Starting /dee2/code/volunteer_pipeline.sh SRR6958244 current disk space = 1550611791872 free memory = 1603640160 SRR6958244 SRAfilesize ff50b49b3d7e26032b1c0d0b38814c88 SRR6958244.sra SRR6958244.sra file validated SRR6958244 is paired end SRR6958244 is conventional basespace SRR6958244 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958244_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.31225 25.0 18.0 31.0 18.0 32.0 2 30.7005 31.0 29.0 33.0 27.0 33.0 3 32.063 33.0 33.0 33.0 29.0 33.0 4 32.4955 33.0 33.0 33.0 32.0 34.0 5 32.82275 33.0 33.0 34.0 32.0 34.0 6 36.62075 38.0 37.0 38.0 34.0 38.0 7 37.27875 38.0 38.0 38.0 36.0 38.0 8 37.287 38.0 38.0 38.0 36.0 38.0 9 37.1295 38.0 38.0 38.0 36.0 38.0 10-14 37.38635000000001 38.0 38.0 38.0 37.2 38.0 15-19 37.3652 38.0 38.0 38.0 37.2 38.0 20-24 37.3036 38.0 38.0 38.0 36.8 38.0 25-29 36.7866 38.0 38.0 38.0 35.2 38.0 30-34 36.75365 38.0 37.8 38.0 34.4 38.0 35-39 37.15260000000001 38.0 38.0 38.0 36.4 38.0 40-44 37.4286 38.0 38.0 38.0 37.8 38.0 45-49 37.47425 38.0 38.0 38.0 38.0 38.0 50-54 37.41665 38.0 38.0 38.0 38.0 38.0 55-59 36.923049999999996 38.0 38.0 38.0 35.2 38.0 60-64 36.79745 38.0 37.8 38.0 34.8 38.0 65-69 37.30865 38.0 38.0 38.0 37.2 38.0 70-74 37.3058 38.0 38.0 38.0 37.0 38.0 75-79 36.0928 38.0 37.2 38.0 31.6 38.0 80-84 36.52155 38.0 37.4 38.0 33.6 38.0 85-89 37.0729 38.0 38.0 38.0 36.0 38.0 90-94 37.186899999999994 38.0 38.0 38.0 36.8 38.0 95-99 37.05135 38.0 38.0 38.0 36.0 38.0 100-104 36.89435 38.0 38.0 38.0 35.6 38.0 105-109 36.7633 38.0 38.0 38.0 35.0 38.0 110-114 36.9129 38.0 38.0 38.0 35.8 38.0 115-119 36.74695 38.0 38.0 38.0 35.0 38.0 120-124 36.44985 38.0 38.0 38.0 34.4 38.0 125-129 36.3996 38.0 38.0 38.0 34.2 38.0 130-134 35.66455 38.0 36.8 38.0 30.0 38.0 135-139 34.3239 38.0 34.0 38.0 24.0 38.0 140-144 35.31849999999999 38.0 35.6 38.0 29.6 38.0 145-149 35.6055 38.0 36.8 38.0 32.4 38.0 150-151 32.216375 35.5 33.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 2.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 3.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 6.0 20 1.0 21 3.0 22 5.0 23 4.0 24 9.0 25 8.0 26 10.0 27 13.0 28 12.0 29 19.0 30 36.0 31 52.0 32 61.0 33 80.0 34 115.0 35 260.0 36 779.0 37 2515.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.24999999999999 11.198979591836734 6.73469387755102 30.816326530612244 2 26.674999999999997 11.225 33.050000000000004 29.049999999999997 3 22.475 17.125 25.3 35.099999999999994 4 26.724999999999998 25.15 21.0 27.125 5 25.95 29.65 23.375 21.025 6 23.75 31.8 22.375 22.075 7 18.8 23.3 38.824999999999996 19.075 8 20.7 23.125 29.5 26.674999999999997 9 19.875 20.1 33.475 26.55 10-14 23.87 26.340000000000003 25.019999999999996 24.77 15-19 23.73 24.465 25.590000000000003 26.215 20-24 23.655 24.66 25.540000000000003 26.145000000000003 25-29 23.53 24.759999999999998 26.275 25.435000000000002 30-34 23.625 24.93 25.765 25.679999999999996 35-39 23.395 24.705 25.195 26.705000000000002 40-44 23.91 24.84 26.025 25.224999999999998 45-49 23.04 25.165 25.180000000000003 26.615 50-54 24.345 24.16 25.365 26.13 55-59 23.79 24.72 25.845000000000002 25.645 60-64 24.08 24.485 25.27 26.165 65-69 23.622362236223623 25.252525252525253 25.36253625362536 25.762576257625764 70-74 24.09 24.825 25.345000000000002 25.740000000000002 75-79 23.799999999999997 24.775 25.7 25.724999999999998 80-84 23.955000000000002 25.2 25.295 25.55 85-89 24.095 24.64 25.305 25.96 90-94 24.855 25.03 24.385 25.729999999999997 95-99 23.965 24.26 25.805 25.97 100-104 24.52 24.855 25.22 25.405 105-109 24.34 24.59 25.105 25.965 110-114 24.48 24.26 24.755 26.505000000000003 115-119 23.94 25.36 24.315 26.384999999999998 120-124 24.82 24.565 24.97 25.645 125-129 24.845 24.77 24.175 26.21 130-134 24.235 25.105 24.745 25.915 135-139 24.709999999999997 24.33 24.905 26.055 140-144 24.035 25.055 24.474999999999998 26.435 145-149 24.8 24.595 24.355 26.25 150-151 24.8625 25.9875 23.025000000000002 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 0.5 26 0.5 27 0.5 28 2.0 29 6.5 30 9.0 31 11.0 32 15.5 33 19.5 34 23.0 35 30.5 36 41.0 37 54.0 38 68.0 39 90.0 40 110.5 41 128.5 42 162.5 43 182.5 44 194.5 45 201.0 46 197.5 47 183.5 48 168.0 49 172.0 50 168.5 51 147.5 52 133.5 53 131.5 54 113.0 55 94.5 56 92.0 57 90.5 58 85.5 59 89.0 60 88.5 61 82.0 62 78.5 63 71.0 64 66.5 65 64.5 66 53.0 67 45.0 68 44.5 69 43.0 70 35.5 71 23.0 72 20.5 73 17.5 74 14.5 75 12.0 76 6.0 77 3.0 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85902636916836 97.475 2 0.9127789046653144 1.7999999999999998 3 0.17748478701825557 0.525 4 0.05070993914807302 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.8499999999999996 0.0 0.0 0.0 0.0 126-127 4.175 0.0 0.0 0.0 0.0 128-129 4.574999999999999 0.0 0.0 0.0 0.0 130-131 4.887499999999999 0.0 0.0 0.0 0.0 132-133 5.262499999999999 0.0 0.0 0.0 0.0 134-135 5.9125 0.0 0.0 0.0 0.0 136-137 6.487500000000001 0.0 0.0 0.0 0.0 138-139 7.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCACC 10 0.006832588 144.9875 7 TATATAT 20 0.0059376103 28.9975 125-129 TTTTTTT 30 0.0014445208 24.164585 50-54 >>END_MODULE SRR6958244 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958244_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9565 33.0 33.0 34.0 32.0 34.0 2 33.08825 34.0 33.0 34.0 33.0 34.0 3 33.18325 34.0 33.0 34.0 33.0 34.0 4 33.06225 34.0 33.0 34.0 33.0 34.0 5 33.0085 34.0 33.0 34.0 33.0 34.0 6 37.21075 38.0 38.0 38.0 37.0 38.0 7 37.274 38.0 38.0 38.0 37.0 38.0 8 37.25575 38.0 38.0 38.0 37.0 38.0 9 37.14725 38.0 38.0 38.0 37.0 38.0 10-14 37.169850000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.273199999999996 38.0 38.0 38.0 37.6 38.0 20-24 37.27605 38.0 38.0 38.0 37.8 38.0 25-29 37.16135 38.0 38.0 38.0 37.2 38.0 30-34 37.1826 38.0 38.0 38.0 37.4 38.0 35-39 37.0897 38.0 38.0 38.0 37.0 38.0 40-44 36.7569 38.0 38.0 38.0 35.8 38.0 45-49 36.8091 38.0 38.0 38.0 36.2 38.0 50-54 36.87235 38.0 38.0 38.0 36.4 38.0 55-59 37.035650000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.04235 38.0 38.0 38.0 37.0 38.0 65-69 36.970549999999996 38.0 38.0 38.0 36.8 38.0 70-74 36.96695 38.0 38.0 38.0 36.6 38.0 75-79 36.965650000000004 38.0 38.0 38.0 36.8 38.0 80-84 36.7772 38.0 38.0 38.0 35.6 38.0 85-89 36.66605 38.0 38.0 38.0 35.2 38.0 90-94 36.5895 38.0 38.0 38.0 35.0 38.0 95-99 36.45455 38.0 38.0 38.0 34.8 38.0 100-104 36.445550000000004 38.0 38.0 38.0 34.6 38.0 105-109 36.4978 38.0 38.0 38.0 34.8 38.0 110-114 36.3097 38.0 38.0 38.0 34.6 38.0 115-119 36.18915 38.0 38.0 38.0 34.0 38.0 120-124 35.996050000000004 38.0 38.0 38.0 33.6 38.0 125-129 35.816250000000004 38.0 38.0 38.0 32.8 38.0 130-134 35.74545 38.0 38.0 38.0 33.0 38.0 135-139 35.5298 38.0 37.4 38.0 31.6 38.0 140-144 35.228899999999996 38.0 36.0 38.0 31.0 38.0 145-149 34.7268 38.0 36.0 38.0 30.6 38.0 150-151 30.785874999999997 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 3.0 4 3.0 5 2.0 6 2.0 7 1.0 8 0.0 9 0.0 10 2.0 11 2.0 12 1.0 13 4.0 14 1.0 15 3.0 16 2.0 17 5.0 18 2.0 19 1.0 20 5.0 21 5.0 22 5.0 23 8.0 24 9.0 25 13.0 26 18.0 27 26.0 28 22.0 29 23.0 30 31.0 31 46.0 32 60.0 33 73.0 34 88.0 35 181.0 36 427.0 37 2913.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.175 19.7 8.05 25.074999999999996 2 28.65 23.35 26.3 21.7 3 23.549999999999997 24.125 27.950000000000003 24.375 4 25.3 30.875000000000004 20.0 23.825 5 27.200000000000003 33.45 19.05 20.3 6 26.0 33.925 18.375 21.7 7 22.7 20.25 32.550000000000004 24.5 8 24.275 23.400000000000002 23.7 28.625 9 24.2 22.325 26.5 26.974999999999998 10-14 26.415 25.264999999999997 23.185 25.135 15-19 25.682568256825682 24.672467246724672 24.197419741974198 25.447544754475448 20-24 25.595000000000002 25.205 24.505 24.695 25-29 25.995 25.014999999999997 23.54 25.45 30-34 25.240000000000002 24.915000000000003 24.16 25.685000000000002 35-39 25.72 25.014999999999997 24.27 24.995 40-44 25.845000000000002 24.7 24.005000000000003 25.45 45-49 25.89 24.915000000000003 23.96 25.235000000000003 50-54 26.08 24.88 23.93 25.11 55-59 26.834999999999997 24.315 23.825 25.025 60-64 25.805 24.3 24.665 25.230000000000004 65-69 26.205000000000002 24.755 24.055 24.985 70-74 26.590000000000003 24.635 24.325 24.45 75-79 25.88 24.465 24.955 24.7 80-84 26.055 24.685000000000002 24.195 25.064999999999998 85-89 26.424999999999997 24.755 24.15 24.67 90-94 25.75 25.545 23.974999999999998 24.73 95-99 26.01130056502825 25.27626381319066 24.16620831041552 24.546227311365566 100-104 26.479999999999997 25.0 23.95 24.57 105-109 26.415 25.045 23.97 24.57 110-114 26.419999999999998 24.875 24.195 24.51 115-119 26.573986097914688 25.6588488273241 23.938590788618292 23.82857428614292 120-124 27.134999999999998 25.174999999999997 24.0 23.69 125-129 27.195000000000004 25.435000000000002 23.615 23.755000000000003 130-134 27.07 25.705 23.62 23.605 135-139 27.195000000000004 25.46 24.095 23.25 140-144 27.466373318665934 26.146307315365767 23.201160058002902 23.186159307965397 145-149 27.205000000000002 26.63 23.169999999999998 22.994999999999997 150-151 28.537499999999998 25.912499999999998 22.8625 22.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 4.0 27 6.0 28 4.0 29 3.0 30 6.5 31 10.5 32 10.5 33 14.0 34 16.0 35 21.5 36 40.0 37 51.0 38 62.5 39 83.0 40 106.0 41 128.0 42 145.0 43 156.5 44 160.5 45 175.0 46 180.0 47 164.0 48 164.0 49 172.5 50 177.0 51 156.5 52 125.0 53 120.5 54 114.0 55 101.5 56 93.5 57 96.0 58 101.0 59 100.0 60 92.5 61 93.0 62 100.0 63 92.0 64 81.0 65 75.0 66 64.5 67 58.0 68 54.5 69 42.0 70 36.0 71 34.5 72 27.0 73 21.0 74 21.0 75 15.0 76 7.0 77 4.5 78 3.0 79 1.5 80 0.5 81 1.5 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06091370558376 97.575 2 0.6598984771573604 1.3 3 0.12690355329949238 0.375 4 0.050761421319796954 0.2 5 0.050761421319796954 0.25 6 0.050761421319796954 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCCGTTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit CACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTTAA 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.8375 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 6.1125 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGTGG 10 0.006830828 145.0 8 >>END_MODULE Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203442 spots for SRR6958244.sra Written 1203442 spots for SRR6958244.sra Read 1203453 spots for SRR6958244.sra Written 1203453 spots for SRR6958244.sra SRR ids: ['SRR6958244.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9so0xmxm SRR6958244.sra spots: 24068851 blocks: [[1, 1203442], [1203443, 2406884], [2406885, 3610326], [3610327, 4813768], [4813769, 6017210], [6017211, 7220652], [7220653, 8424094], [8424095, 9627536], [9627537, 10830978], [10830979, 12034420], [12034421, 13237862], [13237863, 14441304], [14441305, 15644746], [15644747, 16848188], [16848189, 18051630], [18051631, 19255072], [19255073, 20458514], [20458515, 21661956], [21661957, 22865398], [22865399, 24068851]] SRR6958244 file size 8134443 SRR6958244 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958244 SRR6958244_1.fastq SRR6958244_2.fastq Input file: SRR6958244_1.fastq Paired file: SRR6958244_2.fastq trimmed: SRR6958244-trimmed-pair1.fastq, SRR6958244-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:31:41 2024 >> started Fri Dec 6 17:32:09 2024 >> done (27.989s) 24068851 read pairs processed; of these: 36414 ( 0.15%) short read pairs filtered out after trimming by size control 30526 ( 0.13%) empty read pairs filtered out after trimming by size control 24001911 (99.72%) read pairs available; of these: 8767708 (36.53%) trimmed read pairs available after processing 15234203 (63.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 10 0.00% 20 7 0.00% 21 16 0.00% 22 21 0.00% 23 24 0.00% 24 24 0.00% 25 18 0.00% 26 27 0.00% 27 37 0.00% 28 55 0.00% 29 32 0.00% 30 25 0.00% 31 37 0.00% 32 29 0.00% 33 25 0.00% 34 32 0.00% 35 21 0.00% 36 26 0.00% 37 33 0.00% 38 39 0.00% 39 46 0.00% 40 53 0.00% 41 38 0.00% 42 48 0.00% 43 51 0.00% 44 48 0.00% 45 52 0.00% 46 51 0.00% 47 65 0.00% 48 81 0.00% 49 96 0.00% 50 109 0.00% 51 94 0.00% 52 127 0.00% 53 112 0.00% 54 145 0.00% 55 158 0.00% 56 148 0.00% 57 185 0.00% 58 190 0.00% 59 235 0.00% 60 292 0.00% 61 294 0.00% 62 359 0.00% 63 378 0.00% 64 424 0.00% 65 418 0.00% 66 506 0.00% 67 494 0.00% 68 606 0.00% 69 736 0.00% 70 836 0.00% 71 920 0.00% 72 1096 0.00% 73 1152 0.00% 74 1337 0.01% 75 1426 0.01% 76 1686 0.01% 77 1861 0.01% 78 2064 0.01% 79 2249 0.01% 80 2664 0.01% 81 3032 0.01% 82 3361 0.01% 83 3862 0.02% 84 5822 0.02% 85 7086 0.03% 86 7662 0.03% 87 8103 0.03% 88 8758 0.04% 89 8949 0.04% 90 9720 0.04% 91 10249 0.04% 92 11018 0.05% 93 11555 0.05% 94 12327 0.05% 95 12945 0.05% 96 13482 0.06% 97 14513 0.06% 98 15139 0.06% 99 16163 0.07% 100 17489 0.07% 101 18834 0.08% 102 20368 0.08% 103 21422 0.09% 104 23069 0.10% 105 24253 0.10% 106 25849 0.11% 107 26542 0.11% 108 27550 0.11% 109 29110 0.12% 110 30516 0.13% 111 32694 0.14% 112 34646 0.14% 113 36395 0.15% 114 38701 0.16% 115 40085 0.17% 116 41300 0.17% 117 42472 0.18% 118 43673 0.18% 119 44665 0.19% 120 46330 0.19% 121 48569 0.20% 122 50703 0.21% 123 53022 0.22% 124 56304 0.23% 125 57999 0.24% 126 59584 0.25% 127 60447 0.25% 128 61695 0.26% 129 63636 0.27% 130 65689 0.27% 131 68248 0.28% 132 70991 0.30% 133 74874 0.31% 134 77445 0.32% 135 80499 0.34% 136 83445 0.35% 137 85389 0.36% 138 88076 0.37% 139 92521 0.39% 140 96607 0.40% 141 101303 0.42% 142 112215 0.47% 143 130194 0.54% 144 132218 0.55% 145 152413 0.64% 146 183476 0.76% 147 241905 1.01% 148 350488 1.46% 149 634904 2.65% 150 4458658 18.58% 151 15234203 63.47% 24001911 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=16 prefix-density=0.98 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=43.44 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=17 prefix-density=0.61 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=78.37 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958244 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:33:00 Started mapping on | Dec 06 17:33:01 Finished on | Dec 06 17:35:40 Mapping speed, Million of reads per hour | 543.44 Number of input reads | 24001911 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 23096279 Uniquely mapped reads % | 96.23% Average mapped length | 294.52 Number of splices: Total | 25653303 Number of splices: Annotated (sjdb) | 24128272 Number of splices: GT/AG | 25300411 Number of splices: GC/AG | 293156 Number of splices: AT/AC | 8789 Number of splices: Non-canonical | 50947 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272979 % of reads mapped to multiple loci | 1.14% Number of reads mapped to too many loci | 10942 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 663397 663397 663397 N_multimapping 272979 272979 272979 N_noFeature 692588 22380259 888545 N_ambiguous 605435 3041 86391 UnstrandedReadsAssigned:21798256 PositiveStrandReadsAssigned:712979 NegativeStrandReadsAssigned:22121343 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958244 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958244-trimmed-pair1.fastq SRR6958244-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,001,911 reads, 22,125,848 reads pseudoaligned [quant] estimated average fragment length: 256.55 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,277 rounds 52973 SRR6958244.ke.tsv 35125 SRR6958244.se.tsv 88098 total ==> SRR6958244.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.116 0 0 PNS24247 1044 788.45 57.3565 4.70778 PNS24249 1928 1672.45 45.2492 1.75091 PNS24246 1044 788.45 57.3565 4.70778 PNS24248 1044 788.45 57.3565 4.70778 PNS24244 1471 1215.45 51.6814 2.75172 PNS24243 293 95.1421 0 0 KQK14069 1603 1347.45 6542.14 314.206 KQK14071 474 238.624 64.2541 17.4258 ==> SRR6958244.se.tsv <== BRADI_1g14170v3 7109 BRADI_1g53295v3 950 BRADI_1g59795v3 99 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 473 BRADI_1g74790v3 111 BRADI_1g09890v3 0 BRADI_1g77505v3 275 BRADI_1g48960v3 0 SRR6958244 completed mapping pipeline successfully