 26.76 24.285 105-109 22.455 26.88 26.284999999999997 24.38 110-114 22.73 26.295 26.979999999999997 23.995 115-119 23.44 27.295 25.919999999999998 23.345 120-124 23.09 27.255000000000003 25.3 24.355 125-129 22.46 27.534999999999997 25.729999999999997 24.275 130-134 22.425 27.200000000000003 25.27 25.105 135-139 22.2 27.029999999999998 25.77 25.0 140-144 22.585 27.13 25.180000000000003 25.105 145-149 22.14 27.200000000000003 25.174999999999997 25.485000000000003 150-151 21.375 27.1625 25.2375 26.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 3.5 27 5.0 28 4.0 29 7.5 30 14.0 31 21.0 32 28.5 33 31.0 34 41.5 35 56.0 36 65.5 37 80.5 38 111.5 39 148.0 40 162.0 41 185.0 42 212.5 43 216.5 44 227.0 45 244.5 46 240.5 47 230.5 48 208.5 49 186.5 50 168.0 51 138.0 52 126.0 53 111.5 54 81.5 55 74.5 56 74.5 57 63.5 58 62.0 59 53.5 60 43.0 61 41.0 62 39.5 63 32.0 64 28.0 65 26.5 66 22.0 67 18.0 68 14.5 69 14.0 70 10.5 71 7.0 72 6.0 73 4.5 74 2.0 75 1.0 76 2.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.015 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.1500000000000004 0.0 0.0 0.0 0.0 108-109 2.65 0.0 0.0 0.0 0.0 110-111 3.0374999999999996 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.7625 0.0 0.0 0.0 0.0 116-117 4.175000000000001 0.0 0.0 0.0 0.0 118-119 4.949999999999999 0.0 0.0 0.0 0.0 120-121 5.725 0.0 0.0 0.0 0.0 122-123 6.3375 0.0 0.0 0.0 0.0 124-125 7.025 0.0 0.0 0.0 0.0 126-127 7.8 0.0 0.0 0.0 0.0 128-129 8.5 0.0 0.0 0.0 0.0 130-131 8.95 0.0 0.0 0.0 0.0 132-133 9.8875 0.0 0.0 0.0 0.0 134-135 10.675 0.0 0.0 0.0 0.0 136-137 11.6 0.0 0.0 0.0 0.0 138-139 12.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACGTC 45 0.008963385 48.325 145 >>END_MODULE SRR6958235 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958235_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0565 33.0 33.0 34.0 33.0 34.0 2 33.18925 34.0 33.0 34.0 33.0 34.0 3 33.1905 34.0 33.0 34.0 33.0 34.0 4 33.10075 34.0 33.0 34.0 33.0 34.0 5 33.18225 34.0 33.0 34.0 33.0 34.0 6 37.29525 38.0 38.0 38.0 38.0 38.0 7 37.338 38.0 38.0 38.0 38.0 38.0 8 37.30325 38.0 38.0 38.0 38.0 38.0 9 37.31375 38.0 38.0 38.0 38.0 38.0 10-14 37.2824 38.0 38.0 38.0 37.2 38.0 15-19 37.240500000000004 38.0 38.0 38.0 37.4 38.0 20-24 36.5438 38.0 37.8 38.0 33.6 38.0 25-29 37.2434 38.0 38.0 38.0 37.4 38.0 30-34 37.29085 38.0 38.0 38.0 37.8 38.0 35-39 36.5629 38.0 37.6 38.0 34.0 38.0 40-44 37.18435 38.0 38.0 38.0 37.0 38.0 45-49 37.2038 38.0 38.0 38.0 37.0 38.0 50-54 37.1867 38.0 38.0 38.0 37.0 38.0 55-59 36.3493 38.0 37.4 38.0 31.2 38.0 60-64 37.11105 38.0 38.0 38.0 36.8 38.0 65-69 37.05255 38.0 38.0 38.0 36.8 38.0 70-74 37.03554999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.020050000000005 38.0 38.0 38.0 36.2 38.0 80-84 36.958749999999995 38.0 38.0 38.0 36.2 38.0 85-89 36.88585 38.0 38.0 38.0 36.0 38.0 90-94 36.73145 38.0 38.0 38.0 35.8 38.0 95-99 36.691500000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.17935 38.0 37.8 38.0 33.0 38.0 105-109 35.42614999999999 38.0 36.2 38.0 30.2 38.0 110-114 35.4984 38.0 36.6 38.0 30.2 38.0 115-119 36.155 38.0 38.0 38.0 34.0 38.0 120-124 34.262299999999996 38.0 34.2 38.0 23.6 38.0 125-129 35.26875 38.0 35.6 38.0 30.4 38.0 130-134 34.1524 38.0 34.0 38.0 24.4 38.0 135-139 31.807 36.0 28.2 38.0 20.2 38.0 140-144 33.919200000000004 38.0 33.4 38.0 23.8 38.0 145-149 33.47215 38.0 33.8 38.0 19.2 38.0 150-151 27.216124999999998 33.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 4.0 5 2.0 6 1.0 7 0.0 8 1.0 9 2.0 10 0.0 11 1.0 12 0.0 13 1.0 14 3.0 15 3.0 16 2.0 17 2.0 18 2.0 19 5.0 20 5.0 21 5.0 22 7.0 23 5.0 24 14.0 25 7.0 26 9.0 27 13.0 28 19.0 29 20.0 30 31.0 31 72.0 32 73.0 33 110.0 34 168.0 35 377.0 36 1060.0 37 1962.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.725 19.375 11.15 32.75 2 27.650000000000002 25.3 30.025000000000002 17.025000000000002 3 21.95 27.975 28.499999999999996 21.575 4 25.0 32.824999999999996 21.275 20.9 5 27.05 33.95 20.375 18.625 6 21.375 38.25 21.099999999999998 19.275000000000002 7 20.325 20.175 37.95 21.55 8 22.35 24.2 27.575 25.874999999999996 9 22.775000000000002 22.8 30.0 24.425 10-14 24.675 27.315 24.990000000000002 23.02 15-19 25.055 26.700000000000003 25.665 22.58 20-24 24.385 27.334999999999997 26.035000000000004 22.245 25-29 24.365000000000002 27.250000000000004 25.455 22.93 30-34 24.54 26.855 26.195 22.41 35-39 23.95 26.88 26.88 22.29 40-44 25.15 26.474999999999998 25.75 22.625 45-49 24.59 26.155 26.724999999999998 22.53 50-54 24.29 26.96 26.02 22.73 55-59 24.775 27.284999999999997 25.865 22.075 60-64 24.27 26.72 26.369999999999997 22.64 65-69 23.945 26.575 27.0 22.48 70-74 25.290000000000003 26.805 25.990000000000002 21.915000000000003 75-79 24.315 26.685 27.26 21.740000000000002 80-84 24.48 27.165 26.419999999999998 21.935 85-89 24.404999999999998 26.775 26.375 22.445 90-94 23.97 27.13 26.534999999999997 22.365 95-99 24.565 27.034999999999997 26.650000000000002 21.75 100-104 24.834999999999997 27.339999999999996 25.72 22.105 105-109 24.14 27.925 25.765 22.17 110-114 24.645 27.229999999999997 26.150000000000002 21.975 115-119 25.624999999999996 27.275 25.955000000000002 21.145 120-124 25.679999999999996 27.134999999999998 25.825 21.36 125-129 25.575 27.67 25.455 21.3 130-134 25.85 27.73 25.119999999999997 21.3 135-139 25.435000000000002 26.995 26.405 21.165 140-144 26.815 27.189999999999998 25.055 20.94 145-149 26.634999999999998 27.975 24.755 20.635 150-151 26.55 27.6375 25.337500000000002 20.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 1.0 25 3.5 26 3.5 27 4.5 28 9.5 29 11.5 30 12.5 31 16.5 32 16.5 33 25.5 34 40.5 35 52.0 36 70.5 37 88.0 38 103.0 39 123.0 40 153.0 41 183.0 42 203.0 43 217.5 44 228.0 45 227.0 46 216.0 47 217.5 48 200.5 49 172.0 50 169.0 51 154.5 52 129.5 53 112.0 54 101.5 55 95.0 56 79.5 57 67.0 58 64.5 59 60.0 60 54.5 61 45.0 62 35.5 63 37.0 64 40.0 65 32.0 66 22.0 67 20.0 68 21.5 69 19.5 70 14.5 71 10.5 72 6.5 73 3.5 74 2.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44584382871537 98.7 2 0.42821158690176325 0.8500000000000001 3 0.07556675062972291 0.22499999999999998 4 0.025188916876574305 0.1 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.8875 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.6625 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.3499999999999996 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 4.0375 0.0 0.0 0.0 0.0 118-119 4.775 0.0 0.0 0.0 0.0 120-121 5.475 0.0 0.0 0.0 0.0 122-123 6.025 0.0 0.0 0.0 0.0 124-125 6.5625 0.0 0.0 0.0 0.0 126-127 7.2 0.0 0.0 0.0 0.0 128-129 7.7625 0.0 0.0 0.0 0.0 130-131 8.1625 0.0 0.0 0.0 0.0 132-133 9.024999999999999 0.0 0.0 0.0 0.0 134-135 9.6875 0.0 0.0 0.0 0.0 136-137 10.4875 0.0 0.0 0.0 0.0 138-139 11.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGTGT 45 0.008957279 48.333332 145 >>END_MODULE Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660766 spots for SRR6958235.sra Written 660766 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra Read 660754 spots for SRR6958235.sra Written 660754 spots for SRR6958235.sra SRR ids: ['SRR6958235.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1l_15xos SRR6958235.sra spots: 13215092 blocks: [[1, 660754], [660755, 1321508], [1321509, 1982262], [1982263, 2643016], [2643017, 3303770], [3303771, 3964524], [3964525, 4625278], [4625279, 5286032], [5286033, 5946786], [5946787, 6607540], [6607541, 7268294], [7268295, 7929048], [7929049, 8589802], [8589803, 9250556], [9250557, 9911310], [9911311, 10572064], [10572065, 11232818], [11232819, 11893572], [11893573, 12554326], [12554327, 13215092]] SRR6958235 file size 4456460 SRR6958235 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958235 SRR6958235_1.fastq SRR6958235_2.fastq Input file: SRR6958235_1.fastq Paired file: SRR6958235_2.fastq trimmed: SRR6958235-trimmed-pair1.fastq, SRR6958235-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:10:31 2024 >> started Fri Dec 6 17:10:46 2024 >> done (14.723s) 13215092 read pairs processed; of these: 8876 ( 0.07%) short read pairs filtered out after trimming by size control 15789 ( 0.12%) empty read pairs filtered out after trimming by size control 13190427 (99.81%) read pairs available; of these: 7899978 (59.89%) trimmed read pairs available after processing 5290449 (40.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 8 0.00% 21 3 0.00% 22 2 0.00% 23 7 0.00% 24 9 0.00% 25 6 0.00% 26 9 0.00% 27 7 0.00% 28 8 0.00% 29 14 0.00% 30 8 0.00% 31 9 0.00% 32 7 0.00% 33 11 0.00% 34 6 0.00% 35 16 0.00% 36 15 0.00% 37 19 0.00% 38 27 0.00% 39 17 0.00% 40 24 0.00% 41 27 0.00% 42 22 0.00% 43 38 0.00% 44 37 0.00% 45 43 0.00% 46 45 0.00% 47 57 0.00% 48 61 0.00% 49 69 0.00% 50 76 0.00% 51 86 0.00% 52 75 0.00% 53 89 0.00% 54 97 0.00% 55 121 0.00% 56 150 0.00% 57 161 0.00% 58 186 0.00% 59 182 0.00% 60 218 0.00% 61 278 0.00% 62 324 0.00% 63 325 0.00% 64 353 0.00% 65 417 0.00% 66 440 0.00% 67 507 0.00% 68 578 0.00% 69 676 0.01% 70 767 0.01% 71 758 0.01% 72 973 0.01% 73 1061 0.01% 74 1129 0.01% 75 1367 0.01% 76 1549 0.01% 77 1765 0.01% 78 1893 0.01% 79 2227 0.02% 80 2470 0.02% 81 2617 0.02% 82 3103 0.02% 83 3428 0.03% 84 4011 0.03% 85 4817 0.04% 86 5109 0.04% 87 5598 0.04% 88 6028 0.05% 89 6344 0.05% 90 6912 0.05% 91 7533 0.06% 92 8233 0.06% 93 9072 0.07% 94 10009 0.08% 95 10600 0.08% 96 11110 0.08% 97 12227 0.09% 98 13017 0.10% 99 13935 0.11% 100 15279 0.12% 101 16821 0.13% 102 16896 0.13% 103 17622 0.13% 104 19126 0.14% 105 20040 0.15% 106 21420 0.16% 107 22507 0.17% 108 23390 0.18% 109 24625 0.19% 110 25354 0.19% 111 26732 0.20% 112 28243 0.21% 113 29739 0.23% 114 31258 0.24% 115 32971 0.25% 116 33860 0.26% 117 35329 0.27% 118 36820 0.28% 119 37253 0.28% 120 39105 0.30% 121 40783 0.31% 122 42728 0.32% 123 44492 0.34% 124 46613 0.35% 125 48808 0.37% 126 50807 0.39% 127 53416 0.40% 128 55025 0.42% 129 57208 0.43% 130 60559 0.46% 131 62704 0.48% 132 65490 0.50% 133 69512 0.53% 134 72231 0.55% 135 76225 0.58% 136 80818 0.61% 137 85121 0.65% 138 91292 0.69% 139 98208 0.74% 140 103197 0.78% 141 112698 0.85% 142 125161 0.95% 143 139725 1.06% 144 157861 1.20% 145 190255 1.44% 146 234512 1.78% 147 306550 2.32% 148 448356 3.40% 149 846457 6.42% 150 3313133 25.12% 151 5290449 40.11% 13190427 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=33 prefix-density=0.58 prefix-fanout=2.4 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=47.15 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.0 sequence=CTTCTGCTTGGC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.13 fanout-score-rank=23 prefix-density=0.57 prefix-fanout=2.0 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=179.94 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.9 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958235 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:11:29 Started mapping on | Dec 06 17:11:29 Finished on | Dec 06 17:12:43 Mapping speed, Million of reads per hour | 641.70 Number of input reads | 13190427 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12875638 Uniquely mapped reads % | 97.61% Average mapped length | 290.93 Number of splices: Total | 14274989 Number of splices: Annotated (sjdb) | 13400317 Number of splices: GT/AG | 14082927 Number of splices: GC/AG | 165452 Number of splices: AT/AC | 5978 Number of splices: Non-canonical | 20632 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 136205 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 8816 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.98% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 183852 183852 183852 N_multimapping 136205 136205 136205 N_noFeature 578099 12512346 692113 N_ambiguous 296160 1680 47007 UnstrandedReadsAssigned:12001379 PositiveStrandReadsAssigned:361612 NegativeStrandReadsAssigned:12136518 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR6958235 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958235-trimmed-pair1.fastq SRR6958235-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,190,427 reads, 12,175,579 reads pseudoaligned [quant] estimated average fragment length: 204.804 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR6958235.ke.tsv 35125 SRR6958235.se.tsv 88098 total ==> SRR6958235.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.374 0 0 PNS24247 1044 840.196 44.0639 6.75954 PNS24249 1928 1724.2 35.0455 2.61975 PNS24246 1044 840.196 44.0639 6.75954 PNS24248 1044 840.196 44.0639 6.75954 PNS24244 1471 1267.2 46.7626 4.7563 PNS24243 293 105.537 0 0 KQK14069 1603 1399.2 2752.83 253.58 KQK14071 474 272.613 66.8556 31.6087 ==> SRR6958235.se.tsv <== BRADI_1g14170v3 3222 BRADI_1g53295v3 103 BRADI_1g59795v3 536 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 169 BRADI_1g74790v3 40 BRADI_1g09890v3 0 BRADI_1g77505v3 238 BRADI_1g48960v3 0 SRR6958235 completed mapping pipeline successfully