Starting /dee2/code/volunteer_pipeline.sh SRR6958237 current disk space = 1550651142144 free memory = 1604241480 SRR6958237 SRAfilesize 43dd60d149842f05ec72497ccd22d3e3 SRR6958237.sra SRR6958237.sra file validated SRR6958237 is paired end SRR6958237 is conventional basespace SRR6958237 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958237_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.29425 28.0 18.0 31.0 18.0 33.0 2 30.2195 31.0 29.0 33.0 27.0 33.0 3 30.185 31.0 29.0 33.0 25.0 33.0 4 31.582 33.0 32.0 33.0 30.0 33.0 5 32.5695 33.0 33.0 33.0 32.0 34.0 6 36.781 38.0 37.0 38.0 35.0 38.0 7 37.20325 38.0 38.0 38.0 36.0 38.0 8 37.2395 38.0 38.0 38.0 36.0 38.0 9 37.304 38.0 38.0 38.0 37.0 38.0 10-14 35.97305 37.8 35.6 38.0 31.2 38.0 15-19 37.49485 38.0 38.0 38.0 37.6 38.0 20-24 37.526349999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.46015 38.0 38.0 38.0 38.0 38.0 30-34 37.16875 38.0 38.0 38.0 36.8 38.0 35-39 37.38935 38.0 38.0 38.0 37.2 38.0 40-44 37.24205 38.0 38.0 38.0 36.8 38.0 45-49 36.7127 38.0 37.4 38.0 33.8 38.0 50-54 37.32765 38.0 38.0 38.0 36.8 38.0 55-59 37.29965 38.0 38.0 38.0 36.8 38.0 60-64 37.322649999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.28099999999999 38.0 38.0 38.0 36.6 38.0 70-74 37.30395 38.0 38.0 38.0 37.0 38.0 75-79 37.251549999999995 38.0 38.0 38.0 36.8 38.0 80-84 37.231 38.0 38.0 38.0 36.4 38.0 85-89 35.963699999999996 38.0 36.0 38.0 30.0 38.0 90-94 34.978899999999996 37.8 34.4 38.0 25.6 38.0 95-99 36.742549999999994 38.0 37.8 38.0 34.8 38.0 100-104 36.86965 38.0 38.0 38.0 35.0 38.0 105-109 36.881299999999996 38.0 38.0 38.0 35.0 38.0 110-114 36.739799999999995 38.0 38.0 38.0 34.8 38.0 115-119 36.574999999999996 38.0 38.0 38.0 34.2 38.0 120-124 36.443599999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.233050000000006 38.0 38.0 38.0 33.4 38.0 130-134 36.2005 38.0 38.0 38.0 33.4 38.0 135-139 36.0735 38.0 37.6 38.0 32.8 38.0 140-144 35.5654 38.0 36.0 38.0 32.0 38.0 145-149 33.59705 38.0 32.4 38.0 24.2 38.0 150-151 30.902499999999996 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 1.0 20 2.0 21 0.0 22 3.0 23 3.0 24 4.0 25 7.0 26 7.0 27 21.0 28 22.0 29 24.0 30 33.0 31 59.0 32 76.0 33 96.0 34 163.0 35 320.0 36 914.0 37 2240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.20512150509538 9.798798014110268 7.786778155212961 37.2093023255814 2 25.3 13.0 31.674999999999997 30.025000000000002 3 21.55 17.125 24.125 37.2 4 26.063031515757878 24.787393696848426 22.511255627813906 26.638319159579787 5 25.424999999999997 28.925 24.675 20.974999999999998 6 22.6 31.85 22.650000000000002 22.900000000000002 7 18.15 24.525 38.5 18.825 8 19.575 24.15 29.849999999999998 26.424999999999997 9 19.05 23.05 31.924999999999997 25.974999999999998 10-14 22.68 26.72 26.27 24.33 15-19 22.314999999999998 25.805 26.35 25.53 20-24 23.205000000000002 26.035000000000004 25.7 25.06 25-29 22.73 25.82 25.72 25.729999999999997 30-34 22.35 25.729999999999997 25.91 26.009999999999998 35-39 22.6 25.88 26.1 25.419999999999998 40-44 23.32 25.645 25.595000000000002 25.44 45-49 22.255 25.82 26.25 25.674999999999997 50-54 22.62 25.669999999999998 26.064999999999998 25.645 55-59 22.75 25.145 26.325 25.779999999999998 60-64 22.62 25.105 25.779999999999998 26.495 65-69 22.71 25.724999999999998 25.905 25.66 70-74 22.465 25.650000000000002 26.015 25.869999999999997 75-79 23.044999999999998 25.540000000000003 26.045 25.369999999999997 80-84 22.785 25.564999999999998 26.340000000000003 25.31 85-89 23.1 25.66 25.97 25.27 90-94 22.625 24.97 26.119999999999997 26.284999999999997 95-99 23.03 26.009999999999998 25.97 24.990000000000002 100-104 22.98 25.665 26.005 25.35 105-109 23.119999999999997 25.195 26.045 25.64 110-114 23.005 25.86 25.69 25.445 115-119 23.244999999999997 25.355 25.569999999999997 25.83 120-124 23.294999999999998 25.665 25.705 25.335 125-129 23.535 25.665 25.505 25.295 130-134 22.82 26.055 25.430000000000003 25.695 135-139 23.305 26.105 25.080000000000002 25.509999999999998 140-144 23.395 26.525 25.040000000000003 25.040000000000003 145-149 23.215 25.790000000000003 25.89 25.105 150-151 23.425 26.0125 25.674999999999997 24.887500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 1.5 29 2.5 30 5.0 31 8.0 32 12.5 33 19.5 34 29.5 35 42.5 36 56.5 37 64.0 38 72.5 39 100.0 40 141.0 41 167.5 42 193.5 43 212.5 44 210.0 45 204.0 46 194.0 47 194.0 48 198.5 49 184.5 50 179.5 51 170.5 52 139.5 53 123.0 54 109.0 55 98.0 56 86.0 57 86.0 58 85.5 59 67.0 60 57.5 61 51.5 62 53.5 63 56.5 64 54.5 65 49.5 66 41.0 67 39.5 68 32.0 69 23.5 70 20.5 71 15.0 72 11.0 73 9.5 74 8.5 75 6.5 76 3.5 77 2.5 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.324999999999999 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.7249999999999996 0.0 0.0 0.0 0.0 124-125 4.050000000000001 0.0 0.0 0.0 0.0 126-127 4.5625 0.0 0.0 0.0 0.0 128-129 5.1375 0.0 0.0 0.0 0.0 130-131 5.7375 0.0 0.0 0.0 0.0 132-133 6.3 0.0 0.0 0.0 0.0 134-135 6.949999999999999 0.0 0.0 0.0 0.0 136-137 7.4625 0.0 0.0 0.0 0.0 138-139 8.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958237 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958237_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6675 33.0 33.0 34.0 32.0 34.0 2 33.03525 33.0 33.0 34.0 32.0 34.0 3 33.09075 34.0 33.0 34.0 32.0 34.0 4 32.5615 34.0 33.0 34.0 32.0 34.0 5 32.99375 34.0 33.0 34.0 32.0 34.0 6 37.28025 38.0 38.0 38.0 37.0 38.0 7 37.2815 38.0 38.0 38.0 37.0 38.0 8 37.26425 38.0 38.0 38.0 37.0 38.0 9 37.25975 38.0 38.0 38.0 37.0 38.0 10-14 36.8907 38.0 37.8 38.0 35.4 38.0 15-19 37.16485 38.0 38.0 38.0 36.6 38.0 20-24 37.260949999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.21685 38.0 38.0 38.0 37.0 38.0 30-34 37.25715 38.0 38.0 38.0 37.0 38.0 35-39 36.88115 38.0 38.0 38.0 35.6 38.0 40-44 36.584450000000004 38.0 38.0 38.0 34.6 38.0 45-49 36.97055 38.0 38.0 38.0 36.0 38.0 50-54 36.80785 38.0 38.0 38.0 35.6 38.0 55-59 36.613099999999996 38.0 38.0 38.0 34.0 38.0 60-64 36.75515 38.0 38.0 38.0 35.2 38.0 65-69 36.57035 38.0 38.0 38.0 34.0 38.0 70-74 36.46875 38.0 37.8 38.0 34.0 38.0 75-79 36.901599999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.838049999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.724849999999996 38.0 38.0 38.0 35.2 38.0 90-94 34.797450000000005 38.0 35.2 38.0 26.8 38.0 95-99 36.29675 38.0 37.8 38.0 33.4 38.0 100-104 36.528949999999995 38.0 38.0 38.0 34.4 38.0 105-109 35.76989999999999 38.0 37.0 38.0 29.6 38.0 110-114 36.35 38.0 38.0 38.0 34.0 38.0 115-119 36.26965 38.0 38.0 38.0 34.0 38.0 120-124 35.941649999999996 38.0 37.8 38.0 32.8 38.0 125-129 35.57190000000001 38.0 37.0 38.0 31.0 38.0 130-134 35.40715 38.0 36.4 38.0 31.0 38.0 135-139 35.200149999999994 38.0 36.0 38.0 30.6 38.0 140-144 34.7909 38.0 36.0 38.0 29.4 38.0 145-149 32.85905 38.0 33.4 38.0 18.2 38.0 150-151 27.917 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 2.0 6 0.0 7 1.0 8 1.0 9 2.0 10 0.0 11 0.0 12 2.0 13 0.0 14 3.0 15 0.0 16 3.0 17 3.0 18 3.0 19 4.0 20 6.0 21 3.0 22 5.0 23 9.0 24 14.0 25 19.0 26 18.0 27 19.0 28 29.0 29 53.0 30 43.0 31 62.0 32 82.0 33 113.0 34 162.0 35 281.0 36 638.0 37 2414.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.125 18.05 10.15 31.674999999999997 2 28.925 23.724999999999998 28.775000000000002 18.575 3 22.400000000000002 25.324999999999996 28.65 23.625 4 25.624999999999996 31.15 20.75 22.475 5 26.25 33.85 19.575 20.325 6 22.125 36.9 21.0 19.975 7 23.150000000000002 18.625 35.65 22.575 8 23.724999999999998 23.5 25.224999999999998 27.55 9 24.15 23.150000000000002 27.675 25.025 10-14 25.314999999999998 26.965 23.64 24.08 15-19 25.474999999999998 25.83 24.565 24.13 20-24 24.975 26.465 24.85 23.71 25-29 25.545 26.035000000000004 24.41 24.01 30-34 25.555 25.115 25.455 23.875 35-39 25.430000000000003 25.525 24.69 24.355 40-44 25.71 25.91 24.525 23.855 45-49 25.88 25.505 24.98 23.635 50-54 25.25 26.009999999999998 25.06 23.68 55-59 25.61 25.974999999999998 24.955 23.46 60-64 25.605 26.115 25.275 23.005 65-69 26.135 26.56 24.3 23.005 70-74 26.465 25.35 24.915000000000003 23.27 75-79 25.83 25.264999999999997 25.535000000000004 23.369999999999997 80-84 25.915 25.96 24.855 23.27 85-89 26.235000000000003 25.85 24.85 23.064999999999998 90-94 25.924999999999997 25.385 25.03 23.66 95-99 25.97 26.195 24.62 23.215 100-104 25.66 26.165 24.9 23.275000000000002 105-109 25.990000000000002 26.43 24.73 22.85 110-114 25.735000000000003 26.405 25.03 22.830000000000002 115-119 26.169999999999998 26.265 24.6 22.965 120-124 26.314999999999998 26.729999999999997 24.51 22.445 125-129 26.56 26.290000000000003 24.884999999999998 22.264999999999997 130-134 26.935 26.155 24.89 22.02 135-139 26.985 26.705000000000002 24.365000000000002 21.945 140-144 26.805 26.724999999999998 24.404999999999998 22.065 145-149 27.139999999999997 26.915 24.455 21.490000000000002 150-151 27.250000000000004 26.8125 25.275 20.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 1.5 25 1.0 26 2.0 27 2.0 28 2.0 29 4.0 30 9.5 31 14.0 32 16.0 33 16.5 34 22.0 35 33.5 36 47.5 37 58.5 38 71.0 39 88.0 40 123.0 41 144.5 42 160.0 43 186.0 44 202.0 45 207.0 46 204.5 47 203.5 48 197.0 49 188.5 50 165.0 51 142.5 52 134.0 53 118.5 54 108.5 55 109.0 56 98.0 57 92.0 58 89.0 59 80.0 60 71.0 61 63.0 62 69.0 63 75.5 64 65.0 65 53.0 66 42.5 67 42.0 68 47.0 69 36.0 70 27.5 71 22.5 72 15.5 73 12.0 74 6.0 75 3.0 76 2.5 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47103274559194 98.725 2 0.42821158690176325 0.8500000000000001 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.025188916876574305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.7249999999999996 0.0 0.0 0.0 0.0 124-125 4.050000000000001 0.0 0.0 0.0 0.0 126-127 4.5625 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.7 0.0 0.0 0.0 0.0 132-133 6.25 0.0 0.0 0.0 0.0 134-135 6.9 0.0 0.0 0.0 0.0 136-137 7.4125 0.0 0.0 0.0 0.0 138-139 7.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGCAC 10 0.006830828 145.0 5 >>END_MODULE Read 1208491 spots for SRR6958237.sra Written 1208491 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra Read 1208475 spots for SRR6958237.sra Written 1208475 spots for SRR6958237.sra SRR ids: ['SRR6958237.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jss25upw SRR6958237.sra spots: 24169516 blocks: [[1, 1208475], [1208476, 2416950], [2416951, 3625425], [3625426, 4833900], [4833901, 6042375], [6042376, 7250850], [7250851, 8459325], [8459326, 9667800], [9667801, 10876275], [10876276, 12084750], [12084751, 13293225], [13293226, 14501700], [14501701, 15710175], [15710176, 16918650], [16918651, 18127125], [18127126, 19335600], [19335601, 20544075], [20544076, 21752550], [21752551, 22961025], [22961026, 24169516]] SRR6958237 file size 8168555 SRR6958237 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958237 SRR6958237_1.fastq SRR6958237_2.fastq Input file: SRR6958237_1.fastq Paired file: SRR6958237_2.fastq trimmed: SRR6958237-trimmed-pair1.fastq, SRR6958237-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:10:46 2024 >> started Fri Dec 6 17:11:13 2024 >> done (26.580s) 24169516 read pairs processed; of these: 24117 ( 0.10%) short read pairs filtered out after trimming by size control 25680 ( 0.11%) empty read pairs filtered out after trimming by size control 24119719 (99.79%) read pairs available; of these: 9300743 (38.56%) trimmed read pairs available after processing 14818976 (61.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 13 0.00% 20 7 0.00% 21 11 0.00% 22 15 0.00% 23 18 0.00% 24 21 0.00% 25 22 0.00% 26 11 0.00% 27 20 0.00% 28 12 0.00% 29 23 0.00% 30 23 0.00% 31 26 0.00% 32 13 0.00% 33 15 0.00% 34 21 0.00% 35 24 0.00% 36 21 0.00% 37 32 0.00% 38 27 0.00% 39 25 0.00% 40 43 0.00% 41 37 0.00% 42 53 0.00% 43 44 0.00% 44 51 0.00% 45 49 0.00% 46 65 0.00% 47 74 0.00% 48 69 0.00% 49 99 0.00% 50 118 0.00% 51 122 0.00% 52 128 0.00% 53 137 0.00% 54 164 0.00% 55 179 0.00% 56 173 0.00% 57 194 0.00% 58 253 0.00% 59 291 0.00% 60 318 0.00% 61 355 0.00% 62 410 0.00% 63 487 0.00% 64 500 0.00% 65 526 0.00% 66 596 0.00% 67 696 0.00% 68 845 0.00% 69 885 0.00% 70 1019 0.00% 71 1202 0.00% 72 1375 0.01% 73 1528 0.01% 74 1724 0.01% 75 1916 0.01% 76 2170 0.01% 77 2452 0.01% 78 2763 0.01% 79 3155 0.01% 80 3349 0.01% 81 3794 0.02% 82 4352 0.02% 83 5015 0.02% 84 6418 0.03% 85 7767 0.03% 86 8124 0.03% 87 8943 0.04% 88 9524 0.04% 89 10275 0.04% 90 10928 0.05% 91 11678 0.05% 92 12590 0.05% 93 13824 0.06% 94 14888 0.06% 95 15670 0.06% 96 16714 0.07% 97 18046 0.07% 98 19016 0.08% 99 20471 0.08% 100 21942 0.09% 101 22978 0.10% 102 24812 0.10% 103 26036 0.11% 104 27397 0.11% 105 28851 0.12% 106 30396 0.13% 107 31526 0.13% 108 33093 0.14% 109 34716 0.14% 110 36227 0.15% 111 37793 0.16% 112 40102 0.17% 113 41220 0.17% 114 43578 0.18% 115 45217 0.19% 116 46917 0.19% 117 48715 0.20% 118 50674 0.21% 119 51990 0.22% 120 53335 0.22% 121 55133 0.23% 122 57360 0.24% 123 59023 0.24% 124 61238 0.25% 125 63874 0.26% 126 66033 0.27% 127 67881 0.28% 128 68312 0.28% 129 70945 0.29% 130 73202 0.30% 131 74968 0.31% 132 78419 0.33% 133 81618 0.34% 134 83421 0.35% 135 87010 0.36% 136 90359 0.37% 137 93099 0.39% 138 96191 0.40% 139 100846 0.42% 140 106184 0.44% 141 111659 0.46% 142 120508 0.50% 143 130840 0.54% 144 145440 0.60% 145 166463 0.69% 146 195765 0.81% 147 250660 1.04% 148 359684 1.49% 149 675819 2.80% 150 4582211 19.00% 151 14818976 61.44% 24119719 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=5.50 fanout-score-rank=16 prefix-density=0.60 prefix-fanout=3.8 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=172.27 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.2 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=4.02 fanout-score-rank=23 prefix-density=0.35 prefix-fanout=3.4 sequence=GGCAAGACCATCACCCTTGAGGTGGAGTCATCTGACACCATCGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=76.50 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=13.0 sequence=GCCGCCGCCGCCA SRR6958237 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:12:02 Started mapping on | Dec 06 17:12:02 Finished on | Dec 06 17:14:55 Mapping speed, Million of reads per hour | 501.91 Number of input reads | 24119719 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 23322683 Uniquely mapped reads % | 96.70% Average mapped length | 293.84 Number of splices: Total | 26745839 Number of splices: Annotated (sjdb) | 25087825 Number of splices: GT/AG | 26375391 Number of splices: GC/AG | 303186 Number of splices: AT/AC | 11089 Number of splices: Non-canonical | 56173 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315147 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 8624 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 499000 499000 499000 N_multimapping 315147 315147 315147 N_noFeature 980007 22675993 1184108 N_ambiguous 526572 2799 85114 UnstrandedReadsAssigned:21816104 PositiveStrandReadsAssigned:643891 NegativeStrandReadsAssigned:22053461 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958237 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958237-trimmed-pair1.fastq SRR6958237-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,119,719 reads, 22,045,015 reads pseudoaligned [quant] estimated average fragment length: 254.114 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR6958237.ke.tsv 35125 SRR6958237.se.tsv 88098 total ==> SRR6958237.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.59 0 0 PNS24247 1044 790.886 80.7692 6.96931 PNS24249 1928 1674.89 71.9427 2.9313 PNS24246 1044 790.886 80.7692 6.96931 PNS24248 1044 790.886 80.7692 6.96931 PNS24244 1471 1217.89 68.7495 3.85231 PNS24243 293 96.8646 0 0 KQK14069 1603 1349.89 4189.28 211.787 KQK14071 474 240.854 94.8911 26.8862 ==> SRR6958237.se.tsv <== BRADI_1g14170v3 4847 BRADI_1g53295v3 2044 BRADI_1g59795v3 177 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 733 BRADI_1g74790v3 196 BRADI_1g09890v3 0 BRADI_1g77505v3 392 BRADI_1g48960v3 1 SRR6958237 completed mapping pipeline successfully