Starting /dee2/code/volunteer_pipeline.sh SRR6958242 current disk space = 1550643625984 free memory = 1604340504 SRR6958242 SRAfilesize 258fcb78a76a495a56ba2a60b9c6e36d SRR6958242.sra SRR6958242.sra file validated SRR6958242 is paired end SRR6958242 is conventional basespace SRR6958242 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958242_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.70575 18.0 18.0 30.0 18.0 32.0 2 28.0665 29.0 27.0 31.0 18.0 33.0 3 29.09275 31.0 27.0 33.0 25.0 33.0 4 31.19975 32.0 32.0 33.0 27.0 33.0 5 32.50575 33.0 33.0 33.0 32.0 33.0 6 36.707 38.0 37.0 38.0 34.0 38.0 7 37.33475 38.0 38.0 38.0 36.0 38.0 8 37.4565 38.0 38.0 38.0 37.0 38.0 9 37.59025 38.0 38.0 38.0 38.0 38.0 10-14 37.5475 38.0 38.0 38.0 38.0 38.0 15-19 37.50945 38.0 38.0 38.0 38.0 38.0 20-24 37.612049999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.60525 38.0 38.0 38.0 38.0 38.0 30-34 37.53815 38.0 38.0 38.0 38.0 38.0 35-39 37.518299999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.57190000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.53885 38.0 38.0 38.0 38.0 38.0 50-54 37.5519 38.0 38.0 38.0 38.0 38.0 55-59 37.4317 38.0 38.0 38.0 37.4 38.0 60-64 37.289 38.0 38.0 38.0 36.6 38.0 65-69 37.40089999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.36065 38.0 38.0 38.0 37.0 38.0 75-79 37.289 38.0 38.0 38.0 37.0 38.0 80-84 37.32435 38.0 38.0 38.0 37.0 38.0 85-89 36.30695 38.0 37.0 38.0 30.8 38.0 90-94 37.09375 38.0 38.0 38.0 35.8 38.0 95-99 37.10695 38.0 38.0 38.0 36.2 38.0 100-104 36.97645 38.0 38.0 38.0 35.8 38.0 105-109 36.86865 38.0 38.0 38.0 35.2 38.0 110-114 36.38695 38.0 37.6 38.0 33.4 38.0 115-119 36.71365 38.0 38.0 38.0 34.8 38.0 120-124 36.5644 38.0 38.0 38.0 34.2 38.0 125-129 36.434 38.0 38.0 38.0 34.0 38.0 130-134 36.30465 38.0 38.0 38.0 33.8 38.0 135-139 36.1643 38.0 38.0 38.0 33.2 38.0 140-144 35.48295 38.0 36.4 38.0 30.0 38.0 145-149 33.902 38.0 33.6 38.0 24.6 38.0 150-151 31.589375 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 2.0 15 0.0 16 0.0 17 2.0 18 1.0 19 1.0 20 0.0 21 0.0 22 4.0 23 0.0 24 3.0 25 5.0 26 9.0 27 13.0 28 21.0 29 22.0 30 32.0 31 37.0 32 55.0 33 79.0 34 130.0 35 241.0 36 701.0 37 2638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.51009564293305 12.672688629117959 6.9872476089266735 34.82996811902231 2 25.4 12.575 32.2 29.825000000000003 3 20.5 17.175 24.7 37.625 4 28.15 24.625 21.025 26.200000000000003 5 24.425 29.2 24.325 22.05 6 21.2 32.9 23.599999999999998 22.3 7 18.2 22.675 40.575 18.55 8 20.225 23.075000000000003 28.475 28.225 9 19.175 21.15 34.300000000000004 25.374999999999996 10-14 23.086154307715386 26.266313315665784 25.206260313015648 25.441272063603183 15-19 22.97 25.074999999999996 26.200000000000003 25.755 20-24 23.0 25.82 25.295 25.885 25-29 23.94 24.945 25.580000000000002 25.535000000000004 30-34 22.845 25.46 26.334999999999997 25.36 35-39 23.875 24.905 25.915 25.305 40-44 23.29 25.435000000000002 25.990000000000002 25.285000000000004 45-49 23.05730573057306 25.147514751475146 26.162616261626166 25.63256325632563 50-54 23.416170808540425 25.131256562828142 25.301265063253165 26.151307565378268 55-59 23.155 25.224999999999998 25.755 25.865 60-64 23.53 25.169999999999998 25.585 25.715 65-69 23.44117205860293 24.761238061903097 26.09630481524076 25.701285064253216 70-74 23.71 24.75 26.115 25.424999999999997 75-79 23.595 25.19 25.135 26.08 80-84 22.919999999999998 24.795 26.215 26.07 85-89 23.455000000000002 25.080000000000002 25.985000000000003 25.480000000000004 90-94 24.075 24.93 25.22 25.775 95-99 23.665 25.055 25.715 25.564999999999998 100-104 24.075 25.275 24.86 25.790000000000003 105-109 23.73 24.89 25.56 25.82 110-114 23.685000000000002 25.259999999999998 25.545 25.509999999999998 115-119 23.836191809590478 24.8162408120406 25.316265813290666 26.03130156507825 120-124 23.65 25.085 24.93 26.334999999999997 125-129 24.33621681084054 25.146257312865643 25.26626331316566 25.251262563128158 130-134 24.54 25.145 24.62 25.695 135-139 24.145 24.740000000000002 24.91 26.205000000000002 140-144 24.224999999999998 24.79 24.990000000000002 25.995 145-149 24.349999999999998 25.174999999999997 25.040000000000003 25.435000000000002 150-151 24.161241862794192 24.799699549323986 25.375563345017525 25.663495242864297 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 2.0 28 2.5 29 6.5 30 11.0 31 10.5 32 13.0 33 22.0 34 25.5 35 27.5 36 38.5 37 66.5 38 82.5 39 96.0 40 128.5 41 150.5 42 171.5 43 190.5 44 202.0 45 200.5 46 193.0 47 196.5 48 204.5 49 196.0 50 167.5 51 142.0 52 128.5 53 122.0 54 115.5 55 112.0 56 96.5 57 80.5 58 74.5 59 70.5 60 71.0 61 70.0 62 62.5 63 54.5 64 52.5 65 51.0 66 43.5 67 37.5 68 37.5 69 32.0 70 29.5 71 28.5 72 23.0 73 19.5 74 14.0 75 7.0 76 4.0 77 3.5 78 3.0 79 2.0 80 1.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.8999999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.475 0.0 0.0 0.0 0.0 128-129 3.85 0.0 0.0 0.0 0.0 130-131 4.2625 0.0 0.0 0.0 0.0 132-133 4.5875 0.0 0.0 0.0 0.0 134-135 4.95 0.0 0.0 0.0 0.0 136-137 5.375 0.0 0.0 0.0 0.0 138-139 5.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACTGC 10 0.006841402 144.925 6 TCTTTTT 10 0.006841402 144.925 6 AACACTG 10 0.006841402 144.925 5 >>END_MODULE SRR6958242 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958242_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43975 33.0 33.0 34.0 32.0 34.0 2 32.92675 34.0 33.0 34.0 32.0 34.0 3 33.0165 34.0 33.0 34.0 32.0 34.0 4 33.133 34.0 33.0 34.0 33.0 34.0 5 32.80675 34.0 33.0 34.0 32.0 34.0 6 37.1115 38.0 38.0 38.0 37.0 38.0 7 37.26 38.0 38.0 38.0 37.0 38.0 8 37.24925 38.0 38.0 38.0 37.0 38.0 9 37.204 38.0 38.0 38.0 37.0 38.0 10-14 36.974450000000004 38.0 38.0 38.0 36.0 38.0 15-19 37.21925 38.0 38.0 38.0 36.8 38.0 20-24 37.342349999999996 38.0 38.0 38.0 37.8 38.0 25-29 36.972750000000005 38.0 38.0 38.0 36.2 38.0 30-34 37.26055 38.0 38.0 38.0 37.2 38.0 35-39 37.0991 38.0 38.0 38.0 36.8 38.0 40-44 36.82299999999999 38.0 38.0 38.0 35.6 38.0 45-49 36.88100000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.7456 38.0 38.0 38.0 35.0 38.0 55-59 37.120400000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.1048 38.0 38.0 38.0 37.0 38.0 65-69 36.28935 38.0 37.8 38.0 33.0 38.0 70-74 36.894850000000005 38.0 38.0 38.0 35.8 38.0 75-79 37.0209 38.0 38.0 38.0 36.2 38.0 80-84 36.85035 38.0 38.0 38.0 35.8 38.0 85-89 36.75995 38.0 38.0 38.0 35.4 38.0 90-94 36.6126 38.0 38.0 38.0 34.6 38.0 95-99 35.25245 38.0 36.2 38.0 27.8 38.0 100-104 36.497550000000004 38.0 38.0 38.0 34.4 38.0 105-109 35.717650000000006 38.0 37.0 38.0 31.0 38.0 110-114 36.30025 38.0 38.0 38.0 34.0 38.0 115-119 36.263099999999994 38.0 38.0 38.0 34.0 38.0 120-124 35.07305 38.0 36.2 38.0 27.8 38.0 125-129 35.69590000000001 38.0 37.2 38.0 31.6 38.0 130-134 35.764300000000006 38.0 37.8 38.0 32.2 38.0 135-139 34.236200000000004 38.0 34.2 38.0 25.2 38.0 140-144 34.7685 38.0 36.0 38.0 29.0 38.0 145-149 33.35235 38.0 34.0 38.0 20.0 38.0 150-151 28.948 35.5 18.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 1.0 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 3.0 12 0.0 13 1.0 14 1.0 15 1.0 16 3.0 17 3.0 18 4.0 19 2.0 20 5.0 21 4.0 22 5.0 23 7.0 24 10.0 25 16.0 26 18.0 27 29.0 28 34.0 29 43.0 30 53.0 31 49.0 32 74.0 33 98.0 34 147.0 35 256.0 36 631.0 37 2488.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.5 19.975 9.275 28.249999999999996 2 30.975 23.275000000000002 26.75 19.0 3 21.95 25.575 28.199999999999996 24.275 4 26.450000000000003 31.1 21.2 21.25 5 28.249999999999996 33.175 19.525000000000002 19.05 6 22.875 35.625 19.025 22.475 7 22.225 18.875 36.425000000000004 22.475 8 25.074999999999996 22.55 24.375 28.000000000000004 9 25.006251562890725 22.930732683170792 26.531632908227053 25.531382845711427 10-14 25.785000000000004 26.029999999999998 23.445 24.740000000000002 15-19 25.675135027005403 25.50510102020404 24.5499099819964 24.26985397079416 20-24 25.755 25.759999999999998 24.2 24.285 25-29 26.16630831541577 25.506275313765688 23.666183309165458 24.661233061653082 30-34 25.655 26.14 23.794999999999998 24.41 35-39 26.123918587788168 25.653848077211585 23.948592288843326 24.273641046156925 40-44 25.967596759675963 25.50755075507551 23.812381238123812 24.71247124712471 45-49 25.587558755875587 25.477547754775475 23.997399739974 24.937493749374937 50-54 26.19785935780734 25.157547264179254 24.46734020206062 24.17725317595279 55-59 26.474265993097585 25.43390186565298 23.74831190916821 24.34352023208123 60-64 26.009999999999998 25.53 24.255 24.205 65-69 26.064999999999998 25.0 24.5 24.435000000000002 70-74 26.195 25.245 24.45 24.11 75-79 25.918887833174974 25.328799319897982 24.35865379806971 24.393659048857327 80-84 25.906476619154787 25.32133033258315 24.566141535383846 24.20605151287822 85-89 26.136306815340767 25.151257562878143 24.216210810540527 24.496224811240563 90-94 25.82758275827583 25.367536753675367 24.51745174517452 24.287428742874287 95-99 26.424999999999997 25.485000000000003 24.04 24.05 100-104 26.47 24.805 24.58 24.145 105-109 26.610322064412884 25.31006201240248 24.74494898979796 23.33466693338668 110-114 26.275255051010205 25.99019803960792 24.079815963192637 23.654730946189236 115-119 27.034999999999997 25.305 24.195 23.465 120-124 26.421321066053306 25.776288814440722 24.23121156057803 23.571178558927947 125-129 26.685 25.94 23.71 23.665 130-134 27.18771877187719 25.48254825482548 23.97239723972397 23.357335733573358 135-139 26.55 25.755 24.29 23.405 140-144 27.091354567728388 25.83629181459073 24.421221061053053 22.651132556627832 145-149 26.93134656732837 25.791289564478227 24.23121156057803 23.04615230761538 150-151 27.515015015015017 26.151151151151154 24.186686686686688 22.147147147147148 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 1.0 26 1.0 27 2.0 28 2.5 29 3.0 30 8.0 31 11.0 32 11.5 33 15.5 34 16.5 35 28.5 36 46.5 37 52.5 38 67.0 39 91.0 40 117.5 41 136.5 42 148.0 43 161.5 44 175.5 45 190.5 46 197.0 47 188.0 48 174.5 49 171.5 50 172.0 51 170.5 52 150.5 53 115.0 54 105.5 55 101.0 56 89.5 57 84.5 58 86.5 59 91.5 60 75.0 61 65.5 62 76.5 63 87.5 64 76.5 65 60.5 66 53.5 67 53.0 68 52.5 69 45.0 70 40.5 71 34.0 72 27.0 73 19.0 74 16.5 75 12.5 76 8.0 77 5.0 78 2.0 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.02 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.015 40-44 0.01 45-49 0.01 50-54 0.03 55-59 0.034999999999999996 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.015 80-84 0.025 85-89 0.005 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.02 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.01 135-139 0.0 140-144 0.005 145-149 0.005 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0642387455741 97.925 2 0.7840161861406171 1.55 3 0.07587253414264036 0.22499999999999998 4 0.07587253414264036 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.2625000000000002 0.0 0.0 0.0 0.0 114-115 1.4500000000000002 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.9375 0.0 0.0 0.0 0.0 126-127 3.375 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.7375 0.0 0.0 0.0 0.0 136-137 5.15 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGAG 20 3.5877043E-4 108.75 9 >>END_MODULE Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015898 spots for SRR6958242.sra Written 1015898 spots for SRR6958242.sra Read 1015901 spots for SRR6958242.sra Written 1015901 spots for SRR6958242.sra SRR ids: ['SRR6958242.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_foow_tuh SRR6958242.sra spots: 20317963 blocks: [[1, 1015898], [1015899, 2031796], [2031797, 3047694], [3047695, 4063592], [4063593, 5079490], [5079491, 6095388], [6095389, 7111286], [7111287, 8127184], [8127185, 9143082], [9143083, 10158980], [10158981, 11174878], [11174879, 12190776], [12190777, 13206674], [13206675, 14222572], [14222573, 15238470], [15238471, 16254368], [16254369, 17270266], [17270267, 18286164], [18286165, 19302062], [19302063, 20317963]] SRR6958242 file size 6863390 SRR6958242 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958242 SRR6958242_1.fastq SRR6958242_2.fastq Input file: SRR6958242_1.fastq Paired file: SRR6958242_2.fastq trimmed: SRR6958242-trimmed-pair1.fastq, SRR6958242-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:27:28 2024 >> started Fri Dec 6 17:27:56 2024 >> done (28.315s) 20317963 read pairs processed; of these: 19213 ( 0.09%) short read pairs filtered out after trimming by size control 18210 ( 0.09%) empty read pairs filtered out after trimming by size control 20280540 (99.82%) read pairs available; of these: 7377689 (36.38%) trimmed read pairs available after processing 12902851 (63.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 10 0.00% 21 13 0.00% 22 16 0.00% 23 14 0.00% 24 14 0.00% 25 10 0.00% 26 17 0.00% 27 14 0.00% 28 15 0.00% 29 14 0.00% 30 21 0.00% 31 17 0.00% 32 12 0.00% 33 15 0.00% 34 20 0.00% 35 15 0.00% 36 23 0.00% 37 29 0.00% 38 18 0.00% 39 26 0.00% 40 33 0.00% 41 29 0.00% 42 29 0.00% 43 43 0.00% 44 31 0.00% 45 44 0.00% 46 50 0.00% 47 51 0.00% 48 56 0.00% 49 54 0.00% 50 53 0.00% 51 84 0.00% 52 76 0.00% 53 67 0.00% 54 107 0.00% 55 115 0.00% 56 107 0.00% 57 159 0.00% 58 140 0.00% 59 175 0.00% 60 199 0.00% 61 221 0.00% 62 267 0.00% 63 268 0.00% 64 291 0.00% 65 334 0.00% 66 344 0.00% 67 410 0.00% 68 466 0.00% 69 526 0.00% 70 620 0.00% 71 685 0.00% 72 796 0.00% 73 911 0.00% 74 1015 0.01% 75 1156 0.01% 76 1232 0.01% 77 1395 0.01% 78 1489 0.01% 79 1816 0.01% 80 1980 0.01% 81 2239 0.01% 82 2497 0.01% 83 2914 0.01% 84 3938 0.02% 85 4901 0.02% 86 5192 0.03% 87 5509 0.03% 88 6012 0.03% 89 6295 0.03% 90 6721 0.03% 91 7138 0.04% 92 7769 0.04% 93 8551 0.04% 94 9114 0.04% 95 9706 0.05% 96 10357 0.05% 97 10975 0.05% 98 11517 0.06% 99 12452 0.06% 100 13344 0.07% 101 14211 0.07% 102 15351 0.08% 103 16124 0.08% 104 17098 0.08% 105 18191 0.09% 106 19564 0.10% 107 20119 0.10% 108 21033 0.10% 109 22069 0.11% 110 23158 0.11% 111 24401 0.12% 112 25851 0.13% 113 26939 0.13% 114 28265 0.14% 115 29831 0.15% 116 31197 0.15% 117 32449 0.16% 118 33249 0.16% 119 34211 0.17% 120 35740 0.18% 121 37077 0.18% 122 38591 0.19% 123 40212 0.20% 124 42485 0.21% 125 44084 0.22% 126 45746 0.23% 127 46428 0.23% 128 47878 0.24% 129 49151 0.24% 130 50663 0.25% 131 52576 0.26% 132 54734 0.27% 133 56952 0.28% 134 58925 0.29% 135 62372 0.31% 136 63753 0.31% 137 66344 0.33% 138 69308 0.34% 139 72704 0.36% 140 76299 0.38% 141 80662 0.40% 142 87609 0.43% 143 94830 0.47% 144 106890 0.53% 145 123124 0.61% 146 146915 0.72% 147 187715 0.93% 148 272245 1.34% 149 579403 2.86% 150 3967550 19.56% 151 12902851 63.62% 20280540 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=18 prefix-density=0.58 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=63.89 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=25 prefix-density=0.44 prefix-fanout=2.9 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=170.30 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=10.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958242 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:28:39 Started mapping on | Dec 06 17:28:39 Finished on | Dec 06 17:30:15 Mapping speed, Million of reads per hour | 760.52 Number of input reads | 20280540 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19843523 Uniquely mapped reads % | 97.85% Average mapped length | 295.75 Number of splices: Total | 21774067 Number of splices: Annotated (sjdb) | 20414699 Number of splices: GT/AG | 21488777 Number of splices: GC/AG | 256687 Number of splices: AT/AC | 9597 Number of splices: Non-canonical | 19006 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 141781 % of reads mapped to multiple loci | 0.70% Number of reads mapped to too many loci | 8629 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.19% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 310193 310193 310193 N_multimapping 141781 141781 141781 N_noFeature 769714 19263733 954796 N_ambiguous 469944 2964 75734 UnstrandedReadsAssigned:18603865 PositiveStrandReadsAssigned:576826 NegativeStrandReadsAssigned:18812993 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958242 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958242-trimmed-pair1.fastq SRR6958242-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,280,540 reads, 18,833,557 reads pseudoaligned [quant] estimated average fragment length: 267.225 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 SRR6958242.ke.tsv 35125 SRR6958242.se.tsv 88098 total ==> SRR6958242.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.387 0 0 PNS24247 1044 777.775 64.5397 6.49893 PNS24249 1928 1661.78 49.3236 2.32462 PNS24246 1044 777.775 64.5397 6.49893 PNS24248 1044 777.775 64.5397 6.49893 PNS24244 1471 1204.78 53.0572 3.44911 PNS24243 293 91.789 0 0 KQK14069 1603 1336.78 2913.98 170.725 KQK14071 474 230.173 81.9324 27.8786 ==> SRR6958242.se.tsv <== BRADI_1g14170v3 3393 BRADI_1g53295v3 242 BRADI_1g59795v3 458 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 343 BRADI_1g74790v3 83 BRADI_1g09890v3 0 BRADI_1g77505v3 296 BRADI_1g48960v3 0 SRR6958242 completed mapping pipeline successfully