Starting /dee2/code/volunteer_pipeline.sh SRR6958241 current disk space = 1550630715392 free memory = 1598754344 SRR6958241 SRAfilesize d58237ccfc09dffa9807fd73ad183ccb SRR6958241.sra SRR6958241.sra file validated SRR6958241 is paired end SRR6958241 is conventional basespace SRR6958241 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958241_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.40525 30.0 18.0 33.0 18.0 34.0 2 29.13425 30.0 27.0 33.0 25.0 34.0 3 29.96575 31.0 29.0 33.0 25.0 33.0 4 31.257 33.0 31.0 33.0 29.0 34.0 5 32.4565 33.0 33.0 33.0 32.0 34.0 6 36.27875 37.0 36.0 38.0 34.0 38.0 7 37.3655 38.0 38.0 38.0 36.0 38.0 8 36.50475 38.0 38.0 38.0 34.0 38.0 9 37.342 38.0 38.0 38.0 36.0 38.0 10-14 37.50145 38.0 38.0 38.0 37.2 38.0 15-19 37.551750000000006 38.0 38.0 38.0 37.8 38.0 20-24 37.449200000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.5286 38.0 38.0 38.0 38.0 38.0 30-34 37.610499999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.533449999999995 38.0 38.0 38.0 37.8 38.0 40-44 37.5567 38.0 38.0 38.0 38.0 38.0 45-49 37.510949999999994 38.0 38.0 38.0 37.8 38.0 50-54 37.25335 38.0 38.0 38.0 36.6 38.0 55-59 36.955149999999996 38.0 38.0 38.0 35.8 38.0 60-64 37.06705 38.0 38.0 38.0 36.0 38.0 65-69 37.1597 38.0 38.0 38.0 36.2 38.0 70-74 37.174850000000006 38.0 38.0 38.0 36.2 38.0 75-79 37.0995 38.0 38.0 38.0 36.0 38.0 80-84 37.035 38.0 38.0 38.0 35.8 38.0 85-89 37.0185 38.0 38.0 38.0 35.8 38.0 90-94 36.97685 38.0 38.0 38.0 35.2 38.0 95-99 36.7708 38.0 38.0 38.0 34.6 38.0 100-104 36.6991 38.0 38.0 38.0 34.4 38.0 105-109 36.5932 38.0 37.8 38.0 34.0 38.0 110-114 36.46285 38.0 37.8 38.0 34.0 38.0 115-119 36.319849999999995 38.0 37.2 38.0 34.0 38.0 120-124 36.06135 38.0 37.0 38.0 32.8 38.0 125-129 35.826350000000005 38.0 36.2 38.0 31.6 38.0 130-134 35.833450000000006 38.0 36.0 38.0 32.4 38.0 135-139 35.33325 38.0 35.4 38.0 31.0 38.0 140-144 34.8843 38.0 34.6 38.0 28.8 38.0 145-149 34.27055 38.0 34.0 38.0 26.4 38.0 150-151 30.326 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.0 20 1.0 21 2.0 22 1.0 23 2.0 24 8.0 25 8.0 26 8.0 27 10.0 28 15.0 29 23.0 30 40.0 31 39.0 32 61.0 33 97.0 34 164.0 35 345.0 36 893.0 37 2276.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.547888774459324 16.915550978372814 6.719876416065912 42.81668383110196 2 22.355588897224308 13.553388347086774 35.13378344586147 28.95723930982746 3 20.75 17.05 23.075000000000003 39.125 4 24.175 27.750000000000004 20.075000000000003 28.000000000000004 5 23.3 31.125000000000004 24.775 20.8 6 21.825 34.55 23.5 20.125 7 16.625 25.75 39.800000000000004 17.825 8 18.0 25.85 30.925000000000004 25.224999999999998 9 18.4 22.95 34.0 24.65 10-14 21.240000000000002 29.585 26.640000000000004 22.535 15-19 22.165000000000003 27.985 26.6 23.25 20-24 21.87 27.644999999999996 26.395000000000003 24.09 25-29 21.395 28.310000000000002 26.685 23.61 30-34 21.959999999999997 27.905 26.415 23.72 35-39 21.855 28.155 26.240000000000002 23.75 40-44 21.88 28.08 26.279999999999998 23.76 45-49 21.875 27.785 26.55 23.79 50-54 22.095000000000002 27.52 26.445 23.94 55-59 21.665 27.38 26.665 24.29 60-64 21.47536884221055 27.576894223555886 26.431607901975497 24.516129032258064 65-69 22.30723072307231 27.582758275827583 26.407640764076408 23.7023702370237 70-74 22.125 28.185 26.205000000000002 23.485 75-79 21.735 26.995 26.919999999999998 24.349999999999998 80-84 22.13 27.334999999999997 26.56 23.974999999999998 85-89 22.16 27.655 26.305 23.880000000000003 90-94 21.9 27.084999999999997 26.5 24.515 95-99 22.125 27.134999999999998 26.484999999999996 24.255 100-104 22.75 27.3 26.340000000000003 23.61 105-109 22.13 27.245 26.729999999999997 23.895 110-114 22.41 27.04 26.595000000000002 23.955000000000002 115-119 22.5 27.500000000000004 26.345000000000002 23.655 120-124 22.439999999999998 27.544999999999998 25.729999999999997 24.285 125-129 22.27 27.615000000000002 25.740000000000002 24.375 130-134 22.685 27.205000000000002 25.724999999999998 24.385 135-139 22.655 27.534999999999997 25.155 24.654999999999998 140-144 22.615 26.83 25.169999999999998 25.385 145-149 22.45 27.13 25.290000000000003 25.130000000000003 150-151 22.5 27.3375 25.275 24.887500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 2.0 26 2.5 27 5.0 28 3.5 29 5.5 30 10.5 31 13.5 32 21.5 33 38.0 34 50.5 35 64.5 36 85.0 37 102.0 38 116.5 39 141.5 40 175.5 41 210.0 42 216.5 43 213.0 44 239.5 45 255.5 46 244.5 47 225.5 48 204.5 49 172.0 50 143.5 51 131.5 52 124.5 53 110.5 54 87.0 55 72.5 56 64.5 57 57.0 58 49.0 59 44.0 60 44.0 61 39.5 62 28.5 63 22.0 64 24.0 65 27.5 66 22.0 67 13.5 68 15.5 69 16.0 70 11.0 71 7.0 72 8.0 73 7.0 74 5.0 75 3.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.025 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.2750000000000004 0.0 0.0 0.0 0.0 108-109 2.4749999999999996 0.0 0.0 0.0 0.0 110-111 2.8875 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.85 0.0 0.0 0.0 0.0 116-117 4.2375 0.0 0.0 0.0 0.0 118-119 4.7875 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.65 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 6.9375 0.0 0.0 0.0 0.0 128-129 7.4625 0.0 0.0 0.0 0.0 130-131 8.2375 0.0 0.0 0.0 0.0 132-133 8.975 0.0 0.0 0.0 0.0 134-135 9.95 0.0 0.0 0.0 0.0 136-137 10.9375 0.0 0.0 0.0 0.0 138-139 11.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCCCG 10 0.006836113 144.9625 145 GAGTTAA 10 0.006836113 144.9625 5 >>END_MODULE SRR6958241 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958241_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.181 33.0 33.0 34.0 33.0 34.0 2 33.3155 34.0 33.0 34.0 33.0 34.0 3 33.36375 34.0 33.0 34.0 33.0 34.0 4 33.35775 34.0 33.0 34.0 33.0 34.0 5 33.343 34.0 33.0 34.0 33.0 34.0 6 37.50425 38.0 38.0 38.0 38.0 38.0 7 37.5155 38.0 38.0 38.0 38.0 38.0 8 37.51375 38.0 38.0 38.0 38.0 38.0 9 37.4845 38.0 38.0 38.0 38.0 38.0 10-14 37.484249999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.50790000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.0678 38.0 38.0 38.0 35.8 38.0 25-29 37.496249999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5608 38.0 38.0 38.0 38.0 38.0 35-39 36.7758 38.0 37.6 38.0 34.4 38.0 40-44 37.5226 38.0 38.0 38.0 37.8 38.0 45-49 37.51445 38.0 38.0 38.0 38.0 38.0 50-54 37.5081 38.0 38.0 38.0 38.0 38.0 55-59 36.74685 38.0 37.8 38.0 34.2 38.0 60-64 37.45915000000001 38.0 38.0 38.0 37.8 38.0 65-69 37.43555 38.0 38.0 38.0 38.0 38.0 70-74 37.41575 38.0 38.0 38.0 37.4 38.0 75-79 37.34439999999999 38.0 38.0 38.0 37.2 38.0 80-84 37.348150000000004 38.0 38.0 38.0 37.0 38.0 85-89 37.25745 38.0 38.0 38.0 36.8 38.0 90-94 37.167449999999995 38.0 38.0 38.0 36.6 38.0 95-99 37.1622 38.0 38.0 38.0 36.2 38.0 100-104 36.90505 38.0 38.0 38.0 35.6 38.0 105-109 35.8232 38.0 36.0 38.0 31.0 38.0 110-114 35.91 38.0 37.0 38.0 31.6 38.0 115-119 36.7202 38.0 38.0 38.0 35.0 38.0 120-124 35.43385 38.0 36.6 38.0 27.8 38.0 125-129 36.05815 38.0 37.2 38.0 32.4 38.0 130-134 35.24265 38.0 35.8 38.0 27.6 38.0 135-139 32.053999999999995 35.6 28.2 38.0 20.2 38.0 140-144 34.64135 38.0 34.4 38.0 28.2 38.0 145-149 34.3232 38.0 36.0 38.0 27.2 38.0 150-151 27.835625 33.0 18.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 5.0 17 1.0 18 4.0 19 5.0 20 1.0 21 2.0 22 3.0 23 3.0 24 6.0 25 9.0 26 9.0 27 14.0 28 15.0 29 22.0 30 29.0 31 46.0 32 60.0 33 91.0 34 130.0 35 292.0 36 958.0 37 2291.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.574999999999996 18.9 11.325000000000001 32.2 2 29.175 23.525 30.375000000000004 16.925 3 21.65 26.775 29.599999999999998 21.975 4 25.775 32.425 21.0 20.8 5 25.6 34.275 22.825 17.299999999999997 6 23.3 36.55 22.45 17.7 7 21.275 21.349999999999998 35.925000000000004 21.45 8 22.6 23.724999999999998 26.950000000000003 26.724999999999998 9 23.35 22.45 30.675 23.525 10-14 24.83 27.450000000000003 24.625 23.095 15-19 24.86 26.56 26.08 22.5 20-24 24.765 26.33 26.334999999999997 22.57 25-29 25.415 26.534999999999997 25.655 22.395 30-34 24.05 26.44 26.55 22.96 35-39 24.310000000000002 27.375 26.07 22.245 40-44 24.055 26.515 26.82 22.61 45-49 24.709999999999997 26.6 26.22 22.470000000000002 50-54 24.38 26.775 26.889999999999997 21.955 55-59 24.474999999999998 26.44 26.32 22.765 60-64 24.785 26.685 26.33 22.2 65-69 24.525 26.22 26.88 22.375 70-74 24.349999999999998 26.21 27.339999999999996 22.1 75-79 24.224999999999998 26.1 26.919999999999998 22.755 80-84 24.03 26.96 26.674999999999997 22.335 85-89 25.335 26.6 26.355 21.709999999999997 90-94 24.84 26.595000000000002 26.435 22.13 95-99 25.355 26.490000000000002 26.284999999999997 21.87 100-104 25.52 26.46 26.545 21.475 105-109 24.95 26.71 26.135 22.205 110-114 24.834999999999997 26.765 26.21 22.189999999999998 115-119 24.905 27.215 25.955000000000002 21.925 120-124 25.19 27.21 26.169999999999998 21.43 125-129 25.115 27.139999999999997 26.224999999999998 21.52 130-134 25.96 26.795 26.490000000000002 20.755000000000003 135-139 25.41 27.589999999999996 25.955000000000002 21.044999999999998 140-144 26.369999999999997 27.41 25.740000000000002 20.48 145-149 26.72 27.089999999999996 25.855 20.335 150-151 26.525 27.212500000000002 25.8625 20.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 1.5 25 3.0 26 5.5 27 3.5 28 4.0 29 7.0 30 10.0 31 16.0 32 24.5 33 31.0 34 34.5 35 41.5 36 56.5 37 80.5 38 100.5 39 115.0 40 158.5 41 198.5 42 202.5 43 202.5 44 223.0 45 258.0 46 245.0 47 218.0 48 203.5 49 175.0 50 165.5 51 154.5 52 125.0 53 108.5 54 99.0 55 80.5 56 68.5 57 60.5 58 59.0 59 64.0 60 56.0 61 47.0 62 44.0 63 37.0 64 33.0 65 35.5 66 34.0 67 27.0 68 21.0 69 16.5 70 12.0 71 8.5 72 8.5 73 6.0 74 2.0 75 2.0 76 1.5 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.1500000000000004 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.275 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.0 0.0 0.0 0.0 0.0 118-119 4.5375 0.0 0.0 0.0 0.0 120-121 4.9 0.0 0.0 0.0 0.0 122-123 5.325 0.0 0.0 0.0 0.0 124-125 5.9125 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 6.875 0.0 0.0 0.0 0.0 130-131 7.475 0.0 0.0 0.0 0.0 132-133 8.0625 0.0 0.0 0.0 0.0 134-135 8.95 0.0 0.0 0.0 0.0 136-137 9.787500000000001 0.0 0.0 0.0 0.0 138-139 10.600000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCTTG 10 0.006830828 145.0 7 >>END_MODULE Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712971 spots for SRR6958241.sra Written 712971 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra Read 712963 spots for SRR6958241.sra Written 712963 spots for SRR6958241.sra SRR ids: ['SRR6958241.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7yba6d0n SRR6958241.sra spots: 14259268 blocks: [[1, 712963], [712964, 1425926], [1425927, 2138889], [2138890, 2851852], [2851853, 3564815], [3564816, 4277778], [4277779, 4990741], [4990742, 5703704], [5703705, 6416667], [6416668, 7129630], [7129631, 7842593], [7842594, 8555556], [8555557, 9268519], [9268520, 9981482], [9981483, 10694445], [10694446, 11407408], [11407409, 12120371], [12120372, 12833334], [12833335, 13546297], [13546298, 14259268]] SRR6958241 file size 4810297 SRR6958241 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958241 SRR6958241_1.fastq SRR6958241_2.fastq Input file: SRR6958241_1.fastq Paired file: SRR6958241_2.fastq trimmed: SRR6958241-trimmed-pair1.fastq, SRR6958241-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:18:15 2024 >> started Fri Dec 6 17:18:30 2024 >> done (14.895s) 14259268 read pairs processed; of these: 5439 ( 0.04%) short read pairs filtered out after trimming by size control 7511 ( 0.05%) empty read pairs filtered out after trimming by size control 14246318 (99.91%) read pairs available; of these: 8215030 (57.66%) trimmed read pairs available after processing 6031288 (42.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 3 0.00% 21 5 0.00% 22 4 0.00% 23 9 0.00% 24 2 0.00% 25 4 0.00% 26 1 0.00% 27 12 0.00% 28 7 0.00% 29 11 0.00% 30 8 0.00% 31 10 0.00% 32 6 0.00% 33 10 0.00% 34 11 0.00% 35 9 0.00% 36 9 0.00% 37 15 0.00% 38 16 0.00% 39 15 0.00% 40 25 0.00% 41 25 0.00% 42 26 0.00% 43 26 0.00% 44 26 0.00% 45 27 0.00% 46 39 0.00% 47 44 0.00% 48 43 0.00% 49 58 0.00% 50 61 0.00% 51 67 0.00% 52 78 0.00% 53 80 0.00% 54 111 0.00% 55 104 0.00% 56 117 0.00% 57 130 0.00% 58 151 0.00% 59 207 0.00% 60 208 0.00% 61 270 0.00% 62 301 0.00% 63 284 0.00% 64 340 0.00% 65 395 0.00% 66 417 0.00% 67 509 0.00% 68 561 0.00% 69 645 0.00% 70 698 0.00% 71 820 0.01% 72 924 0.01% 73 1076 0.01% 74 1204 0.01% 75 1392 0.01% 76 1606 0.01% 77 1828 0.01% 78 1894 0.01% 79 2113 0.01% 80 2342 0.02% 81 2646 0.02% 82 3046 0.02% 83 3468 0.02% 84 3993 0.03% 85 4540 0.03% 86 5049 0.04% 87 5437 0.04% 88 5874 0.04% 89 6264 0.04% 90 6827 0.05% 91 7559 0.05% 92 8376 0.06% 93 9281 0.07% 94 10290 0.07% 95 10843 0.08% 96 11552 0.08% 97 12448 0.09% 98 13184 0.09% 99 14063 0.10% 100 15684 0.11% 101 17590 0.12% 102 17365 0.12% 103 18436 0.13% 104 19576 0.14% 105 20745 0.15% 106 22100 0.16% 107 23353 0.16% 108 24314 0.17% 109 25797 0.18% 110 26638 0.19% 111 27918 0.20% 112 28875 0.20% 113 30046 0.21% 114 32263 0.23% 115 33941 0.24% 116 35533 0.25% 117 36987 0.26% 118 38216 0.27% 119 38822 0.27% 120 40084 0.28% 121 42221 0.30% 122 43534 0.31% 123 45166 0.32% 124 47524 0.33% 125 49659 0.35% 126 51490 0.36% 127 53658 0.38% 128 55544 0.39% 129 57792 0.41% 130 60108 0.42% 131 62104 0.44% 132 64659 0.45% 133 68651 0.48% 134 71437 0.50% 135 75114 0.53% 136 79346 0.56% 137 83445 0.59% 138 87238 0.61% 139 94670 0.66% 140 99788 0.70% 141 108286 0.76% 142 120673 0.85% 143 134052 0.94% 144 151062 1.06% 145 181692 1.28% 146 222013 1.56% 147 293872 2.06% 148 432521 3.04% 149 848206 5.95% 150 3689036 25.89% 151 6031288 42.34% 14246318 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=19 prefix-density=0.55 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=43.86 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=18 prefix-density=0.33 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=110.64 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958241 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:19:09 Started mapping on | Dec 06 17:19:09 Finished on | Dec 06 17:20:07 Mapping speed, Million of reads per hour | 884.25 Number of input reads | 14246318 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14044724 Uniquely mapped reads % | 98.58% Average mapped length | 291.88 Number of splices: Total | 15535193 Number of splices: Annotated (sjdb) | 14584935 Number of splices: GT/AG | 15335851 Number of splices: GC/AG | 180577 Number of splices: AT/AC | 5991 Number of splices: Non-canonical | 12774 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 112165 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 10464 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.20% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 92321 92321 92321 N_multimapping 112165 112165 112165 N_noFeature 600346 13647753 723074 N_ambiguous 322862 1645 49294 UnstrandedReadsAssigned:13121516 PositiveStrandReadsAssigned:395326 NegativeStrandReadsAssigned:13272356 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6958241 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958241-trimmed-pair1.fastq SRR6958241-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,246,318 reads, 13,315,999 reads pseudoaligned [quant] estimated average fragment length: 215.612 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR6958241.ke.tsv 35125 SRR6958241.se.tsv 88098 total ==> SRR6958241.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 721.752 0 0 PNS24247 1044 829.388 53.8538 7.52166 PNS24249 1928 1713.39 20.6445 1.39574 PNS24246 1044 829.388 53.8538 7.52166 PNS24248 1044 829.388 53.8538 7.52166 PNS24244 1471 1256.39 43.7943 4.03784 PNS24243 293 102.217 0 0 KQK14069 1603 1388.39 2001.52 166.996 KQK14071 474 263.018 83.3014 36.6879 ==> SRR6958241.se.tsv <== BRADI_1g14170v3 2614 BRADI_1g53295v3 239 BRADI_1g59795v3 360 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 245 BRADI_1g74790v3 77 BRADI_1g09890v3 0 BRADI_1g77505v3 232 BRADI_1g48960v3 0 SRR6958241 completed mapping pipeline successfully