Starting /dee2/code/volunteer_pipeline.sh SRR6958236 current disk space = 1550655680512 free memory = 1600353852 SRR6958236 SRAfilesize 3a43a9dd1dbf6498f71b809c136113c7 SRR6958236.sra SRR6958236.sra file validated SRR6958236 is paired end SRR6958236 is conventional basespace SRR6958236 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958236_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.42325 18.0 18.0 30.0 18.0 32.0 2 28.504 29.0 27.0 31.0 18.0 33.0 3 29.83775 31.0 29.0 33.0 25.0 33.0 4 31.98025 33.0 32.0 33.0 31.0 33.0 5 32.67925 33.0 33.0 33.0 32.0 34.0 6 36.8075 38.0 37.0 38.0 35.0 38.0 7 37.1965 38.0 38.0 38.0 36.0 38.0 8 37.22125 38.0 38.0 38.0 36.0 38.0 9 37.56125 38.0 38.0 38.0 37.0 38.0 10-14 37.5621 38.0 38.0 38.0 38.0 38.0 15-19 37.5184 38.0 38.0 38.0 38.0 38.0 20-24 37.6522 38.0 38.0 38.0 38.0 38.0 25-29 37.63674999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.58245 38.0 38.0 38.0 38.0 38.0 35-39 37.5545 38.0 38.0 38.0 38.0 38.0 40-44 37.53515 38.0 38.0 38.0 38.0 38.0 45-49 37.565 38.0 38.0 38.0 38.0 38.0 50-54 37.562200000000004 38.0 38.0 38.0 38.0 38.0 55-59 37.49935000000001 38.0 38.0 38.0 37.8 38.0 60-64 37.3297 38.0 38.0 38.0 37.2 38.0 65-69 37.4435 38.0 38.0 38.0 37.4 38.0 70-74 37.44375 38.0 38.0 38.0 37.2 38.0 75-79 37.386250000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.3673 38.0 38.0 38.0 37.0 38.0 85-89 36.3684 38.0 37.0 38.0 31.2 38.0 90-94 37.14789999999999 38.0 38.0 38.0 36.2 38.0 95-99 37.22895 38.0 38.0 38.0 36.4 38.0 100-104 37.09705 38.0 38.0 38.0 36.0 38.0 105-109 36.96475 38.0 38.0 38.0 35.6 38.0 110-114 36.52935 38.0 37.8 38.0 34.0 38.0 115-119 36.8524 38.0 38.0 38.0 35.0 38.0 120-124 36.77215 38.0 38.0 38.0 34.8 38.0 125-129 36.507949999999994 38.0 38.0 38.0 34.0 38.0 130-134 36.39545 38.0 38.0 38.0 33.8 38.0 135-139 36.22089999999999 38.0 38.0 38.0 33.4 38.0 140-144 35.48870000000001 38.0 36.2 38.0 30.0 38.0 145-149 33.95645 38.0 33.8 38.0 24.2 38.0 150-151 31.67375 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 5.0 24 5.0 25 5.0 26 4.0 27 8.0 28 17.0 29 22.0 30 29.0 31 40.0 32 66.0 33 60.0 34 114.0 35 237.0 36 708.0 37 2674.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.93001060445387 12.327677624602334 8.006362672322375 42.735949098621425 2 23.425 12.5 34.0 30.075000000000003 3 20.674999999999997 15.15 24.25 39.925 4 26.474999999999998 23.200000000000003 20.474999999999998 29.849999999999998 5 25.45 27.950000000000003 23.3 23.3 6 21.725 32.625 23.825 21.825 7 17.325 23.775 40.025 18.875 8 21.349999999999998 23.1 29.4 26.150000000000002 9 20.125 21.85 33.275 24.75 10-14 22.770000000000003 26.58 25.729999999999997 24.92 15-19 22.48 25.374999999999996 26.02 26.125 20-24 22.515 25.6 26.165 25.72 25-29 23.44 25.52 25.665 25.374999999999996 30-34 22.97 26.045 25.8 25.185000000000002 35-39 22.68 25.27 26.229999999999997 25.82 40-44 22.93 25.119999999999997 26.195 25.755 45-49 22.389477895579116 25.670134026805364 25.970194038807758 25.970194038807758 50-54 23.51 25.355 25.545 25.590000000000003 55-59 23.044999999999998 24.85 26.0 26.105 60-64 23.044999999999998 25.419999999999998 25.835 25.7 65-69 22.757275727572758 25.167516751675166 25.85758575857586 26.21762176217622 70-74 23.61 24.705 25.985000000000003 25.7 75-79 23.21 25.314999999999998 25.745 25.729999999999997 80-84 23.315 25.15 26.22 25.314999999999998 85-89 23.345 25.36 25.569999999999997 25.724999999999998 90-94 23.48 24.825 25.474999999999998 26.22 95-99 23.66 25.119999999999997 25.61 25.61 100-104 23.385 25.490000000000002 25.795 25.330000000000002 105-109 23.06 25.624999999999996 25.71 25.605 110-114 23.64 24.77 25.724999999999998 25.865 115-119 23.805 25.169999999999998 25.455 25.569999999999997 120-124 23.29 25.330000000000002 25.66 25.72 125-129 23.580000000000002 24.779999999999998 25.785000000000004 25.855 130-134 23.265 25.495 25.45 25.790000000000003 135-139 23.605 25.395 25.445 25.555 140-144 23.919999999999998 24.9 25.650000000000002 25.53 145-149 23.494999999999997 25.16 25.81 25.535000000000004 150-151 22.95758788940323 24.82171900412861 25.997748029525837 26.222945076942324 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 2.5 27 3.5 28 3.5 29 5.5 30 8.0 31 10.0 32 10.0 33 19.0 34 26.5 35 30.5 36 50.5 37 65.0 38 71.0 39 89.5 40 121.5 41 154.5 42 172.5 43 178.0 44 188.0 45 203.5 46 212.5 47 218.0 48 207.0 49 194.5 50 182.5 51 150.0 52 130.5 53 133.5 54 119.5 55 96.5 56 89.5 57 96.5 58 84.5 59 70.0 60 74.5 61 73.5 62 63.0 63 53.0 64 55.5 65 52.0 66 40.5 67 35.0 68 32.5 69 27.0 70 22.5 71 20.0 72 15.5 73 9.0 74 6.5 75 5.0 76 4.0 77 4.0 78 3.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.5499999999999998 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.8875 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.6875 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.625 0.0 0.0 0.0 0.0 134-135 3.875 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958236 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958236_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62325 33.0 33.0 34.0 32.0 34.0 2 33.05975 34.0 33.0 34.0 32.0 34.0 3 33.14925 34.0 33.0 34.0 32.0 34.0 4 33.16775 34.0 33.0 34.0 33.0 34.0 5 32.8075 34.0 33.0 34.0 32.0 34.0 6 37.22525 38.0 38.0 38.0 37.0 38.0 7 37.3435 38.0 38.0 38.0 37.0 38.0 8 37.283 38.0 38.0 38.0 37.0 38.0 9 37.3315 38.0 38.0 38.0 37.0 38.0 10-14 37.0634 38.0 38.0 38.0 36.2 38.0 15-19 37.273 38.0 38.0 38.0 37.2 38.0 20-24 37.35549999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.0287 38.0 38.0 38.0 36.2 38.0 30-34 37.318400000000004 38.0 38.0 38.0 37.6 38.0 35-39 37.20515 38.0 38.0 38.0 36.8 38.0 40-44 36.9034 38.0 38.0 38.0 36.2 38.0 45-49 36.92954999999999 38.0 38.0 38.0 36.2 38.0 50-54 36.8177 38.0 38.0 38.0 35.2 38.0 55-59 37.198899999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.171400000000006 38.0 38.0 38.0 37.0 38.0 65-69 36.3622 38.0 38.0 38.0 33.2 38.0 70-74 36.9812 38.0 38.0 38.0 36.2 38.0 75-79 37.064049999999995 38.0 38.0 38.0 36.6 38.0 80-84 36.956149999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.835100000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.6659 38.0 38.0 38.0 35.0 38.0 95-99 35.31515 38.0 36.4 38.0 27.8 38.0 100-104 36.5658 38.0 38.0 38.0 34.6 38.0 105-109 35.91205 38.0 37.4 38.0 32.0 38.0 110-114 36.47475 38.0 38.0 38.0 34.4 38.0 115-119 36.4446 38.0 38.0 38.0 34.4 38.0 120-124 35.2039 38.0 36.4 38.0 28.0 38.0 125-129 35.8394 38.0 37.2 38.0 32.2 38.0 130-134 35.9207 38.0 38.0 38.0 32.8 38.0 135-139 34.410450000000004 38.0 34.4 38.0 25.4 38.0 140-144 35.1416 38.0 36.0 38.0 29.8 38.0 145-149 33.9455 38.0 34.6 38.0 24.6 38.0 150-151 29.411250000000003 35.5 27.0 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 4.0 5 0.0 6 1.0 7 0.0 8 0.0 9 2.0 10 2.0 11 1.0 12 1.0 13 0.0 14 1.0 15 4.0 16 1.0 17 2.0 18 5.0 19 5.0 20 5.0 21 4.0 22 9.0 23 6.0 24 11.0 25 12.0 26 16.0 27 18.0 28 24.0 29 27.0 30 44.0 31 49.0 32 64.0 33 109.0 34 136.0 35 237.0 36 598.0 37 2596.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.699999999999996 17.775 11.5 35.025 2 30.4 23.375 28.299999999999997 17.925 3 22.525000000000002 27.0 26.900000000000002 23.575 4 26.25 31.474999999999998 20.375 21.9 5 27.150000000000002 32.25 21.0 19.6 6 23.125 35.5 20.25 21.125 7 23.1 19.7 34.5 22.7 8 23.674999999999997 23.724999999999998 25.224999999999998 27.375 9 24.112056028014006 21.785892946473236 27.213606803401703 26.88844422211106 10-14 25.785000000000004 26.355 23.685000000000002 24.175 15-19 25.82758275827583 25.397539753975394 24.2974297429743 24.477447744774476 20-24 25.805 25.330000000000002 25.09 23.775 25-29 25.437543754375437 25.81258125812581 24.2974297429743 24.45244524452445 30-34 25.224999999999998 25.55 25.365 23.86 35-39 24.944988997799562 25.870174034806958 24.81496299259852 24.36987397479496 40-44 25.881294064703237 25.18125906295315 24.431221561078054 24.506225311265563 45-49 25.661283064153206 25.961298064903243 23.91119555977799 24.466223311165557 50-54 25.637563756375638 25.797579757975797 24.41744174417442 24.147414741474147 55-59 25.6514128532133 25.536384096024005 24.71617904476119 24.0960240060015 60-64 25.745 25.1 24.560000000000002 24.595 65-69 25.96 25.655 24.305 24.08 70-74 25.855 25.735000000000003 24.474999999999998 23.935000000000002 75-79 25.42754275427543 25.052505250525055 24.722472247224722 24.797479747974798 80-84 26.037603760376037 25.567556755675568 24.627462746274627 23.767376737673768 85-89 25.895000000000003 25.374999999999996 24.81 23.919999999999998 90-94 25.517551755175518 25.967596759675963 24.902490249024904 23.612361236123615 95-99 25.91 26.07 24.415 23.605 100-104 26.345000000000002 25.515 24.54 23.599999999999998 105-109 25.682568256825682 26.2976297629763 24.69246924692469 23.327332733273327 110-114 26.247624762476246 26.312631263126313 24.302430243024304 23.137313731373137 115-119 26.435 25.72 24.21 23.635 120-124 26.525 26.095000000000002 24.585 22.795 125-129 26.105 25.509999999999998 24.67 23.715 130-134 26.715 25.705 24.69 22.89 135-139 26.93 25.619999999999997 24.455 22.994999999999997 140-144 26.755000000000003 25.740000000000002 24.36 23.145 145-149 26.895000000000003 25.785000000000004 24.365000000000002 22.955000000000002 150-151 26.70419011882427 26.629143214509064 24.190118824265166 22.4765478424015 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 2.5 26 2.0 27 1.5 28 4.0 29 7.5 30 9.0 31 12.0 32 17.5 33 18.5 34 23.5 35 36.0 36 47.5 37 56.5 38 76.5 39 103.0 40 108.5 41 145.0 42 166.5 43 161.5 44 177.5 45 178.5 46 184.0 47 193.0 48 189.0 49 169.5 50 160.5 51 152.0 52 130.5 53 119.5 54 112.0 55 98.5 56 94.0 57 104.0 58 105.0 59 88.0 60 79.0 61 80.0 62 75.5 63 72.0 64 68.5 65 58.0 66 53.0 67 47.5 68 42.0 69 40.0 70 32.0 71 31.5 72 23.5 73 11.0 74 9.0 75 6.0 76 4.5 77 4.0 78 3.0 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.02 40-44 0.005 45-49 0.005 50-54 0.01 55-59 0.025 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.01 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14054600606673 98.05 2 0.7077856420626896 1.4000000000000001 3 0.05055611729019212 0.15 4 0.10111223458038424 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.5750000000000002 0.0 0.0 0.0 0.0 118-119 1.75 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.6500000000000004 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.6125 0.0 0.0 0.0 0.0 134-135 3.9250000000000003 0.0 0.0 0.0 0.0 136-137 4.225 0.0 0.0 0.0 0.0 138-139 4.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATTCC 10 0.0063298983 148.6923 145 >>END_MODULE Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053332 spots for SRR6958236.sra Written 1053332 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra Read 1053328 spots for SRR6958236.sra Written 1053328 spots for SRR6958236.sra SRR ids: ['SRR6958236.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nder6_74 SRR6958236.sra spots: 21066564 blocks: [[1, 1053328], [1053329, 2106656], [2106657, 3159984], [3159985, 4213312], [4213313, 5266640], [5266641, 6319968], [6319969, 7373296], [7373297, 8426624], [8426625, 9479952], [9479953, 10533280], [10533281, 11586608], [11586609, 12639936], [12639937, 13693264], [13693265, 14746592], [14746593, 15799920], [15799921, 16853248], [16853249, 17906576], [17906577, 18959904], [18959905, 20013232], [20013233, 21066564]] SRR6958236 file size 7117066 SRR6958236 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958236 SRR6958236_1.fastq SRR6958236_2.fastq Input file: SRR6958236_1.fastq Paired file: SRR6958236_2.fastq trimmed: SRR6958236-trimmed-pair1.fastq, SRR6958236-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:09:12 2024 >> started Fri Dec 6 17:09:35 2024 >> done (22.862s) 21066564 read pairs processed; of these: 12558 ( 0.06%) short read pairs filtered out after trimming by size control 13112 ( 0.06%) empty read pairs filtered out after trimming by size control 21040894 (99.88%) read pairs available; of these: 7262475 (34.52%) trimmed read pairs available after processing 13778419 (65.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 14 0.00% 21 10 0.00% 22 12 0.00% 23 11 0.00% 24 9 0.00% 25 15 0.00% 26 6 0.00% 27 9 0.00% 28 14 0.00% 29 9 0.00% 30 7 0.00% 31 16 0.00% 32 17 0.00% 33 13 0.00% 34 14 0.00% 35 14 0.00% 36 13 0.00% 37 13 0.00% 38 28 0.00% 39 14 0.00% 40 29 0.00% 41 27 0.00% 42 18 0.00% 43 21 0.00% 44 30 0.00% 45 24 0.00% 46 26 0.00% 47 31 0.00% 48 49 0.00% 49 43 0.00% 50 45 0.00% 51 67 0.00% 52 75 0.00% 53 73 0.00% 54 64 0.00% 55 76 0.00% 56 114 0.00% 57 125 0.00% 58 103 0.00% 59 161 0.00% 60 166 0.00% 61 197 0.00% 62 193 0.00% 63 247 0.00% 64 279 0.00% 65 339 0.00% 66 316 0.00% 67 337 0.00% 68 406 0.00% 69 447 0.00% 70 519 0.00% 71 647 0.00% 72 714 0.00% 73 755 0.00% 74 917 0.00% 75 971 0.00% 76 1285 0.01% 77 1373 0.01% 78 1398 0.01% 79 1596 0.01% 80 1821 0.01% 81 1963 0.01% 82 2171 0.01% 83 2565 0.01% 84 3358 0.02% 85 3991 0.02% 86 4200 0.02% 87 4607 0.02% 88 4880 0.02% 89 5166 0.02% 90 5619 0.03% 91 6228 0.03% 92 6771 0.03% 93 7074 0.03% 94 7799 0.04% 95 8139 0.04% 96 8789 0.04% 97 9754 0.05% 98 10072 0.05% 99 10926 0.05% 100 11769 0.06% 101 12559 0.06% 102 13216 0.06% 103 14052 0.07% 104 15083 0.07% 105 15729 0.07% 106 16727 0.08% 107 17121 0.08% 108 18059 0.09% 109 19187 0.09% 110 20452 0.10% 111 21354 0.10% 112 22632 0.11% 113 23360 0.11% 114 24324 0.12% 115 25894 0.12% 116 26864 0.13% 117 27820 0.13% 118 29143 0.14% 119 29900 0.14% 120 30819 0.15% 121 32212 0.15% 122 33172 0.16% 123 35124 0.17% 124 36896 0.18% 125 38273 0.18% 126 39443 0.19% 127 41353 0.20% 128 42390 0.20% 129 42702 0.20% 130 44548 0.21% 131 46290 0.22% 132 48178 0.23% 133 50608 0.24% 134 52225 0.25% 135 54656 0.26% 136 56953 0.27% 137 59500 0.28% 138 61979 0.29% 139 65014 0.31% 140 69271 0.33% 141 74224 0.35% 142 80920 0.38% 143 88406 0.42% 144 99097 0.47% 145 115730 0.55% 146 139139 0.66% 147 181887 0.86% 148 269330 1.28% 149 588375 2.80% 150 4108044 19.52% 151 13778419 65.48% 21040894 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=5.28 fanout-score-rank=13 prefix-density=0.67 prefix-fanout=3.7 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=69.11 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.0 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=32 prefix-density=0.41 prefix-fanout=2.5 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=65.21 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=11.0 sequence=CCGCCGCCGCCG SRR6958236 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:10:32 Started mapping on | Dec 06 17:10:32 Finished on | Dec 06 17:12:19 Mapping speed, Million of reads per hour | 707.92 Number of input reads | 21040894 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20588545 Uniquely mapped reads % | 97.85% Average mapped length | 296.45 Number of splices: Total | 23471173 Number of splices: Annotated (sjdb) | 22011952 Number of splices: GT/AG | 23155236 Number of splices: GC/AG | 273004 Number of splices: AT/AC | 9755 Number of splices: Non-canonical | 33178 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.48 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 202159 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 20575 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 259449 259449 259449 N_multimapping 202159 202159 202159 N_noFeature 817138 20015614 995780 N_ambiguous 477389 2937 83734 UnstrandedReadsAssigned:19294018 PositiveStrandReadsAssigned:569994 NegativeStrandReadsAssigned:19509031 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958236 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958236-trimmed-pair1.fastq SRR6958236-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,040,894 reads, 19,530,496 reads pseudoaligned [quant] estimated average fragment length: 274.11 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52973 SRR6958236.ke.tsv 35125 SRR6958236.se.tsv 88098 total ==> SRR6958236.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.353 0.0134477 0.00154892 PNS24247 1044 770.89 79.3147 7.86119 PNS24249 1928 1654.89 47.7196 2.2032 PNS24246 1044 770.89 79.3147 7.86119 PNS24248 1044 770.89 79.3147 7.86119 PNS24244 1471 1197.89 31.3227 1.99788 PNS24243 293 86.9805 0 0 KQK14069 1603 1329.89 2960.04 170.063 KQK14071 474 223.185 43.6282 14.9358 ==> SRR6958236.se.tsv <== BRADI_1g14170v3 3488 BRADI_1g53295v3 264 BRADI_1g59795v3 553 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 299 BRADI_1g74790v3 89 BRADI_1g09890v3 0 BRADI_1g77505v3 287 BRADI_1g48960v3 0 SRR6958236 completed mapping pipeline successfully