Starting /dee2/code/volunteer_pipeline.sh SRR6958239 current disk space = 1550585638912 free memory = 1600348116 SRR6958239 SRAfilesize 6f6c1c36a182776d846fb100b2d1a18a SRR6958239.sra SRR6958239.sra file validated SRR6958239 is paired end SRR6958239 is conventional basespace SRR6958239 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958239_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.14475 32.0 27.0 33.0 18.0 33.0 2 26.3525 28.0 18.0 31.0 18.0 33.0 3 29.47975 31.0 28.0 33.0 25.0 33.0 4 30.29 32.0 31.0 33.0 25.0 33.0 5 31.788 33.0 32.0 33.0 30.0 33.0 6 36.3835 38.0 36.0 38.0 34.0 38.0 7 36.62075 38.0 37.0 38.0 34.0 38.0 8 36.99225 38.0 38.0 38.0 35.0 38.0 9 37.2465 38.0 38.0 38.0 36.0 38.0 10-14 37.36030000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.306 38.0 38.0 38.0 36.8 38.0 20-24 37.41305 38.0 38.0 38.0 37.0 38.0 25-29 37.30395 38.0 38.0 38.0 37.0 38.0 30-34 37.25305 38.0 38.0 38.0 36.6 38.0 35-39 37.04645 38.0 38.0 38.0 36.0 38.0 40-44 36.971450000000004 38.0 38.0 38.0 35.8 38.0 45-49 37.14805 38.0 38.0 38.0 36.0 38.0 50-54 36.96075 38.0 38.0 38.0 35.4 38.0 55-59 36.7768 38.0 38.0 38.0 34.6 38.0 60-64 36.806050000000006 38.0 38.0 38.0 35.0 38.0 65-69 36.965 38.0 38.0 38.0 35.2 38.0 70-74 36.9223 38.0 38.0 38.0 35.0 38.0 75-79 36.7431 38.0 38.0 38.0 34.6 38.0 80-84 36.5043 38.0 38.0 38.0 34.0 38.0 85-89 36.366350000000004 38.0 37.6 38.0 33.6 38.0 90-94 36.44395 38.0 38.0 38.0 33.8 38.0 95-99 36.4947 38.0 38.0 38.0 34.0 38.0 100-104 36.268550000000005 38.0 37.0 38.0 33.2 38.0 105-109 35.9378 38.0 37.0 38.0 32.6 38.0 110-114 35.801300000000005 38.0 36.4 38.0 31.2 38.0 115-119 35.69315 38.0 36.0 38.0 31.2 38.0 120-124 35.40955 38.0 35.8 38.0 30.2 38.0 125-129 35.10135 38.0 35.0 38.0 28.2 38.0 130-134 35.00045 38.0 35.0 38.0 28.2 38.0 135-139 34.682550000000006 38.0 35.0 38.0 27.6 38.0 140-144 34.2663 38.0 34.6 38.0 25.2 38.0 145-149 33.2791 38.0 34.0 38.0 19.0 38.0 150-151 28.91075 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 0.0 20 2.0 21 6.0 22 3.0 23 2.0 24 14.0 25 13.0 26 15.0 27 22.0 28 36.0 29 50.0 30 51.0 31 66.0 32 105.0 33 135.0 34 230.0 35 414.0 36 935.0 37 1895.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.19003595274781 8.320493066255779 8.371854134566 43.11761684643041 2 26.0 12.1 34.775 27.125 3 20.575 13.8 25.724999999999998 39.900000000000006 4 26.775 19.825 22.25 31.15 5 26.125 27.700000000000003 24.6 21.575 6 24.2 30.8 22.775000000000002 22.225 7 19.900000000000002 24.7 36.0 19.400000000000002 8 21.45 23.150000000000002 30.3 25.1 9 21.525 20.025000000000002 33.675 24.775 10-14 22.405 25.945 25.945 25.705 15-19 23.26 25.155 25.685000000000002 25.900000000000002 20-24 23.135 25.224999999999998 26.0 25.64 25-29 23.53 24.44 26.340000000000003 25.69 30-34 23.615 24.94 25.669999999999998 25.775 35-39 23.28 24.85 25.624999999999996 26.245 40-44 23.685000000000002 24.715 25.85 25.75 45-49 23.515 24.474999999999998 25.915 26.095000000000002 50-54 23.45 24.775 25.72 26.055 55-59 24.224999999999998 24.62 25.35 25.805 60-64 23.665 24.41 25.835 26.090000000000003 65-69 23.645 24.685000000000002 25.655 26.015 70-74 24.335 24.895 24.88 25.89 75-79 23.64 24.705 25.5 26.155 80-84 23.655 24.645 25.874999999999996 25.825 85-89 23.91 24.58 25.735000000000003 25.775 90-94 24.075 24.21 25.665 26.05 95-99 23.985 24.545 25.374999999999996 26.095000000000002 100-104 24.375 24.545 25.28 25.8 105-109 24.196209810490522 24.566228311415568 25.29126456322816 25.946297314865742 110-114 23.89 24.055 25.645 26.41 115-119 24.485 23.97 25.264999999999997 26.279999999999998 120-124 24.05 24.41 25.165 26.375 125-129 23.919999999999998 24.18 25.135 26.765 130-134 24.349999999999998 24.795 24.415 26.44 135-139 24.15 24.4 25.705 25.745 140-144 24.3 24.515 25.355 25.83 145-149 24.654999999999998 24.25 24.84 26.255 150-151 24.090511313914238 24.028003500437556 25.740717589698715 26.140767595949495 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.5 26 1.0 27 1.0 28 0.5 29 2.0 30 6.5 31 10.5 32 10.5 33 15.5 34 25.0 35 32.0 36 36.0 37 50.5 38 77.0 39 91.5 40 128.0 41 161.5 42 177.0 43 191.0 44 195.0 45 197.0 46 212.0 47 208.5 48 182.0 49 166.0 50 144.0 51 128.0 52 118.0 53 108.0 54 101.0 55 96.5 56 91.0 57 93.5 58 90.0 59 77.5 60 83.5 61 86.5 62 82.5 63 78.0 64 67.0 65 59.0 66 47.5 67 42.5 68 42.5 69 37.5 70 31.0 71 27.0 72 24.5 73 18.0 74 12.0 75 10.0 76 8.0 77 5.0 78 3.5 79 3.0 80 2.5 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98913318170331 97.925 2 0.960323477381855 1.9 3 0.025271670457417232 0.075 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7375 0.0 0.0 0.0 0.0 128-129 1.9249999999999998 0.0 0.0 0.0 0.0 130-131 2.025 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958239 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958239_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87575 33.0 33.0 34.0 32.0 34.0 2 32.82975 33.0 33.0 34.0 32.0 34.0 3 32.92475 33.0 33.0 34.0 32.0 34.0 4 32.89 34.0 33.0 34.0 32.0 34.0 5 32.73825 33.0 33.0 34.0 32.0 34.0 6 37.037 38.0 38.0 38.0 36.0 38.0 7 36.95075 38.0 38.0 38.0 36.0 38.0 8 36.94075 38.0 38.0 38.0 36.0 38.0 9 36.92225 38.0 38.0 38.0 36.0 38.0 10-14 36.9244 38.0 38.0 38.0 35.8 38.0 15-19 36.79345 38.0 38.0 38.0 35.2 38.0 20-24 36.87285000000001 38.0 38.0 38.0 35.6 38.0 25-29 36.917249999999996 38.0 38.0 38.0 35.8 38.0 30-34 36.98315 38.0 38.0 38.0 36.0 38.0 35-39 36.917950000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.83245 38.0 38.0 38.0 35.4 38.0 45-49 36.756449999999994 38.0 38.0 38.0 35.0 38.0 50-54 36.6606 38.0 38.0 38.0 34.6 38.0 55-59 36.744299999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.68345 38.0 38.0 38.0 34.8 38.0 65-69 36.533699999999996 38.0 38.0 38.0 34.0 38.0 70-74 36.37695 38.0 38.0 38.0 33.6 38.0 75-79 36.18685 38.0 38.0 38.0 33.2 38.0 80-84 36.012649999999994 38.0 37.2 38.0 32.2 38.0 85-89 35.8962 38.0 37.0 38.0 31.4 38.0 90-94 35.8702 38.0 37.0 38.0 32.4 38.0 95-99 35.679050000000004 38.0 37.0 38.0 31.0 38.0 100-104 35.478899999999996 38.0 36.2 38.0 30.4 38.0 105-109 35.25664999999999 38.0 36.0 38.0 29.2 38.0 110-114 35.0138 38.0 35.6 38.0 28.0 38.0 115-119 34.77815 38.0 35.0 38.0 27.0 38.0 120-124 34.76755 38.0 35.0 38.0 27.2 38.0 125-129 34.427550000000004 38.0 34.8 38.0 25.2 38.0 130-134 34.089150000000004 38.0 34.4 38.0 23.2 38.0 135-139 33.4773 38.0 34.0 38.0 21.0 38.0 140-144 33.28439999999999 38.0 33.8 38.0 17.2 38.0 145-149 32.262 38.0 32.4 38.0 13.4 38.0 150-151 26.932625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 1.0 5 2.0 6 0.0 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 2.0 13 4.0 14 1.0 15 5.0 16 2.0 17 3.0 18 4.0 19 7.0 20 9.0 21 12.0 22 13.0 23 16.0 24 9.0 25 24.0 26 19.0 27 33.0 28 30.0 29 63.0 30 57.0 31 98.0 32 114.0 33 162.0 34 224.0 35 376.0 36 756.0 37 1945.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.574999999999996 17.4 11.55 38.475 2 29.375 23.075000000000003 27.900000000000002 19.650000000000002 3 22.55563890972743 25.206301575393848 28.307076769192296 23.93098274568642 4 25.93148287071768 28.707176794198553 20.7551887971993 24.60615153788447 5 27.60690172543136 31.43285821455364 20.05501375343836 20.905226306576644 6 21.8 36.125 21.625 20.45 7 22.775000000000002 20.0 32.7 24.525 8 24.125 23.45 24.175 28.249999999999996 9 23.724999999999998 23.25 28.15 24.875 10-14 26.169999999999998 25.415 23.200000000000003 25.215 15-19 25.46 25.435000000000002 24.08 25.025 20-24 25.490000000000002 25.724999999999998 24.21 24.575 25-29 26.52 25.155 24.135 24.19 30-34 25.5 25.455 24.175 24.87 35-39 25.369999999999997 25.7 24.015 24.915000000000003 40-44 26.56 25.324999999999996 23.64 24.474999999999998 45-49 25.96 24.735 24.01 25.295 50-54 26.38 25.025 23.84 24.755 55-59 26.284999999999997 25.71 23.715 24.29 60-64 25.825 25.285000000000004 24.5 24.39 65-69 26.355 24.959999999999997 23.98 24.705 70-74 25.874999999999996 25.264999999999997 23.86 25.0 75-79 25.22 25.174999999999997 24.315 25.290000000000003 80-84 26.064999999999998 25.290000000000003 24.11 24.535 85-89 26.83 24.55 24.54 24.08 90-94 25.874999999999996 25.480000000000004 23.65 24.995 95-99 25.865 25.05 24.404999999999998 24.68 100-104 25.97 25.11 24.11 24.81 105-109 26.490000000000002 25.115 24.135 24.26 110-114 26.525 25.14 24.099999999999998 24.235 115-119 26.48132406620331 25.391269563478176 24.32621631081554 23.801190059502975 120-124 26.16 25.505 23.73 24.605 125-129 27.0 25.0 23.84 24.16 130-134 27.29 25.14 23.525 24.044999999999998 135-139 26.39 25.814999999999998 24.15 23.645 140-144 26.529999999999998 25.52 24.005000000000003 23.945 145-149 26.745 25.759999999999998 23.34 24.154999999999998 150-151 26.56582072759095 25.715714464308036 23.215401925240656 24.50306288286036 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 0.5 28 2.0 29 4.5 30 5.0 31 7.0 32 10.5 33 11.0 34 13.0 35 24.0 36 40.5 37 51.5 38 72.0 39 86.5 40 103.0 41 140.0 42 156.5 43 161.5 44 174.0 45 179.0 46 186.0 47 187.0 48 173.5 49 165.0 50 157.0 51 148.0 52 134.5 53 123.5 54 111.0 55 99.5 56 95.0 57 101.5 58 99.0 59 95.5 60 104.5 61 95.5 62 97.0 63 90.0 64 73.0 65 71.5 66 63.5 67 58.5 68 53.0 69 44.0 70 35.5 71 25.5 72 23.0 73 16.5 74 7.5 75 5.5 76 4.0 77 2.5 78 2.0 79 3.0 80 2.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47133757961784 96.625 2 1.2484076433121019 2.45 3 0.17834394904458598 0.525 4 0.1019108280254777 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.575 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 1.975 0.0 0.0 0.0 0.0 130-131 2.0625 0.0 0.0 0.0 0.0 132-133 2.3499999999999996 0.0 0.0 0.0 0.0 134-135 2.6500000000000004 0.0 0.0 0.0 0.0 136-137 2.8625 0.0 0.0 0.0 0.0 138-139 3.0250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTGCT 10 0.006830828 145.0 145 GCCGGAG 10 0.006830828 145.0 5 ATTCAAC 10 0.006830828 145.0 4 >>END_MODULE Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Read 1047623 spots for SRR6958239.sra Written 1047623 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra Read 1047622 spots for SRR6958239.sra Written 1047622 spots for SRR6958239.sra SRR ids: ['SRR6958239.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8impnywx SRR6958239.sra spots: 20952441 blocks: [[1, 1047622], [1047623, 2095244], [2095245, 3142866], [3142867, 4190488], [4190489, 5238110], [5238111, 6285732], [6285733, 7333354], [7333355, 8380976], [8380977, 9428598], [9428599, 10476220], [10476221, 11523842], [11523843, 12571464], [12571465, 13619086], [13619087, 14666708], [14666709, 15714330], [15714331, 16761952], [16761953, 17809574], [17809575, 18857196], [18857197, 19904818], [19904819, 20952441]] SRR6958239 file size 7078394 SRR6958239 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958239 SRR6958239_1.fastq SRR6958239_2.fastq Input file: SRR6958239_1.fastq Paired file: SRR6958239_2.fastq trimmed: SRR6958239-trimmed-pair1.fastq, SRR6958239-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:18:53 2024 >> started Fri Dec 6 17:19:15 2024 >> done (21.478s) 20952441 read pairs processed; of these: 12514 ( 0.06%) short read pairs filtered out after trimming by size control 9552 ( 0.05%) empty read pairs filtered out after trimming by size control 20930375 (99.89%) read pairs available; of these: 8033608 (38.38%) trimmed read pairs available after processing 12896767 (61.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 7 0.00% 22 2 0.00% 23 3 0.00% 24 6 0.00% 25 8 0.00% 26 4 0.00% 27 3 0.00% 28 9 0.00% 29 12 0.00% 30 9 0.00% 31 9 0.00% 32 8 0.00% 33 7 0.00% 34 11 0.00% 35 13 0.00% 36 17 0.00% 37 12 0.00% 38 12 0.00% 39 13 0.00% 40 16 0.00% 41 14 0.00% 42 15 0.00% 43 16 0.00% 44 25 0.00% 45 22 0.00% 46 16 0.00% 47 26 0.00% 48 29 0.00% 49 33 0.00% 50 35 0.00% 51 37 0.00% 52 36 0.00% 53 43 0.00% 54 67 0.00% 55 68 0.00% 56 55 0.00% 57 74 0.00% 58 88 0.00% 59 103 0.00% 60 105 0.00% 61 131 0.00% 62 141 0.00% 63 147 0.00% 64 184 0.00% 65 188 0.00% 66 221 0.00% 67 206 0.00% 68 270 0.00% 69 263 0.00% 70 293 0.00% 71 327 0.00% 72 386 0.00% 73 436 0.00% 74 497 0.00% 75 573 0.00% 76 590 0.00% 77 714 0.00% 78 759 0.00% 79 875 0.00% 80 937 0.00% 81 1085 0.01% 82 1195 0.01% 83 1417 0.01% 84 2029 0.01% 85 2493 0.01% 86 2595 0.01% 87 2661 0.01% 88 2967 0.01% 89 3097 0.01% 90 3348 0.02% 91 3524 0.02% 92 3710 0.02% 93 3964 0.02% 94 4365 0.02% 95 4636 0.02% 96 4961 0.02% 97 5445 0.03% 98 5824 0.03% 99 6199 0.03% 100 6529 0.03% 101 7105 0.03% 102 7408 0.04% 103 7920 0.04% 104 8478 0.04% 105 8769 0.04% 106 9661 0.05% 107 10344 0.05% 108 10728 0.05% 109 11763 0.06% 110 12336 0.06% 111 12890 0.06% 112 13665 0.07% 113 14496 0.07% 114 15435 0.07% 115 16352 0.08% 116 17246 0.08% 117 18214 0.09% 118 19581 0.09% 119 20417 0.10% 120 21206 0.10% 121 22528 0.11% 122 23195 0.11% 123 24438 0.12% 124 25646 0.12% 125 27396 0.13% 126 28732 0.14% 127 30334 0.14% 128 31795 0.15% 129 33549 0.16% 130 35487 0.17% 131 37562 0.18% 132 40394 0.19% 133 42994 0.21% 134 45112 0.22% 135 47841 0.23% 136 51620 0.25% 137 54727 0.26% 138 59027 0.28% 139 64611 0.31% 140 70198 0.34% 141 76673 0.37% 142 86547 0.41% 143 99137 0.47% 144 115549 0.55% 145 141606 0.68% 146 178248 0.85% 147 247925 1.18% 148 390760 1.87% 149 817850 3.91% 150 4736834 22.63% 151 12896767 61.62% 20930375 reads passed initial QC criterion=sequence-density sequence-density=1.17 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=18 prefix-density=1.21 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=33.93 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=14 prefix-density=0.91 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=57.82 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.5 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958239 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:19:55 Started mapping on | Dec 06 17:19:55 Finished on | Dec 06 17:21:27 Mapping speed, Million of reads per hour | 819.01 Number of input reads | 20930375 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20630340 Uniquely mapped reads % | 98.57% Average mapped length | 297.55 Number of splices: Total | 23913121 Number of splices: Annotated (sjdb) | 22578173 Number of splices: GT/AG | 23595882 Number of splices: GC/AG | 283070 Number of splices: AT/AC | 8434 Number of splices: Non-canonical | 25735 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.53 Insertion rate per base | 0.01% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 152968 % of reads mapped to multiple loci | 0.73% Number of reads mapped to too many loci | 8460 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 154399 154399 154399 N_multimapping 152968 152968 152968 N_noFeature 568426 20019041 735042 N_ambiguous 528157 2750 84607 UnstrandedReadsAssigned:19533757 PositiveStrandReadsAssigned:608549 NegativeStrandReadsAssigned:19810691 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958239 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958239-trimmed-pair1.fastq SRR6958239-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,930,375 reads, 19,781,265 reads pseudoaligned [quant] estimated average fragment length: 270.885 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 SRR6958239.ke.tsv 35125 SRR6958239.se.tsv 88098 total ==> SRR6958239.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.67 0 0 PNS24247 1044 774.115 50.0255 4.66448 PNS24249 1928 1658.11 39.4828 1.71874 PNS24246 1044 774.115 50.0255 4.66448 PNS24248 1044 774.115 50.0255 4.66448 PNS24244 1471 1201.11 9.44077 0.567337 PNS24243 293 79.0121 0 0 KQK14069 1603 1333.11 8112.4 439.237 KQK14071 474 218.928 113.563 37.4415 ==> SRR6958239.se.tsv <== BRADI_1g14170v3 8931 BRADI_1g53295v3 107 BRADI_1g59795v3 272 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 256 BRADI_1g74790v3 77 BRADI_1g09890v3 1 BRADI_1g77505v3 187 BRADI_1g48960v3 0 SRR6958239 completed mapping pipeline successfully