Starting /dee2/code/volunteer_pipeline.sh SRR6958240 current disk space = 1550630395904 free memory = 1599075500 SRR6958240 SRAfilesize 63ebcd23b79b5e1a9f52642c5e55cf06 SRR6958240.sra SRR6958240.sra file validated SRR6958240 is paired end SRR6958240 is conventional basespace SRR6958240 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958240_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.397 32.0 18.0 33.0 18.0 33.0 2 28.607 29.0 27.0 33.0 18.0 33.0 3 30.68525 31.0 29.0 33.0 27.0 33.0 4 32.32875 33.0 32.0 33.0 32.0 33.0 5 32.88625 33.0 33.0 33.0 32.0 34.0 6 37.12675 38.0 37.0 38.0 36.0 38.0 7 37.44425 38.0 38.0 38.0 37.0 38.0 8 37.54875 38.0 38.0 38.0 38.0 38.0 9 37.643 38.0 38.0 38.0 38.0 38.0 10-14 37.232350000000004 38.0 38.0 38.0 36.0 38.0 15-19 36.0366 38.0 35.4 38.0 31.2 38.0 20-24 35.96975 38.0 36.2 38.0 29.6 38.0 25-29 37.52985 38.0 38.0 38.0 37.6 38.0 30-34 37.608 38.0 38.0 38.0 38.0 38.0 35-39 37.55135 38.0 38.0 38.0 38.0 38.0 40-44 37.6191 38.0 38.0 38.0 38.0 38.0 45-49 37.625800000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.63399999999999 38.0 38.0 38.0 38.0 38.0 55-59 37.4868 38.0 38.0 38.0 38.0 38.0 60-64 37.5021 38.0 38.0 38.0 38.0 38.0 65-69 37.5104 38.0 38.0 38.0 38.0 38.0 70-74 37.450100000000006 38.0 38.0 38.0 37.6 38.0 75-79 36.7959 38.0 37.8 38.0 34.6 38.0 80-84 37.35835 38.0 38.0 38.0 37.0 38.0 85-89 37.3454 38.0 38.0 38.0 37.0 38.0 90-94 36.704449999999994 38.0 37.8 38.0 34.4 38.0 95-99 37.171800000000005 38.0 38.0 38.0 36.6 38.0 100-104 37.18105 38.0 38.0 38.0 36.2 38.0 105-109 37.1083 38.0 38.0 38.0 36.0 38.0 110-114 37.106300000000005 38.0 38.0 38.0 36.0 38.0 115-119 36.8997 38.0 38.0 38.0 35.4 38.0 120-124 36.6083 38.0 38.0 38.0 34.6 38.0 125-129 36.63775 38.0 38.0 38.0 34.6 38.0 130-134 36.58 38.0 38.0 38.0 34.4 38.0 135-139 36.485949999999995 38.0 38.0 38.0 34.2 38.0 140-144 36.2803 38.0 38.0 38.0 34.0 38.0 145-149 35.92405 38.0 38.0 38.0 33.0 38.0 150-151 32.337125 35.5 33.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 3.0 18 1.0 19 1.0 20 0.0 21 4.0 22 1.0 23 4.0 24 2.0 25 2.0 26 8.0 27 9.0 28 12.0 29 20.0 30 27.0 31 24.0 32 49.0 33 51.0 34 96.0 35 200.0 36 652.0 37 2829.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.013204672422546 11.503301168105637 6.399187404773997 36.08430675469781 2 26.25 13.05 31.25 29.45 3 21.65 18.075 23.425 36.85 4 25.624999999999996 24.675 22.325 27.375 5 26.5 30.225 22.2 21.075 6 23.1807951987997 32.958239559889975 22.18054513628407 21.680420105026258 7 17.675 23.3 39.900000000000006 19.125 8 20.075000000000003 23.150000000000002 29.75 27.025 9 19.950000000000003 20.9 32.875 26.275 10-14 22.855 25.955000000000002 26.290000000000003 24.9 15-19 23.465 24.87 26.465 25.2 20-24 22.96 25.840000000000003 25.929999999999996 25.27 25-29 22.775000000000002 25.44 25.845000000000002 25.94 30-34 22.95229522952295 25.93259325932593 25.28252825282528 25.83258325832583 35-39 23.912391239123913 24.977497749774976 25.76757675767577 25.34253425342534 40-44 23.415 25.564999999999998 25.679999999999996 25.34 45-49 22.919999999999998 25.145 25.765 26.169999999999998 50-54 23.13 25.025 26.040000000000003 25.805 55-59 23.45 25.419999999999998 25.845000000000002 25.285000000000004 60-64 23.815 24.63 26.035000000000004 25.52 65-69 23.807380738073807 25.332533253325334 25.467546754675467 25.392539253925396 70-74 23.432343234323433 25.312531253125314 25.402540254025403 25.85258525852585 75-79 24.01 25.0 25.465 25.525 80-84 23.527352735273528 25.107510751075107 25.722572257225725 25.642564256425644 85-89 23.82 25.15 25.009999999999998 26.02 90-94 23.865 25.124999999999996 25.295 25.715 95-99 23.99239923992399 25.317531753175317 25.302530253025303 25.38753875387539 100-104 23.74 24.855 25.715 25.69 105-109 23.381169058452922 24.951247562378118 26.136306815340767 25.531276563828193 110-114 23.376168808440422 25.186259312965646 25.52127606380319 25.91629581479074 115-119 24.292429242924293 25.197519751975193 25.05750575057506 25.452545254525454 120-124 23.945 25.569999999999997 25.035 25.45 125-129 24.342434243424343 25.027502750275026 24.842484248424842 25.78757875787579 130-134 24.099999999999998 25.495 25.080000000000002 25.324999999999996 135-139 23.93 25.569999999999997 25.47 25.03 140-144 23.93 24.77 24.935 26.365 145-149 23.93 25.705 24.485 25.88 150-151 25.174999999999997 24.2625 24.637500000000003 25.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 1.5 28 1.5 29 3.0 30 5.0 31 11.0 32 17.0 33 18.5 34 26.0 35 38.0 36 57.0 37 66.5 38 72.0 39 102.5 40 129.5 41 148.5 42 175.0 43 190.0 44 200.0 45 193.5 46 194.0 47 194.0 48 180.5 49 175.0 50 170.0 51 168.5 52 137.5 53 99.5 54 92.5 55 97.5 56 100.5 57 92.5 58 81.5 59 79.5 60 71.5 61 68.5 62 70.0 63 71.5 64 68.0 65 58.5 66 53.5 67 42.5 68 31.0 69 27.5 70 26.5 71 19.5 72 12.5 73 15.0 74 15.5 75 10.5 76 5.5 77 3.0 78 3.0 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.005 110-114 0.005 115-119 0.01 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 2.0875000000000004 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.6375 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.574999999999999 0.0 0.0 0.0 0.0 134-135 5.125 0.0 0.0 0.0 0.0 136-137 5.550000000000001 0.0 0.0 0.0 0.0 138-139 6.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCGT 10 0.006830828 145.0 5 GATGTGC 10 0.006830828 145.0 6 ACCGTGG 10 0.006830828 145.0 7 GAATTCG 10 0.006830828 145.0 4 >>END_MODULE SRR6958240 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958240_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7875 33.0 33.0 34.0 32.0 34.0 2 33.0465 33.0 33.0 34.0 32.0 34.0 3 33.1845 34.0 33.0 34.0 33.0 34.0 4 33.2155 34.0 33.0 34.0 33.0 34.0 5 31.80375 33.0 33.0 34.0 28.0 34.0 6 37.10675 38.0 38.0 38.0 36.0 38.0 7 37.31625 38.0 38.0 38.0 37.0 38.0 8 37.37375 38.0 38.0 38.0 37.0 38.0 9 37.42 38.0 38.0 38.0 38.0 38.0 10-14 37.43319999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.46130000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.45205 38.0 38.0 38.0 38.0 38.0 25-29 37.46315 38.0 38.0 38.0 38.0 38.0 30-34 37.414699999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.26025 38.0 38.0 38.0 37.6 38.0 40-44 37.077299999999994 38.0 38.0 38.0 36.8 38.0 45-49 37.0038 38.0 38.0 38.0 36.8 38.0 50-54 37.23 38.0 38.0 38.0 37.2 38.0 55-59 37.34955000000001 38.0 38.0 38.0 38.0 38.0 60-64 37.2975 38.0 38.0 38.0 37.6 38.0 65-69 37.268 38.0 38.0 38.0 37.4 38.0 70-74 37.23349999999999 38.0 38.0 38.0 37.4 38.0 75-79 37.1893 38.0 38.0 38.0 37.0 38.0 80-84 37.1258 38.0 38.0 38.0 36.8 38.0 85-89 37.04085 38.0 38.0 38.0 36.6 38.0 90-94 36.9572 38.0 38.0 38.0 36.0 38.0 95-99 36.74955 38.0 38.0 38.0 35.6 38.0 100-104 36.8451 38.0 38.0 38.0 35.8 38.0 105-109 36.85125000000001 38.0 38.0 38.0 35.6 38.0 110-114 36.76975 38.0 38.0 38.0 35.2 38.0 115-119 36.612350000000006 38.0 38.0 38.0 35.0 38.0 120-124 35.78975 38.0 37.0 38.0 31.2 38.0 125-129 36.205400000000004 38.0 38.0 38.0 33.8 38.0 130-134 36.2051 38.0 38.0 38.0 33.8 38.0 135-139 35.8069 38.0 38.0 38.0 32.4 38.0 140-144 35.442550000000004 38.0 37.2 38.0 31.0 38.0 145-149 34.955799999999996 38.0 36.0 38.0 30.0 38.0 150-151 29.26075 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 0.0 6 0.0 7 0.0 8 2.0 9 2.0 10 1.0 11 1.0 12 2.0 13 2.0 14 0.0 15 0.0 16 0.0 17 3.0 18 3.0 19 3.0 20 2.0 21 3.0 22 1.0 23 8.0 24 3.0 25 11.0 26 15.0 27 9.0 28 20.0 29 22.0 30 32.0 31 26.0 32 46.0 33 86.0 34 95.0 35 181.0 36 459.0 37 2951.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.15 21.0 10.674999999999999 27.175 2 32.300000000000004 23.3 24.7 19.7 3 22.375 25.45 27.875 24.3 4 25.6 31.974999999999998 20.8 21.625 5 27.200000000000003 32.824999999999996 19.85 20.125 6 23.1 36.35 20.375 20.175 7 22.15 19.275000000000002 35.225 23.35 8 23.875 22.525000000000002 24.3 29.299999999999997 9 24.625 22.3 27.1 25.974999999999998 10-14 25.455 25.669999999999998 23.73 25.145 15-19 25.729999999999997 25.155 24.560000000000002 24.555 20-24 26.200000000000003 25.83 23.855 24.115000000000002 25-29 26.055 25.669999999999998 23.925 24.349999999999998 30-34 25.259999999999998 26.085 23.630000000000003 25.025 35-39 25.21 26.314999999999998 23.86 24.615000000000002 40-44 26.484999999999996 25.335 24.11 24.07 45-49 26.52 25.235000000000003 24.154999999999998 24.09 50-54 25.405 25.365 24.529999999999998 24.7 55-59 26.200000000000003 25.27 24.224999999999998 24.305 60-64 25.995 25.485000000000003 24.32 24.2 65-69 26.21 25.295 24.18 24.315 70-74 26.235000000000003 24.610000000000003 25.16 23.995 75-79 26.3 24.495 24.75 24.455 80-84 25.775 24.765 24.785 24.675 85-89 26.240000000000002 25.374999999999996 24.125 24.26 90-94 25.535000000000004 25.35 25.03 24.085 95-99 25.590000000000003 25.595000000000002 24.45 24.365000000000002 100-104 26.21 25.09 24.445 24.255 105-109 25.4 25.215 25.180000000000003 24.205 110-114 26.02630131506575 25.54127706385319 24.48122406120306 23.951197559877993 115-119 26.26 25.585 24.42 23.735 120-124 26.5 26.195 23.645 23.66 125-129 25.590000000000003 25.83 24.12 24.46 130-134 26.41 26.05 23.880000000000003 23.66 135-139 27.005000000000003 25.28 24.995 22.720000000000002 140-144 27.41 25.629999999999995 23.965 22.994999999999997 145-149 27.24 25.88 24.560000000000002 22.32 150-151 27.425 25.575 24.375 22.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 0.5 25 0.0 26 1.5 27 3.5 28 3.0 29 2.5 30 6.5 31 10.0 32 11.5 33 18.0 34 28.0 35 39.0 36 42.0 37 40.0 38 59.0 39 86.5 40 123.0 41 149.0 42 149.5 43 163.0 44 178.0 45 189.5 46 191.0 47 182.5 48 174.5 49 173.0 50 157.5 51 145.0 52 142.5 53 126.0 54 113.0 55 103.0 56 94.5 57 91.5 58 101.5 59 101.5 60 93.5 61 81.5 62 77.0 63 74.0 64 61.5 65 59.0 66 55.5 67 54.0 68 47.5 69 42.5 70 38.0 71 27.0 72 22.0 73 19.5 74 14.0 75 7.0 76 4.5 77 3.5 78 4.0 79 4.0 80 3.0 81 1.5 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.755081300813 97.175 2 1.092479674796748 2.15 3 0.05081300813008131 0.15 4 0.05081300813008131 0.2 5 0.025406504065040653 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025406504065040653 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 8 0.2 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.2625 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 5.1125 0.0 0.0 0.0 0.0 136-137 5.550000000000001 0.0 0.0 0.0 0.0 138-139 6.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGTTG 10 0.006830828 145.0 5 GCATCTT 10 0.006830828 145.0 7 >>END_MODULE Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra Read 955131 spots for SRR6958240.sra Written 955131 spots for SRR6958240.sra Read 955127 spots for SRR6958240.sra Written 955127 spots for SRR6958240.sra SRR ids: ['SRR6958240.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ls6c_obl SRR6958240.sra spots: 19102544 blocks: [[1, 955127], [955128, 1910254], [1910255, 2865381], [2865382, 3820508], [3820509, 4775635], [4775636, 5730762], [5730763, 6685889], [6685890, 7641016], [7641017, 8596143], [8596144, 9551270], [9551271, 10506397], [10506398, 11461524], [11461525, 12416651], [12416652, 13371778], [13371779, 14326905], [14326906, 15282032], [15282033, 16237159], [16237160, 17192286], [17192287, 18147413], [18147414, 19102544]] SRR6958240 file size 6451524 SRR6958240 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958240 SRR6958240_1.fastq SRR6958240_2.fastq Input file: SRR6958240_1.fastq Paired file: SRR6958240_2.fastq trimmed: SRR6958240-trimmed-pair1.fastq, SRR6958240-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:17:33 2024 >> started Fri Dec 6 17:17:57 2024 >> done (24.476s) 19102544 read pairs processed; of these: 12855 ( 0.07%) short read pairs filtered out after trimming by size control 10253 ( 0.05%) empty read pairs filtered out after trimming by size control 19079436 (99.88%) read pairs available; of these: 6605268 (34.62%) trimmed read pairs available after processing 12474168 (65.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 4 0.00% 21 14 0.00% 22 10 0.00% 23 11 0.00% 24 11 0.00% 25 25 0.00% 26 18 0.00% 27 7 0.00% 28 13 0.00% 29 15 0.00% 30 19 0.00% 31 18 0.00% 32 11 0.00% 33 14 0.00% 34 18 0.00% 35 16 0.00% 36 18 0.00% 37 22 0.00% 38 25 0.00% 39 26 0.00% 40 38 0.00% 41 28 0.00% 42 26 0.00% 43 29 0.00% 44 32 0.00% 45 37 0.00% 46 37 0.00% 47 28 0.00% 48 37 0.00% 49 44 0.00% 50 61 0.00% 51 73 0.00% 52 92 0.00% 53 84 0.00% 54 88 0.00% 55 80 0.00% 56 100 0.00% 57 122 0.00% 58 132 0.00% 59 136 0.00% 60 194 0.00% 61 169 0.00% 62 204 0.00% 63 211 0.00% 64 262 0.00% 65 287 0.00% 66 322 0.00% 67 357 0.00% 68 414 0.00% 69 415 0.00% 70 523 0.00% 71 611 0.00% 72 683 0.00% 73 753 0.00% 74 833 0.00% 75 878 0.00% 76 1132 0.01% 77 1153 0.01% 78 1353 0.01% 79 1543 0.01% 80 1688 0.01% 81 1991 0.01% 82 2170 0.01% 83 2561 0.01% 84 3436 0.02% 85 4002 0.02% 86 4347 0.02% 87 4749 0.02% 88 5002 0.03% 89 5403 0.03% 90 5864 0.03% 91 6317 0.03% 92 6782 0.04% 93 7422 0.04% 94 7882 0.04% 95 8581 0.04% 96 9002 0.05% 97 9753 0.05% 98 10245 0.05% 99 10935 0.06% 100 11746 0.06% 101 12524 0.07% 102 13470 0.07% 103 14454 0.08% 104 15497 0.08% 105 16225 0.09% 106 17368 0.09% 107 17902 0.09% 108 18762 0.10% 109 19795 0.10% 110 20742 0.11% 111 21711 0.11% 112 23204 0.12% 113 24463 0.13% 114 25740 0.13% 115 27190 0.14% 116 28169 0.15% 117 29296 0.15% 118 30171 0.16% 119 31313 0.16% 120 32203 0.17% 121 33480 0.18% 122 34415 0.18% 123 36823 0.19% 124 38361 0.20% 125 39748 0.21% 126 40865 0.21% 127 41791 0.22% 128 42816 0.22% 129 45080 0.24% 130 45742 0.24% 131 47501 0.25% 132 49968 0.26% 133 51794 0.27% 134 53543 0.28% 135 56173 0.29% 136 58004 0.30% 137 59505 0.31% 138 61678 0.32% 139 65366 0.34% 140 68010 0.36% 141 72057 0.38% 142 77267 0.40% 143 83386 0.44% 144 93826 0.49% 145 106302 0.56% 146 126632 0.66% 147 162277 0.85% 148 234752 1.23% 149 459851 2.41% 150 3634249 19.05% 151 12474168 65.38% 19079436 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=18 prefix-density=0.92 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=27.39 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=15 prefix-density=0.57 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=93.03 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958240 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:18:54 Started mapping on | Dec 06 17:18:54 Finished on | Dec 06 17:20:49 Mapping speed, Million of reads per hour | 597.27 Number of input reads | 19079436 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18506837 Uniquely mapped reads % | 97.00% Average mapped length | 295.59 Number of splices: Total | 20542006 Number of splices: Annotated (sjdb) | 19296319 Number of splices: GT/AG | 20254377 Number of splices: GC/AG | 237543 Number of splices: AT/AC | 7210 Number of splices: Non-canonical | 42876 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205123 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 7630 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.69% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 379097 379097 379097 N_multimapping 205123 205123 205123 N_noFeature 702324 17916844 876075 N_ambiguous 486155 2670 70519 UnstrandedReadsAssigned:17318358 PositiveStrandReadsAssigned:587323 NegativeStrandReadsAssigned:17560243 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958240 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958240-trimmed-pair1.fastq SRR6958240-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,079,436 reads, 17,536,074 reads pseudoaligned [quant] estimated average fragment length: 263.017 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52973 SRR6958240.ke.tsv 35125 SRR6958240.se.tsv 88098 total ==> SRR6958240.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.582 0 0 PNS24247 1044 781.983 49.6093 5.32286 PNS24249 1928 1665.98 51.3854 2.58791 PNS24246 1044 781.983 49.6093 5.32286 PNS24248 1044 781.983 49.6093 5.32286 PNS24244 1471 1208.98 31.7867 2.206 PNS24243 293 91.4707 1 0.917271 KQK14069 1603 1340.98 3631.1 227.193 KQK14071 474 231.434 58.7492 21.2988 ==> SRR6958240.se.tsv <== BRADI_1g14170v3 3978 BRADI_1g53295v3 1198 BRADI_1g59795v3 120 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 360 BRADI_1g74790v3 99 BRADI_1g09890v3 0 BRADI_1g77505v3 221 BRADI_1g48960v3 0 SRR6958240 completed mapping pipeline successfully