Starting /dee2/code/volunteer_pipeline.sh SRR6958238 current disk space = 1550636527616 free memory = 1601280984 SRR6958238 SRAfilesize b4d52b781dbd91583151754ba76bb752 SRR6958238.sra SRR6958238.sra file validated SRR6958238 is paired end SRR6958238 is conventional basespace SRR6958238 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958238_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.25925 18.0 18.0 30.0 18.0 32.0 2 25.15875 25.0 18.0 29.0 18.0 31.0 3 29.63025 31.0 29.0 33.0 25.0 33.0 4 30.97925 32.0 32.0 33.0 27.0 33.0 5 32.1745 33.0 32.0 33.0 31.0 33.0 6 36.80625 38.0 37.0 38.0 35.0 38.0 7 37.39625 38.0 38.0 38.0 37.0 38.0 8 37.49 38.0 38.0 38.0 37.0 38.0 9 37.227 38.0 38.0 38.0 37.0 38.0 10-14 37.40695 38.0 38.0 38.0 37.2 38.0 15-19 37.4311 38.0 38.0 38.0 37.4 38.0 20-24 37.3088 38.0 38.0 38.0 37.0 38.0 25-29 36.8698 38.0 38.0 38.0 35.4 38.0 30-34 36.907050000000005 38.0 37.8 38.0 35.0 38.0 35-39 37.23635 38.0 38.0 38.0 36.8 38.0 40-44 37.529250000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.58265 38.0 38.0 38.0 38.0 38.0 50-54 37.521950000000004 38.0 38.0 38.0 37.8 38.0 55-59 37.0822 38.0 38.0 38.0 36.0 38.0 60-64 36.97845 38.0 37.8 38.0 35.2 38.0 65-69 37.474450000000004 38.0 38.0 38.0 38.0 38.0 70-74 37.44304999999999 38.0 38.0 38.0 37.2 38.0 75-79 36.35885 38.0 37.2 38.0 32.6 38.0 80-84 36.71565 38.0 37.6 38.0 34.0 38.0 85-89 37.2699 38.0 38.0 38.0 36.6 38.0 90-94 37.3292 38.0 38.0 38.0 37.0 38.0 95-99 37.246249999999996 38.0 38.0 38.0 36.4 38.0 100-104 37.07375 38.0 38.0 38.0 36.0 38.0 105-109 37.0792 38.0 38.0 38.0 35.6 38.0 110-114 37.11995 38.0 38.0 38.0 35.8 38.0 115-119 36.943949999999994 38.0 38.0 38.0 35.0 38.0 120-124 36.61745 38.0 38.0 38.0 34.4 38.0 125-129 36.62195 38.0 38.0 38.0 34.6 38.0 130-134 35.8389 38.0 36.8 38.0 29.6 38.0 135-139 34.7519 38.0 35.2 38.0 25.8 38.0 140-144 35.61555 38.0 36.2 38.0 30.2 38.0 145-149 35.857800000000005 38.0 36.8 38.0 33.2 38.0 150-151 32.48725 35.5 33.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 0.0 21 2.0 22 2.0 23 2.0 24 2.0 25 8.0 26 5.0 27 7.0 28 13.0 29 24.0 30 40.0 31 50.0 32 54.0 33 92.0 34 119.0 35 292.0 36 829.0 37 2455.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.107387661843106 12.135059659812136 5.635948210205636 39.12160446813912 2 24.4 13.625000000000002 32.15 29.825000000000003 3 20.575 18.099999999999998 22.85 38.475 4 25.775 25.95 21.025 27.250000000000004 5 26.650000000000002 28.000000000000004 23.599999999999998 21.75 6 21.275 31.85 23.875 23.0 7 16.6 24.25 40.075 19.075 8 20.674999999999997 21.8 31.125000000000004 26.400000000000002 9 18.975 21.55 34.35 25.124999999999996 10-14 22.18 26.615 26.340000000000003 24.865000000000002 15-19 22.759999999999998 25.419999999999998 26.169999999999998 25.650000000000002 20-24 22.275 25.495 26.205000000000002 26.025 25-29 22.835 25.77 26.215 25.180000000000003 30-34 22.81 25.055 26.674999999999997 25.46 35-39 23.225 25.515 25.825 25.435000000000002 40-44 22.770000000000003 25.495 26.5 25.235000000000003 45-49 22.88 25.19 25.995 25.935000000000002 50-54 22.675 25.674999999999997 25.590000000000003 26.06 55-59 22.605 25.865 25.715 25.814999999999998 60-64 23.415 24.759999999999998 26.255 25.569999999999997 65-69 23.186159307965397 25.34126706335317 25.621281064053203 25.85129256462823 70-74 23.255 25.5 25.935000000000002 25.31 75-79 23.01 25.345000000000002 25.86 25.785000000000004 80-84 22.465 25.635 26.0 25.900000000000002 85-89 23.74 25.165 25.319999999999997 25.775 90-94 23.24 25.665 25.8 25.295 95-99 23.625 25.480000000000004 25.905 24.990000000000002 100-104 23.294999999999998 25.135 25.979999999999997 25.590000000000003 105-109 23.27 25.330000000000002 25.555 25.845000000000002 110-114 24.165 25.215 25.535000000000004 25.085 115-119 23.794999999999998 25.215 25.82 25.169999999999998 120-124 23.794999999999998 25.080000000000002 25.155 25.97 125-129 23.61 24.565 26.090000000000003 25.735000000000003 130-134 23.87 25.195 25.085 25.85 135-139 23.185 25.865 24.855 26.095000000000002 140-144 23.724999999999998 24.98 25.324999999999996 25.97 145-149 23.195 25.835 25.430000000000003 25.540000000000003 150-151 23.6125 25.0 24.3625 27.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 3.0 28 5.5 29 5.5 30 8.0 31 12.0 32 15.0 33 17.0 34 25.0 35 37.0 36 52.5 37 67.0 38 83.0 39 110.0 40 133.0 41 153.0 42 171.0 43 182.0 44 193.0 45 212.0 46 216.0 47 200.5 48 199.0 49 192.0 50 153.0 51 139.5 52 142.0 53 125.0 54 112.5 55 100.0 56 100.5 57 99.0 58 79.0 59 70.0 60 70.5 61 69.0 62 66.0 63 59.0 64 56.5 65 56.0 66 40.5 67 33.5 68 33.5 69 25.0 70 21.5 71 17.0 72 12.5 73 8.0 74 6.5 75 5.5 76 2.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26896899420217 98.45 2 0.6301991429291656 1.25 3 0.10083186286866651 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.7249999999999996 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.225 0.0 0.0 0.0 0.0 118-119 3.6375 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.5 0.0 0.0 0.0 0.0 124-125 5.0875 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.949999999999999 0.0 0.0 0.0 0.0 130-131 6.4125 0.0 0.0 0.0 0.0 132-133 6.9125 0.0 0.0 0.0 0.0 134-135 7.4 0.0 0.0 0.0 0.0 136-137 8.125 0.0 0.0 0.0 0.0 138-139 8.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTGGT 10 0.006832588 144.9875 7 TTGCTGG 10 0.006832588 144.9875 6 >>END_MODULE SRR6958238 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958238_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03825 33.0 33.0 34.0 32.0 34.0 2 33.1665 34.0 33.0 34.0 33.0 34.0 3 33.21 34.0 33.0 34.0 33.0 34.0 4 33.1305 34.0 33.0 34.0 33.0 34.0 5 33.05025 34.0 33.0 34.0 32.0 34.0 6 37.34625 38.0 38.0 38.0 37.0 38.0 7 37.42325 38.0 38.0 38.0 38.0 38.0 8 37.38975 38.0 38.0 38.0 38.0 38.0 9 37.37125 38.0 38.0 38.0 38.0 38.0 10-14 37.3159 38.0 38.0 38.0 37.6 38.0 15-19 37.3687 38.0 38.0 38.0 37.8 38.0 20-24 37.389149999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.329100000000004 38.0 38.0 38.0 37.6 38.0 30-34 37.3772 38.0 38.0 38.0 38.0 38.0 35-39 37.25135 38.0 38.0 38.0 37.2 38.0 40-44 36.89355 38.0 38.0 38.0 36.0 38.0 45-49 36.95055000000001 38.0 38.0 38.0 36.2 38.0 50-54 37.12905 38.0 38.0 38.0 36.8 38.0 55-59 37.28275 38.0 38.0 38.0 37.4 38.0 60-64 37.26039999999999 38.0 38.0 38.0 37.2 38.0 65-69 37.2181 38.0 38.0 38.0 37.0 38.0 70-74 37.224149999999995 38.0 38.0 38.0 37.2 38.0 75-79 37.19375 38.0 38.0 38.0 37.0 38.0 80-84 37.02285 38.0 38.0 38.0 36.8 38.0 85-89 36.896 38.0 38.0 38.0 36.0 38.0 90-94 36.8085 38.0 38.0 38.0 35.8 38.0 95-99 36.749849999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.72525 38.0 38.0 38.0 35.0 38.0 105-109 36.8706 38.0 38.0 38.0 35.8 38.0 110-114 36.58325000000001 38.0 38.0 38.0 34.6 38.0 115-119 36.597899999999996 38.0 38.0 38.0 35.0 38.0 120-124 36.386449999999996 38.0 38.0 38.0 34.2 38.0 125-129 36.1005 38.0 38.0 38.0 33.6 38.0 130-134 36.0866 38.0 38.0 38.0 33.8 38.0 135-139 35.76885 38.0 38.0 38.0 32.8 38.0 140-144 35.40535 38.0 37.4 38.0 31.0 38.0 145-149 35.0702 38.0 36.8 38.0 31.0 38.0 150-151 31.040625 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 2.0 11 1.0 12 2.0 13 0.0 14 2.0 15 0.0 16 3.0 17 1.0 18 4.0 19 1.0 20 3.0 21 12.0 22 2.0 23 6.0 24 5.0 25 10.0 26 13.0 27 16.0 28 21.0 29 21.0 30 34.0 31 37.0 32 56.0 33 75.0 34 99.0 35 193.0 36 392.0 37 2978.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.849999999999994 18.6 8.525 32.025 2 29.975 24.175 28.025 17.825 3 23.1 25.124999999999996 27.6 24.175 4 26.0 32.15 20.175 21.675 5 26.35 34.699999999999996 18.55 20.4 6 22.45 37.724999999999994 19.6 20.225 7 22.900000000000002 19.025 35.475 22.6 8 24.55 23.25 24.9 27.3 9 23.625 22.075 28.449999999999996 25.85 10-14 25.900000000000002 25.945 23.145 25.009999999999998 15-19 25.426271313565678 25.396269813490672 24.961248062403122 24.216210810540527 20-24 25.545 25.729999999999997 24.705 24.02 25-29 26.384999999999998 25.480000000000004 23.925 24.21 30-34 25.365 25.665 24.785 24.185000000000002 35-39 25.865 25.790000000000003 24.57 23.775 40-44 26.245 25.805 24.3 23.65 45-49 25.759999999999998 25.405 24.36 24.474999999999998 50-54 25.705 26.22 24.169999999999998 23.905 55-59 26.215 25.365 24.095 24.325 60-64 25.995 25.55 24.495 23.96 65-69 25.369999999999997 26.075 24.62 23.935000000000002 70-74 25.415 26.215 24.38 23.990000000000002 75-79 25.729999999999997 25.040000000000003 25.465 23.765 80-84 26.150000000000002 25.629999999999995 24.255 23.965 85-89 25.785000000000004 25.924999999999997 24.495 23.794999999999998 90-94 25.72 25.34 25.1 23.84 95-99 25.731286564328215 25.621281064053203 24.866243312165608 23.781189059452974 100-104 26.115 26.255 24.169999999999998 23.46 105-109 25.45 26.340000000000003 24.98 23.23 110-114 26.355 26.095000000000002 24.32 23.23 115-119 26.632663266326634 25.967596759675963 24.487448744874488 22.912291229122914 120-124 26.919999999999998 26.490000000000002 24.23 22.36 125-129 26.875 25.990000000000002 24.675 22.46 130-134 26.765 26.305 24.195 22.735 135-139 26.93 26.245 24.815 22.009999999999998 140-144 27.801390069503473 26.03130156507825 24.08120406020301 22.086104305215258 145-149 27.43 27.095000000000002 23.810000000000002 21.665 150-151 27.97849731216402 26.653331666458307 24.590573821727716 20.777597199649954 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 3.0 28 3.5 29 3.0 30 6.5 31 11.5 32 13.0 33 18.0 34 21.0 35 23.5 36 34.0 37 48.5 38 63.5 39 92.5 40 132.5 41 149.5 42 162.5 43 175.5 44 181.0 45 200.5 46 208.0 47 191.0 48 182.5 49 183.5 50 168.0 51 144.0 52 129.5 53 127.0 54 124.0 55 108.5 56 99.5 57 104.5 58 93.0 59 80.0 60 86.0 61 77.5 62 71.0 63 64.5 64 53.5 65 56.0 66 49.5 67 44.0 68 44.5 69 39.5 70 30.5 71 23.5 72 18.5 73 16.0 74 12.5 75 6.5 76 5.0 77 4.0 78 1.5 79 0.5 80 2.0 81 1.5 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19130654536265 98.125 2 0.5812484205205964 1.15 3 0.17690169320192065 0.525 4 0.050543340914834464 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.15 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 3.9 0.0 0.0 0.0 0.0 122-123 4.475 0.0 0.0 0.0 0.0 124-125 5.1 0.0 0.0 0.0 0.0 126-127 5.625 0.0 0.0 0.0 0.0 128-129 6.0625 0.0 0.0 0.0 0.0 130-131 6.5625 0.0 0.0 0.0 0.0 132-133 7.0625 0.0 0.0 0.0 0.0 134-135 7.6 0.0 0.0 0.0 0.0 136-137 8.399999999999999 0.0 0.0 0.0 0.0 138-139 9.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173277 spots for SRR6958238.sra Written 1173277 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra Read 1173259 spots for SRR6958238.sra Written 1173259 spots for SRR6958238.sra SRR ids: ['SRR6958238.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l7fbi6j2 SRR6958238.sra spots: 23465198 blocks: [[1, 1173259], [1173260, 2346518], [2346519, 3519777], [3519778, 4693036], [4693037, 5866295], [5866296, 7039554], [7039555, 8212813], [8212814, 9386072], [9386073, 10559331], [10559332, 11732590], [11732591, 12905849], [12905850, 14079108], [14079109, 15252367], [15252368, 16425626], [16425627, 17598885], [17598886, 18772144], [18772145, 19945403], [19945404, 21118662], [21118663, 22291921], [22291922, 23465198]] SRR6958238 file size 7929885 SRR6958238 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958238 SRR6958238_1.fastq SRR6958238_2.fastq Input file: SRR6958238_1.fastq Paired file: SRR6958238_2.fastq trimmed: SRR6958238-trimmed-pair1.fastq, SRR6958238-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:13:09 2024 >> started Fri Dec 6 17:13:36 2024 >> done (26.459s) 23465198 read pairs processed; of these: 16371 ( 0.07%) short read pairs filtered out after trimming by size control 16901 ( 0.07%) empty read pairs filtered out after trimming by size control 23431926 (99.86%) read pairs available; of these: 8748082 (37.33%) trimmed read pairs available after processing 14683844 (62.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 13 0.00% 21 14 0.00% 22 19 0.00% 23 11 0.00% 24 12 0.00% 25 14 0.00% 26 12 0.00% 27 16 0.00% 28 17 0.00% 29 14 0.00% 30 25 0.00% 31 20 0.00% 32 23 0.00% 33 20 0.00% 34 22 0.00% 35 22 0.00% 36 30 0.00% 37 27 0.00% 38 30 0.00% 39 31 0.00% 40 26 0.00% 41 40 0.00% 42 42 0.00% 43 51 0.00% 44 39 0.00% 45 63 0.00% 46 68 0.00% 47 84 0.00% 48 77 0.00% 49 93 0.00% 50 103 0.00% 51 113 0.00% 52 123 0.00% 53 133 0.00% 54 150 0.00% 55 191 0.00% 56 188 0.00% 57 223 0.00% 58 257 0.00% 59 303 0.00% 60 355 0.00% 61 385 0.00% 62 411 0.00% 63 487 0.00% 64 534 0.00% 65 552 0.00% 66 651 0.00% 67 717 0.00% 68 852 0.00% 69 933 0.00% 70 1101 0.00% 71 1230 0.01% 72 1350 0.01% 73 1655 0.01% 74 1761 0.01% 75 2068 0.01% 76 2349 0.01% 77 2645 0.01% 78 2943 0.01% 79 3213 0.01% 80 3628 0.02% 81 4150 0.02% 82 4637 0.02% 83 5191 0.02% 84 6576 0.03% 85 7470 0.03% 86 8119 0.03% 87 8700 0.04% 88 9513 0.04% 89 10174 0.04% 90 11024 0.05% 91 12060 0.05% 92 13047 0.06% 93 14142 0.06% 94 15660 0.07% 95 16260 0.07% 96 17449 0.07% 97 18943 0.08% 98 19851 0.08% 99 21482 0.09% 100 22926 0.10% 101 24326 0.10% 102 25952 0.11% 103 27889 0.12% 104 29365 0.13% 105 30920 0.13% 106 32517 0.14% 107 33455 0.14% 108 35512 0.15% 109 36931 0.16% 110 38626 0.16% 111 40465 0.17% 112 42349 0.18% 113 44091 0.19% 114 46070 0.20% 115 48617 0.21% 116 49862 0.21% 117 51798 0.22% 118 52803 0.23% 119 53738 0.23% 120 55776 0.24% 121 57446 0.25% 122 59875 0.26% 123 62379 0.27% 124 64279 0.27% 125 66819 0.29% 126 67681 0.29% 127 70197 0.30% 128 71530 0.31% 129 73022 0.31% 130 74803 0.32% 131 76429 0.33% 132 78962 0.34% 133 82093 0.35% 134 84218 0.36% 135 87377 0.37% 136 89728 0.38% 137 92136 0.39% 138 94047 0.40% 139 98654 0.42% 140 101421 0.43% 141 106116 0.45% 142 115985 0.49% 143 132266 0.56% 144 132524 0.57% 145 149249 0.64% 146 176039 0.75% 147 227888 0.97% 148 327297 1.40% 149 582477 2.49% 150 4164115 17.77% 151 14683844 62.67% 23431926 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=23 prefix-density=0.59 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=38.88 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=60.67 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=11.8 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958238 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:14:27 Started mapping on | Dec 06 17:14:27 Finished on | Dec 06 17:16:54 Mapping speed, Million of reads per hour | 573.84 Number of input reads | 23431926 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 22700187 Uniquely mapped reads % | 96.88% Average mapped length | 293.35 Number of splices: Total | 25898355 Number of splices: Annotated (sjdb) | 24292334 Number of splices: GT/AG | 25534330 Number of splices: GC/AG | 300607 Number of splices: AT/AC | 10254 Number of splices: Non-canonical | 53164 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 292840 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 11901 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451087 451087 451087 N_multimapping 292840 292840 292840 N_noFeature 903777 22022705 1095921 N_ambiguous 570122 2801 85994 UnstrandedReadsAssigned:21226288 PositiveStrandReadsAssigned:674681 NegativeStrandReadsAssigned:21518272 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958238 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958238-trimmed-pair1.fastq SRR6958238-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,431,926 reads, 21,539,393 reads pseudoaligned [quant] estimated average fragment length: 247.428 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR6958238.ke.tsv 35125 SRR6958238.se.tsv 88098 total ==> SRR6958238.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.076 0 0 PNS24247 1044 797.572 60.0821 5.19021 PNS24249 1928 1681.57 71.2897 2.92094 PNS24246 1044 797.572 60.0821 5.19021 PNS24248 1044 797.572 60.0821 5.19021 PNS24244 1471 1224.57 54.4641 3.06434 PNS24243 293 98.6025 0 0 KQK14069 1603 1356.57 3542.71 179.93 KQK14071 474 244.577 68.7482 19.3668 ==> SRR6958238.se.tsv <== BRADI_1g14170v3 4096 BRADI_1g53295v3 1742 BRADI_1g59795v3 204 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 582 BRADI_1g74790v3 131 BRADI_1g09890v3 1 BRADI_1g77505v3 346 BRADI_1g48960v3 0 SRR6958238 completed mapping pipeline successfully