Starting /dee2/code/volunteer_pipeline.sh SRR6958243 current disk space = 1550638166016 free memory = 1599984312 SRR6958243 SRAfilesize b7010d9e0d881637fe77dff8499db5a7 SRR6958243.sra SRR6958243.sra file validated SRR6958243 is paired end SRR6958243 is conventional basespace SRR6958243 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958243_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.70425 18.0 18.0 30.0 18.0 32.0 2 22.6795 18.0 18.0 27.0 18.0 31.0 3 27.3435 27.0 27.0 30.0 18.0 33.0 4 31.12875 31.0 30.0 33.0 29.0 33.0 5 32.19325 33.0 33.0 33.0 31.0 33.0 6 36.06425 37.0 36.0 38.0 33.0 38.0 7 37.338 38.0 38.0 38.0 36.0 38.0 8 37.5 38.0 38.0 38.0 37.0 38.0 9 37.62575 38.0 38.0 38.0 38.0 38.0 10-14 37.59325 38.0 38.0 38.0 38.0 38.0 15-19 37.608900000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.588100000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5989 38.0 38.0 38.0 38.0 38.0 30-34 37.5546 38.0 38.0 38.0 38.0 38.0 35-39 37.5396 38.0 38.0 38.0 37.8 38.0 40-44 37.39365 38.0 38.0 38.0 37.0 38.0 45-49 37.40925 38.0 38.0 38.0 37.2 38.0 50-54 37.4756 38.0 38.0 38.0 37.2 38.0 55-59 37.424549999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.357949999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.052749999999996 38.0 38.0 38.0 35.8 38.0 70-74 37.12075 38.0 38.0 38.0 36.0 38.0 75-79 37.22580000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.17115 38.0 38.0 38.0 36.0 38.0 85-89 36.6305 38.0 37.6 38.0 33.8 38.0 90-94 36.8239 38.0 37.8 38.0 34.6 38.0 95-99 36.958749999999995 38.0 38.0 38.0 35.4 38.0 100-104 36.696549999999995 38.0 38.0 38.0 34.6 38.0 105-109 36.773450000000004 38.0 38.0 38.0 35.0 38.0 110-114 36.612649999999995 38.0 38.0 38.0 34.2 38.0 115-119 36.5066 38.0 38.0 38.0 34.2 38.0 120-124 36.334199999999996 38.0 37.6 38.0 33.8 38.0 125-129 36.22145 38.0 37.4 38.0 33.4 38.0 130-134 36.2466 38.0 37.6 38.0 33.8 38.0 135-139 35.984049999999996 38.0 36.4 38.0 33.0 38.0 140-144 34.57405 38.0 34.6 38.0 26.8 38.0 145-149 34.85215 38.0 34.8 38.0 28.6 38.0 150-151 31.64425 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 4.0 18 0.0 19 0.0 20 0.0 21 1.0 22 6.0 23 2.0 24 7.0 25 5.0 26 11.0 27 11.0 28 10.0 29 20.0 30 16.0 31 37.0 32 55.0 33 83.0 34 166.0 35 317.0 36 952.0 37 2295.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.842907981698016 30.32536858159634 6.354855109303507 36.47686832740214 2 22.475 17.625 27.825 32.074999999999996 3 21.825 19.725 25.775 32.675 4 25.724999999999998 25.55 23.1 25.624999999999996 5 25.45 30.85 23.075000000000003 20.625 6 22.025 33.675 23.825 20.474999999999998 7 15.8 22.1 43.35 18.75 8 19.650000000000002 23.525 30.025000000000002 26.8 9 18.475 21.925 34.675 24.925 10-14 21.745 27.845 26.265 24.145 15-19 21.45 26.695 26.865 24.990000000000002 20-24 22.12 26.590000000000003 26.815 24.474999999999998 25-29 22.645 26.41 26.695 24.25 30-34 22.5 26.58 27.015 23.905 35-39 21.98 26.040000000000003 27.534999999999997 24.445 40-44 22.28 26.31 26.974999999999998 24.435000000000002 45-49 22.325 26.595000000000002 26.185000000000002 24.895 50-54 22.564999999999998 26.939999999999998 26.900000000000002 23.595 55-59 22.515 26.58 26.455000000000002 24.45 60-64 22.105 26.46 26.685 24.75 65-69 22.49 26.16 26.979999999999997 24.37 70-74 22.43 26.46 26.83 24.279999999999998 75-79 22.185 26.815 26.369999999999997 24.63 80-84 22.43 26.810000000000002 26.224999999999998 24.535 85-89 22.55 26.135 26.71 24.605 90-94 22.275 25.979999999999997 27.034999999999997 24.709999999999997 95-99 21.995 25.779999999999998 26.72 25.505 100-104 21.718687474989995 26.565626250500202 26.850740296118445 24.864945978391358 105-109 22.295 25.555 27.12 25.03 110-114 22.858000300105036 26.914420047016456 25.724003401190416 24.50357625168809 115-119 22.699079631852744 25.995398159263704 26.815726290516206 24.489795918367346 120-124 22.665 26.384999999999998 25.759999999999998 25.19 125-129 22.067067067067068 26.576576576576578 26.046046046046044 25.310310310310307 130-134 22.46 26.275 25.95 25.314999999999998 135-139 22.81 26.479999999999997 25.765 24.945 140-144 22.48 26.395000000000003 25.905 25.22 145-149 22.445 26.645000000000003 25.624999999999996 25.285000000000004 150-151 22.35 26.3625 25.7125 25.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.5 28 7.0 29 8.5 30 14.0 31 17.0 32 19.5 33 31.0 34 38.0 35 50.5 36 62.0 37 87.0 38 111.0 39 119.0 40 152.5 41 190.0 42 216.0 43 226.0 44 232.0 45 241.0 46 223.0 47 208.5 48 204.0 49 177.5 50 165.0 51 149.5 52 115.0 53 104.5 54 97.0 55 94.5 56 91.5 57 75.5 58 64.5 59 52.0 60 51.5 61 46.0 62 33.0 63 30.0 64 29.0 65 31.5 66 31.5 67 25.5 68 16.5 69 13.5 70 12.5 71 8.0 72 5.0 73 5.5 74 5.0 75 4.5 76 2.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.034999999999999996 115-119 0.04 120-124 0.0 125-129 0.1 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1625 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 2.9625000000000004 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.9000000000000004 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.825 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.6875 0.0 0.0 0.0 0.0 134-135 6.1125 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138-139 7.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958243 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958243_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.52425 33.0 31.0 34.0 18.0 34.0 2 32.2605 33.0 32.0 34.0 27.0 34.0 3 32.76475 33.0 33.0 34.0 32.0 34.0 4 33.071 33.0 33.0 34.0 32.0 34.0 5 33.14425 34.0 33.0 34.0 33.0 34.0 6 37.4715 38.0 38.0 38.0 38.0 38.0 7 37.45875 38.0 38.0 38.0 38.0 38.0 8 37.4695 38.0 38.0 38.0 38.0 38.0 9 37.48275 38.0 38.0 38.0 38.0 38.0 10-14 37.4736 38.0 38.0 38.0 38.0 38.0 15-19 36.753499999999995 38.0 37.8 38.0 34.8 38.0 20-24 36.6797 38.0 37.8 38.0 34.8 38.0 25-29 37.36650000000001 38.0 38.0 38.0 37.6 38.0 30-34 37.44885 38.0 38.0 38.0 38.0 38.0 35-39 37.4099 38.0 38.0 38.0 38.0 38.0 40-44 37.3174 38.0 38.0 38.0 37.8 38.0 45-49 36.579449999999994 38.0 37.4 38.0 34.0 38.0 50-54 37.398199999999996 38.0 38.0 38.0 38.0 38.0 55-59 37.38765 38.0 38.0 38.0 38.0 38.0 60-64 37.34734999999999 38.0 38.0 38.0 37.8 38.0 65-69 37.3458 38.0 38.0 38.0 37.8 38.0 70-74 37.259550000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.20675000000001 38.0 38.0 38.0 37.0 38.0 80-84 37.161699999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.132799999999996 38.0 38.0 38.0 37.0 38.0 90-94 37.08275 38.0 38.0 38.0 36.6 38.0 95-99 37.00105 38.0 38.0 38.0 36.2 38.0 100-104 36.8583 38.0 38.0 38.0 36.0 38.0 105-109 36.77735 38.0 38.0 38.0 35.2 38.0 110-114 35.90995 38.0 37.2 38.0 29.6 38.0 115-119 36.6702 38.0 38.0 38.0 35.0 38.0 120-124 36.470600000000005 38.0 38.0 38.0 34.4 38.0 125-129 35.534150000000004 38.0 36.8 38.0 29.0 38.0 130-134 35.3982 38.0 36.4 38.0 30.0 38.0 135-139 35.185249999999996 38.0 36.4 38.0 29.2 38.0 140-144 34.990899999999996 38.0 35.6 38.0 29.6 38.0 145-149 33.70405000000001 38.0 34.6 38.0 24.4 38.0 150-151 29.775625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 2.0 5 0.0 6 2.0 7 0.0 8 1.0 9 3.0 10 0.0 11 1.0 12 3.0 13 1.0 14 1.0 15 2.0 16 2.0 17 0.0 18 1.0 19 4.0 20 5.0 21 4.0 22 3.0 23 4.0 24 3.0 25 9.0 26 10.0 27 14.0 28 16.0 29 16.0 30 17.0 31 30.0 32 54.0 33 63.0 34 134.0 35 266.0 36 747.0 37 2574.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.625 21.15 8.425 23.799999999999997 2 28.95 24.8 27.900000000000002 18.35 3 22.125 26.400000000000002 29.4 22.075 4 25.324999999999996 33.675 21.224999999999998 19.775000000000002 5 26.325 33.900000000000006 20.875 18.9 6 23.25 37.875 19.775000000000002 19.1 7 21.425 20.474999999999998 36.825 21.275 8 23.875 23.9 25.8 26.424999999999997 9 23.275000000000002 23.425 28.249999999999996 25.05 10-14 25.509999999999998 27.58 24.365000000000002 22.545 15-19 25.230000000000004 26.72 25.465 22.585 20-24 24.6 27.034999999999997 26.0 22.365 25-29 24.82 26.57 25.86 22.75 30-34 24.86 26.3 25.83 23.01 35-39 24.759999999999998 26.395000000000003 26.05 22.795 40-44 24.610000000000003 26.540000000000003 25.230000000000004 23.62 45-49 25.085 27.04 25.295 22.58 50-54 24.65 26.99 25.919999999999998 22.439999999999998 55-59 24.779999999999998 26.584999999999997 25.7 22.935 60-64 24.79 26.729999999999997 25.779999999999998 22.7 65-69 25.005 26.779999999999998 25.900000000000002 22.314999999999998 70-74 24.75 26.179999999999996 25.874999999999996 23.195 75-79 24.85 26.32 26.14 22.689999999999998 80-84 25.374999999999996 26.865 25.509999999999998 22.25 85-89 24.985 26.44 25.915 22.66 90-94 24.545 27.37 25.490000000000002 22.595000000000002 95-99 24.85 26.68 26.284999999999997 22.185 100-104 25.215 26.625 25.845000000000002 22.314999999999998 105-109 25.221261063053152 26.766338316915846 25.971298564928247 22.041102055102755 110-114 24.81 26.775 26.334999999999997 22.08 115-119 25.71 26.735 25.905 21.65 120-124 25.19 27.060000000000002 25.330000000000002 22.42 125-129 25.915 26.765 25.474999999999998 21.845 130-134 25.94 27.38 25.36 21.32 135-139 25.645 26.415 26.169999999999998 21.77 140-144 26.445 26.529999999999998 25.775 21.25 145-149 25.814999999999998 27.38 25.180000000000003 21.625 150-151 26.375 27.437499999999996 25.0375 21.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 2.0 23 1.0 24 1.0 25 2.5 26 3.0 27 4.0 28 7.5 29 7.5 30 10.0 31 15.5 32 23.0 33 29.5 34 33.5 35 43.0 36 58.0 37 76.5 38 101.0 39 122.5 40 134.0 41 158.0 42 194.5 43 211.0 44 215.5 45 211.5 46 205.0 47 210.0 48 198.0 49 188.5 50 184.0 51 160.0 52 130.0 53 115.5 54 106.5 55 95.5 56 81.0 57 69.5 58 67.5 59 57.5 60 59.5 61 63.0 62 50.5 63 46.0 64 41.5 65 35.5 66 32.0 67 28.5 68 26.0 69 20.0 70 17.0 71 13.0 72 10.0 73 9.5 74 6.0 75 1.5 76 1.0 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4462622703247 98.775 2 0.47822803926503904 0.95 3 0.025169896803423106 0.075 4 0.05033979360684621 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1625 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.725 0.0 0.0 0.0 0.0 126-127 4.137499999999999 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 5.0375 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.8375 0.0 0.0 0.0 0.0 136-137 6.4125 0.0 0.0 0.0 0.0 138-139 7.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGTTA 10 0.006830828 145.0 2 AAGTCAA 10 0.006830828 145.0 4 >>END_MODULE Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706639 spots for SRR6958243.sra Written 706639 spots for SRR6958243.sra Read 706644 spots for SRR6958243.sra Written 706644 spots for SRR6958243.sra SRR ids: ['SRR6958243.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__fucxvhx SRR6958243.sra spots: 14132785 blocks: [[1, 706639], [706640, 1413278], [1413279, 2119917], [2119918, 2826556], [2826557, 3533195], [3533196, 4239834], [4239835, 4946473], [4946474, 5653112], [5653113, 6359751], [6359752, 7066390], [7066391, 7773029], [7773030, 8479668], [8479669, 9186307], [9186308, 9892946], [9892947, 10599585], [10599586, 11306224], [11306225, 12012863], [12012864, 12719502], [12719503, 13426141], [13426142, 14132785]] SRR6958243 file size 4767436 SRR6958243 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958243 SRR6958243_1.fastq SRR6958243_2.fastq Input file: SRR6958243_1.fastq Paired file: SRR6958243_2.fastq trimmed: SRR6958243-trimmed-pair1.fastq, SRR6958243-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:27:22 2024 >> started Fri Dec 6 17:27:37 2024 >> done (15.731s) 14132785 read pairs processed; of these: 10158 ( 0.07%) short read pairs filtered out after trimming by size control 12891 ( 0.09%) empty read pairs filtered out after trimming by size control 14109736 (99.84%) read pairs available; of these: 5492026 (38.92%) trimmed read pairs available after processing 8617710 (61.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 7 0.00% 20 4 0.00% 21 7 0.00% 22 8 0.00% 23 6 0.00% 24 16 0.00% 25 9 0.00% 26 7 0.00% 27 9 0.00% 28 10 0.00% 29 9 0.00% 30 6 0.00% 31 14 0.00% 32 8 0.00% 33 10 0.00% 34 16 0.00% 35 16 0.00% 36 10 0.00% 37 14 0.00% 38 19 0.00% 39 23 0.00% 40 24 0.00% 41 17 0.00% 42 23 0.00% 43 24 0.00% 44 17 0.00% 45 27 0.00% 46 28 0.00% 47 31 0.00% 48 48 0.00% 49 45 0.00% 50 53 0.00% 51 54 0.00% 52 76 0.00% 53 65 0.00% 54 67 0.00% 55 69 0.00% 56 76 0.00% 57 109 0.00% 58 128 0.00% 59 126 0.00% 60 133 0.00% 61 173 0.00% 62 174 0.00% 63 200 0.00% 64 227 0.00% 65 213 0.00% 66 258 0.00% 67 309 0.00% 68 346 0.00% 69 410 0.00% 70 439 0.00% 71 525 0.00% 72 576 0.00% 73 654 0.00% 74 667 0.00% 75 784 0.01% 76 983 0.01% 77 1105 0.01% 78 1053 0.01% 79 1271 0.01% 80 1372 0.01% 81 1583 0.01% 82 1897 0.01% 83 2081 0.01% 84 2702 0.02% 85 3119 0.02% 86 3239 0.02% 87 3626 0.03% 88 3874 0.03% 89 4086 0.03% 90 4450 0.03% 91 4832 0.03% 92 5274 0.04% 93 5738 0.04% 94 6301 0.04% 95 6691 0.05% 96 7102 0.05% 97 7479 0.05% 98 7982 0.06% 99 8728 0.06% 100 10199 0.07% 101 11130 0.08% 102 10683 0.08% 103 11501 0.08% 104 12170 0.09% 105 12821 0.09% 106 13721 0.10% 107 14132 0.10% 108 14884 0.11% 109 15718 0.11% 110 16653 0.12% 111 17418 0.12% 112 18460 0.13% 113 19897 0.14% 114 20619 0.15% 115 21983 0.16% 116 22915 0.16% 117 23422 0.17% 118 24053 0.17% 119 24808 0.18% 120 25697 0.18% 121 26919 0.19% 122 28593 0.20% 123 29732 0.21% 124 31650 0.22% 125 32953 0.23% 126 33716 0.24% 127 34661 0.25% 128 35983 0.26% 129 36677 0.26% 130 38454 0.27% 131 39262 0.28% 132 41713 0.30% 133 43467 0.31% 134 45362 0.32% 135 47780 0.34% 136 49827 0.35% 137 51351 0.36% 138 53359 0.38% 139 56189 0.40% 140 59249 0.42% 141 62893 0.45% 142 68421 0.48% 143 74945 0.53% 144 84792 0.60% 145 100590 0.71% 146 122369 0.87% 147 153285 1.09% 148 245037 1.74% 149 486541 3.45% 150 2809369 19.91% 151 8617710 61.08% 14109736 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=15 prefix-density=0.70 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=37.09 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=4.03 fanout-score-rank=16 prefix-density=0.44 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=47.78 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.0 sequence=AGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958243 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:28:25 Started mapping on | Dec 06 17:28:25 Finished on | Dec 06 17:30:24 Mapping speed, Million of reads per hour | 426.85 Number of input reads | 14109736 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13441998 Uniquely mapped reads % | 95.27% Average mapped length | 294.80 Number of splices: Total | 14918650 Number of splices: Annotated (sjdb) | 14023365 Number of splices: GT/AG | 14706397 Number of splices: GC/AG | 173132 Number of splices: AT/AC | 5771 Number of splices: Non-canonical | 33350 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233148 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 23672 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 442448 442448 442448 N_multimapping 233148 233148 233148 N_noFeature 668529 13067082 789902 N_ambiguous 303035 1760 49997 UnstrandedReadsAssigned:12470434 PositiveStrandReadsAssigned:373156 NegativeStrandReadsAssigned:12602099 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958243 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958243-trimmed-pair1.fastq SRR6958243-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,109,736 reads, 12,641,498 reads pseudoaligned [quant] estimated average fragment length: 235.718 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52973 SRR6958243.ke.tsv 35125 SRR6958243.se.tsv 88098 total ==> SRR6958243.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 701.679 0 0 PNS24247 1044 809.282 41.088 6.12732 PNS24249 1928 1693.28 28.489 2.0305 PNS24246 1044 809.282 41.088 6.12732 PNS24248 1044 809.282 41.088 6.12732 PNS24244 1471 1236.28 35.2471 3.44082 PNS24243 293 93.5832 0 0 KQK14069 1603 1368.28 1751.69 154.503 KQK14071 474 245.724 43.685 21.4555 ==> SRR6958243.se.tsv <== BRADI_1g14170v3 2085 BRADI_1g53295v3 887 BRADI_1g59795v3 125 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 276 BRADI_1g74790v3 49 BRADI_1g09890v3 0 BRADI_1g77505v3 222 BRADI_1g48960v3 0 SRR6958243 completed mapping pipeline successfully