Starting /dee2/code/volunteer_pipeline.sh SRR6958245 current disk space = 1550638383104 free memory = 1296934028 SRR6958245 SRAfilesize 5f445c5942658a519053b5dcbb1d639a SRR6958245.sra SRR6958245.sra file validated SRR6958245 is paired end SRR6958245 is conventional basespace SRR6958245 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958245_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.266 33.0 33.0 33.0 32.0 34.0 2 30.188 31.0 29.0 33.0 25.0 33.0 3 29.26625 31.0 28.0 33.0 18.0 33.0 4 31.4205 33.0 31.0 33.0 29.0 33.0 5 32.64575 33.0 33.0 33.0 32.0 34.0 6 36.06375 38.0 36.0 38.0 33.0 38.0 7 36.79425 38.0 37.0 38.0 34.0 38.0 8 37.11825 38.0 38.0 38.0 35.0 38.0 9 37.37125 38.0 38.0 38.0 37.0 38.0 10-14 37.487649999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.568799999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.56815 38.0 38.0 38.0 38.0 38.0 25-29 37.55795 38.0 38.0 38.0 38.0 38.0 30-34 37.52755 38.0 38.0 38.0 38.0 38.0 35-39 37.47260000000001 38.0 38.0 38.0 37.2 38.0 40-44 37.445800000000006 38.0 38.0 38.0 37.2 38.0 45-49 37.428000000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.3716 38.0 38.0 38.0 37.0 38.0 55-59 37.33635 38.0 38.0 38.0 37.0 38.0 60-64 36.6608 38.0 38.0 38.0 36.0 38.0 65-69 37.042049999999996 38.0 38.0 38.0 35.6 38.0 70-74 37.2085 38.0 38.0 38.0 36.0 38.0 75-79 37.13175 38.0 38.0 38.0 36.0 38.0 80-84 37.050149999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.977149999999995 38.0 38.0 38.0 35.8 38.0 90-94 36.94185 38.0 38.0 38.0 35.4 38.0 95-99 36.82795 38.0 38.0 38.0 35.0 38.0 100-104 36.6999 38.0 38.0 38.0 34.8 38.0 105-109 36.54395 38.0 38.0 38.0 34.2 38.0 110-114 36.4927 38.0 38.0 38.0 34.0 38.0 115-119 36.38125 38.0 38.0 38.0 34.0 38.0 120-124 36.1507 38.0 37.4 38.0 33.4 38.0 125-129 35.8116 38.0 37.0 38.0 31.6 38.0 130-134 35.30929999999999 38.0 36.0 38.0 31.0 38.0 135-139 34.91775 38.0 35.8 38.0 29.8 38.0 140-144 34.52409999999999 38.0 35.8 38.0 27.2 38.0 145-149 33.954750000000004 38.0 34.2 38.0 25.8 38.0 150-151 29.234875 35.5 26.5 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 3.0 22 5.0 23 7.0 24 6.0 25 7.0 26 9.0 27 17.0 28 20.0 29 31.0 30 42.0 31 56.0 32 63.0 33 98.0 34 153.0 35 265.0 36 771.0 37 2437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.15 9.625 8.55 36.675000000000004 2 22.6 10.9 35.949999999999996 30.55 3 22.075 15.525 27.05 35.35 4 26.60665166291573 21.530382595648913 22.95573893473368 28.907226806701676 5 27.750000000000004 26.55 23.599999999999998 22.1 6 24.3 29.575000000000003 23.65 22.475 7 18.925 24.075 38.4 18.6 8 21.175 23.05 29.325000000000003 26.450000000000003 9 21.75 20.200000000000003 33.025 25.025 10-14 23.380845211302827 26.241560390097522 26.09152288072018 24.28607151787947 15-19 23.375 24.884999999999998 26.41 25.330000000000002 20-24 23.474999999999998 24.925 26.525 25.074999999999996 25-29 23.5 25.069999999999997 25.85 25.580000000000002 30-34 23.775 24.695 25.645 25.885 35-39 24.015 25.305 25.3 25.380000000000003 40-44 23.735 24.575 26.375 25.314999999999998 45-49 23.200000000000003 24.635 25.974999999999998 26.19 50-54 23.575 24.82 25.775 25.83 55-59 23.632089626888067 24.792437731319396 25.51265379613884 26.062818845653695 60-64 23.773201118738875 24.688532926519198 25.451309433002795 26.08695652173913 65-69 23.771600300525918 24.713248184322563 25.269221136989735 26.245930378161788 70-74 23.515 24.654999999999998 25.955000000000002 25.874999999999996 75-79 24.11 23.965 26.240000000000002 25.685000000000002 80-84 24.415 24.4 25.6 25.585 85-89 24.415 24.37 25.779999999999998 25.435000000000002 90-94 23.895 25.14 25.34 25.624999999999996 95-99 24.16 24.245 25.69 25.905 100-104 23.46 24.455 25.83 26.255 105-109 24.33 24.345 25.665 25.66 110-114 23.575 24.64 25.5 26.284999999999997 115-119 23.96 24.21 25.615 26.215 120-124 24.03 24.535 25.31 26.125 125-129 24.515 24.73 24.985 25.77 130-134 24.154999999999998 24.905 25.365 25.575 135-139 24.8 24.52 24.665 26.015 140-144 24.67 24.759999999999998 24.675 25.895000000000003 145-149 24.279999999999998 24.9 24.715 26.105 150-151 24.2625 25.0125 24.45 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.0 27 0.5 28 1.5 29 3.0 30 4.5 31 7.0 32 12.5 33 19.5 34 22.5 35 30.0 36 41.5 37 50.0 38 64.0 39 101.0 40 137.5 41 142.0 42 153.5 43 174.0 44 188.0 45 207.5 46 202.5 47 190.5 48 188.5 49 172.5 50 160.0 51 150.5 52 132.5 53 132.5 54 126.0 55 98.0 56 99.5 57 102.5 58 89.5 59 87.0 60 90.0 61 83.5 62 78.0 63 80.0 64 73.5 65 66.0 66 56.5 67 42.0 68 30.0 69 23.5 70 20.0 71 17.5 72 14.5 73 10.5 74 9.0 75 5.0 76 1.5 77 1.0 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.025 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.03 60-64 1.675 65-69 0.17500000000000002 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.6559031281533804 1.3 3 0.12613521695257315 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.6749999999999998 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.4000000000000004 0.0 0.0 0.0 0.0 130-131 2.725 0.0 0.0 0.0 0.0 132-133 2.9625000000000004 0.0 0.0 0.0 0.0 134-135 3.3375 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138-139 4.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGACG 10 0.00686971 144.72499 1 GGGGGGG 40 0.007739309 18.090624 120-124 >>END_MODULE SRR6958245 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958245_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86125 33.0 33.0 34.0 32.0 34.0 2 33.00925 34.0 33.0 34.0 32.0 34.0 3 32.97725 34.0 33.0 34.0 32.0 34.0 4 32.95525 34.0 33.0 34.0 32.0 34.0 5 32.983 34.0 33.0 34.0 33.0 34.0 6 37.1805 38.0 38.0 38.0 37.0 38.0 7 37.18325 38.0 38.0 38.0 37.0 38.0 8 37.22125 38.0 38.0 38.0 37.0 38.0 9 37.18625 38.0 38.0 38.0 37.0 38.0 10-14 37.2072 38.0 38.0 38.0 37.0 38.0 15-19 37.18300000000001 38.0 38.0 38.0 36.8 38.0 20-24 37.131350000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.08395 38.0 38.0 38.0 37.0 38.0 30-34 37.05995 38.0 38.0 38.0 36.6 38.0 35-39 37.0947 38.0 38.0 38.0 36.8 38.0 40-44 37.090500000000006 38.0 38.0 38.0 36.8 38.0 45-49 37.06275 38.0 38.0 38.0 36.2 38.0 50-54 37.054300000000005 38.0 38.0 38.0 36.4 38.0 55-59 36.9253 38.0 38.0 38.0 36.0 38.0 60-64 36.87525000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.78555 38.0 38.0 38.0 35.4 38.0 70-74 36.7457 38.0 38.0 38.0 35.2 38.0 75-79 36.7933 38.0 38.0 38.0 35.4 38.0 80-84 36.78605 38.0 38.0 38.0 35.4 38.0 85-89 36.65305 38.0 38.0 38.0 34.8 38.0 90-94 36.600849999999994 38.0 38.0 38.0 34.8 38.0 95-99 36.39595 38.0 38.0 38.0 34.0 38.0 100-104 36.316199999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.078649999999996 38.0 38.0 38.0 33.8 38.0 110-114 35.8877 38.0 37.6 38.0 33.0 38.0 115-119 35.783 38.0 37.2 38.0 32.6 38.0 120-124 35.76205 38.0 37.4 38.0 32.2 38.0 125-129 35.68665 38.0 37.0 38.0 33.0 38.0 130-134 35.429 38.0 36.2 38.0 31.4 38.0 135-139 35.13685 38.0 36.0 38.0 30.6 38.0 140-144 34.8709 38.0 35.8 38.0 29.0 38.0 145-149 34.194500000000005 38.0 35.2 38.0 26.6 38.0 150-151 29.835375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 1.0 5 1.0 6 3.0 7 0.0 8 1.0 9 0.0 10 1.0 11 3.0 12 3.0 13 3.0 14 1.0 15 3.0 16 3.0 17 4.0 18 2.0 19 4.0 20 3.0 21 2.0 22 6.0 23 8.0 24 12.0 25 8.0 26 15.0 27 21.0 28 36.0 29 28.0 30 42.0 31 48.0 32 62.0 33 83.0 34 134.0 35 204.0 36 575.0 37 2667.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.5250501002004 17.860721442885772 11.54809619238477 33.06613226452906 2 28.929556279769365 23.614941087991976 25.770869892203557 21.684632740035095 3 22.662321383805466 25.595387315116568 28.052143394334422 23.690147906743544 4 25.732899022801302 31.069907291405663 19.143071911801552 24.05412177399148 5 26.94235588972431 31.654135338345863 20.25062656641604 21.152882205513784 6 22.43060765191298 35.08377094273568 20.630157539384847 21.85546386596649 7 21.80545136284071 19.004751187796952 34.883720930232556 24.306076519129782 8 24.8062015503876 22.73068267066767 23.78094523630908 28.68217054263566 9 24.50612653163291 22.330582645661416 26.78169542385596 26.38159539884971 10-14 25.63640910227557 25.216304076019004 23.56089022255564 25.586396599149786 15-19 25.89406292202271 24.77367078477467 24.31851147901766 25.013754814184963 20-24 25.96149037259315 25.596399099774942 23.845961490372595 24.596149037259316 25-29 26.136534133533385 25.431357839459867 23.315828957239308 25.116279069767444 30-34 26.05890883632545 25.298794819222888 24.00860129019353 24.63369505425814 35-39 25.481370342585645 25.18129532383096 24.0960240060015 25.241310327581896 40-44 26.298944841726257 25.188778316747513 23.65854878231735 24.853728059208883 45-49 25.50510102020404 25.53510702140428 24.16483296659332 24.79495899179836 50-54 25.92777833350005 25.492647794338303 24.017205161548464 24.562368710613182 55-59 25.936484121030258 25.09127281820455 23.74593648412103 25.22630657664416 60-64 26.116529132283073 25.14628657164291 24.14603650912728 24.59114778694674 65-69 25.566391597899475 25.61140285071268 23.93098274568642 24.891222805701425 70-74 26.159155704496573 25.30885810033512 23.713299654879208 24.8186865402891 75-79 26.19130956547827 24.591229561478073 24.23621181059053 24.981249062453124 80-84 26.19130956547827 25.401270063503173 24.121206060303017 24.286214310715536 85-89 25.460092018403678 25.795159031806364 23.879775955191036 24.86497299459892 90-94 25.552555255525554 25.687568756875688 24.147414741474147 24.61246124612461 95-99 26.072821846553968 25.472641792537758 24.28228468540562 24.17225167550265 100-104 26.22786836050815 25.02250675202561 24.247274182254678 24.502350705211565 105-109 26.022806842052614 25.397619285785733 24.582374712413724 23.997199159747925 110-114 25.849047166508278 26.094132946531285 24.113439703896365 23.943380183064072 115-119 25.976494123530884 25.561390347586897 24.091022755688922 24.371092773193297 120-124 26.12783835150545 25.31759527858358 24.197259177753324 24.35730719215765 125-129 26.748024407322195 25.842752825847754 23.206962088626586 24.202260678203462 130-134 26.441610402600652 25.626406601650416 24.306076519129782 23.625906476619154 135-139 26.981745436359088 25.85646411602901 23.495873968492123 23.66591647911978 140-144 27.03905585837876 26.048907336100413 23.713557033555034 23.198479771965793 145-149 26.941735433858465 25.63140785196299 23.99099774943736 23.435858964741186 150-151 26.428303537942245 26.428303537942245 24.153019127390923 22.99037379672459 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 0.5 28 2.0 29 3.0 30 2.0 31 3.0 32 5.5 33 11.0 34 17.0 35 23.5 36 35.0 37 53.5 38 63.5 39 88.0 40 116.5 41 120.5 42 137.0 43 171.5 44 185.0 45 185.0 46 184.0 47 178.0 48 177.0 49 180.0 50 167.5 51 150.0 52 138.0 53 125.5 54 125.0 55 118.0 56 102.0 57 100.5 58 96.5 59 89.5 60 89.5 61 84.5 62 89.0 63 90.5 64 82.5 65 70.5 66 64.5 67 53.5 68 48.0 69 44.5 70 30.5 71 24.0 72 21.0 73 16.5 74 10.0 75 10.0 76 6.5 77 2.0 78 1.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.27499999999999997 3 0.27499999999999997 4 0.22499999999999998 5 0.25 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.034999999999999996 20-24 0.025 25-29 0.025 30-34 0.015 35-39 0.025 40-44 0.015 45-49 0.02 50-54 0.03 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.034999999999999996 75-79 0.005 80-84 0.005 85-89 0.02 90-94 0.01 95-99 0.03 100-104 0.03 105-109 0.03 110-114 0.034999999999999996 115-119 0.025 120-124 0.03 125-129 0.03 130-134 0.025 135-139 0.025 140-144 0.015 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1154915339904 98.05 2 0.7834217841799342 1.55 3 0.025271670457417232 0.075 4 0.050543340914834464 0.2 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.45 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.3499999999999996 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138-139 3.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGAAT 10 0.006830828 145.0 145 TTACAAG 10 0.006830828 145.0 9 TTTACAA 10 0.006830828 145.0 8 CCCCCCC 25 4.977651E-4 29.0 45-49 >>END_MODULE Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569042 spots for SRR6958245.sra Written 1569042 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra Read 1569035 spots for SRR6958245.sra Written 1569035 spots for SRR6958245.sra SRR ids: ['SRR6958245.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wh6sj3im SRR6958245.sra spots: 31380707 blocks: [[1, 1569035], [1569036, 3138070], [3138071, 4707105], [4707106, 6276140], [6276141, 7845175], [7845176, 9414210], [9414211, 10983245], [10983246, 12552280], [12552281, 14121315], [14121316, 15690350], [15690351, 17259385], [17259386, 18828420], [18828421, 20397455], [20397456, 21966490], [21966491, 23535525], [23535526, 25104560], [25104561, 26673595], [26673596, 28242630], [28242631, 29811665], [29811666, 31380707]] SRR6958245 file size 10612191 SRR6958245 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958245 SRR6958245_1.fastq SRR6958245_2.fastq Input file: SRR6958245_1.fastq Paired file: SRR6958245_2.fastq trimmed: SRR6958245-trimmed-pair1.fastq, SRR6958245-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:31:39 2024 >> started Fri Dec 6 17:32:21 2024 >> done (42.038s) 31380707 read pairs processed; of these: 34777 ( 0.11%) short read pairs filtered out after trimming by size control 54624 ( 0.17%) empty read pairs filtered out after trimming by size control 31291306 (99.72%) read pairs available; of these: 11349178 (36.27%) trimmed read pairs available after processing 19942128 (63.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 1 0.00% 23 2 0.00% 24 6 0.00% 25 7 0.00% 26 11 0.00% 27 9 0.00% 28 11 0.00% 29 10 0.00% 30 4 0.00% 31 8 0.00% 32 11 0.00% 33 8 0.00% 34 12 0.00% 35 9 0.00% 36 12 0.00% 37 11 0.00% 38 15 0.00% 39 16 0.00% 40 8 0.00% 41 21 0.00% 42 22 0.00% 43 21 0.00% 44 35 0.00% 45 37 0.00% 46 32 0.00% 47 33 0.00% 48 36 0.00% 49 44 0.00% 50 41 0.00% 51 76 0.00% 52 66 0.00% 53 81 0.00% 54 64 0.00% 55 80 0.00% 56 97 0.00% 57 117 0.00% 58 122 0.00% 59 128 0.00% 60 206 0.00% 61 223 0.00% 62 234 0.00% 63 252 0.00% 64 315 0.00% 65 268 0.00% 66 346 0.00% 67 338 0.00% 68 425 0.00% 69 506 0.00% 70 549 0.00% 71 631 0.00% 72 770 0.00% 73 892 0.00% 74 954 0.00% 75 1067 0.00% 76 1201 0.00% 77 1319 0.00% 78 1527 0.00% 79 1741 0.01% 80 1962 0.01% 81 2202 0.01% 82 2524 0.01% 83 2904 0.01% 84 4300 0.01% 85 5257 0.02% 86 5537 0.02% 87 5820 0.02% 88 6338 0.02% 89 6611 0.02% 90 7000 0.02% 91 7302 0.02% 92 7721 0.02% 93 8327 0.03% 94 9009 0.03% 95 9609 0.03% 96 10154 0.03% 97 10718 0.03% 98 11200 0.04% 99 11992 0.04% 100 12511 0.04% 101 13474 0.04% 102 14261 0.05% 103 15247 0.05% 104 16130 0.05% 105 16988 0.05% 106 18318 0.06% 107 18861 0.06% 108 20039 0.06% 109 20796 0.07% 110 21497 0.07% 111 22964 0.07% 112 24419 0.08% 113 25713 0.08% 114 27374 0.09% 115 28633 0.09% 116 30659 0.10% 117 31974 0.10% 118 33344 0.11% 119 33845 0.11% 120 35570 0.11% 121 37318 0.12% 122 38649 0.12% 123 40664 0.13% 124 42059 0.13% 125 44602 0.14% 126 46181 0.15% 127 48349 0.15% 128 50156 0.16% 129 51984 0.17% 130 54435 0.17% 131 57037 0.18% 132 60201 0.19% 133 63259 0.20% 134 66244 0.21% 135 70891 0.23% 136 74597 0.24% 137 78708 0.25% 138 83746 0.27% 139 89477 0.29% 140 95910 0.31% 141 103258 0.33% 142 114936 0.37% 143 127794 0.41% 144 145551 0.47% 145 175021 0.56% 146 216730 0.69% 147 285975 0.91% 148 438357 1.40% 149 933099 2.98% 150 6979783 22.31% 151 19942128 63.73% 31291306 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=25 prefix-density=0.73 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=62.90 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=24 prefix-density=0.56 prefix-fanout=2.9 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=334.72 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=14.1 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958245 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:33:24 Started mapping on | Dec 06 17:33:24 Finished on | Dec 06 17:35:48 Mapping speed, Million of reads per hour | 782.28 Number of input reads | 31291306 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 30381019 Uniquely mapped reads % | 97.09% Average mapped length | 297.42 Number of splices: Total | 35497972 Number of splices: Annotated (sjdb) | 33335701 Number of splices: GT/AG | 35039941 Number of splices: GC/AG | 415225 Number of splices: AT/AC | 13784 Number of splices: Non-canonical | 29022 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 206334 % of reads mapped to multiple loci | 0.66% Number of reads mapped to too many loci | 31532 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.51% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 723665 723665 723665 N_multimapping 206334 206334 206334 N_noFeature 935549 29555282 1155837 N_ambiguous 718083 4085 114297 UnstrandedReadsAssigned:28727387 PositiveStrandReadsAssigned:821652 NegativeStrandReadsAssigned:29110885 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958245 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958245-trimmed-pair1.fastq SRR6958245-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,291,306 reads, 29,148,039 reads pseudoaligned [quant] estimated average fragment length: 265.817 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52973 SRR6958245.ke.tsv 35125 SRR6958245.se.tsv 88098 total ==> SRR6958245.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.723 0 0 PNS24247 1044 779.183 95.2138 6.29017 PNS24249 1928 1663.18 47.1277 1.45861 PNS24246 1044 779.183 95.2138 6.29017 PNS24248 1044 779.183 95.2138 6.29017 PNS24244 1471 1206.18 52.2308 2.22903 PNS24243 293 82.0782 1 0.627154 KQK14069 1603 1338.18 6540.8 251.604 KQK14071 474 224.215 122.413 28.1038 ==> SRR6958245.se.tsv <== BRADI_1g14170v3 7448 BRADI_1g53295v3 489 BRADI_1g59795v3 305 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 409 BRADI_1g74790v3 195 BRADI_1g09890v3 0 BRADI_1g77505v3 345 BRADI_1g48960v3 0 SRR6958245 completed mapping pipeline successfully