Starting /dee2/code/volunteer_pipeline.sh SRR6958246 current disk space = 1550660587520 free memory = 1602863956 SRR6958246 SRAfilesize 3dcb6b0ac8a51adcdfecbfbe45a4cf72 SRR6958246.sra SRR6958246.sra file validated SRR6958246 is paired end SRR6958246 is conventional basespace SRR6958246 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958246_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.07275 31.0 18.0 33.0 18.0 33.0 2 26.332 27.0 18.0 31.0 18.0 33.0 3 30.4685 31.0 29.0 33.0 27.0 33.0 4 32.51625 33.0 33.0 33.0 32.0 33.0 5 32.53225 33.0 33.0 33.0 32.0 34.0 6 36.68775 38.0 37.0 38.0 34.0 38.0 7 37.34675 38.0 38.0 38.0 37.0 38.0 8 36.084 38.0 38.0 38.0 31.0 38.0 9 37.24025 38.0 38.0 38.0 36.0 38.0 10-14 36.57735 38.0 37.0 38.0 31.8 38.0 15-19 37.46205 38.0 38.0 38.0 37.2 38.0 20-24 37.588100000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.56655 38.0 38.0 38.0 38.0 38.0 30-34 37.52065 38.0 38.0 38.0 38.0 38.0 35-39 37.32855 38.0 38.0 38.0 37.2 38.0 40-44 37.41235 38.0 38.0 38.0 37.2 38.0 45-49 37.5285 38.0 38.0 38.0 37.8 38.0 50-54 36.706300000000006 38.0 37.6 38.0 34.0 38.0 55-59 37.18165 38.0 38.0 38.0 36.6 38.0 60-64 37.30345 38.0 38.0 38.0 37.0 38.0 65-69 37.33695 38.0 38.0 38.0 37.0 38.0 70-74 37.32285 38.0 38.0 38.0 37.0 38.0 75-79 36.335699999999996 38.0 37.8 38.0 33.8 38.0 80-84 36.38805 38.0 38.0 38.0 35.2 38.0 85-89 36.5942 38.0 38.0 38.0 36.0 38.0 90-94 35.01865 38.0 35.2 38.0 29.0 38.0 95-99 36.229 38.0 38.0 38.0 34.4 38.0 100-104 36.29395 38.0 38.0 38.0 34.6 38.0 105-109 36.130849999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.050200000000004 38.0 38.0 38.0 33.8 38.0 115-119 35.62885 38.0 37.4 38.0 31.8 38.0 120-124 35.67225 38.0 37.6 38.0 32.2 38.0 125-129 35.58415 38.0 37.8 38.0 32.2 38.0 130-134 35.602700000000006 38.0 37.4 38.0 32.6 38.0 135-139 35.3937 38.0 37.2 38.0 31.2 38.0 140-144 35.1019 38.0 36.4 38.0 31.0 38.0 145-149 34.3712 38.0 35.6 38.0 27.6 38.0 150-151 30.285 35.5 29.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 5.0 18 17.0 19 51.0 20 3.0 21 2.0 22 4.0 23 4.0 24 4.0 25 5.0 26 8.0 27 13.0 28 17.0 29 35.0 30 33.0 31 52.0 32 53.0 33 92.0 34 124.0 35 261.0 36 748.0 37 2462.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.03034199022885 11.54538441758807 6.839804577012086 43.584469015170995 2 21.8 17.1 32.300000000000004 28.799999999999997 3 21.275 15.425 25.650000000000002 37.65 4 26.825 23.674999999999997 21.075 28.425 5 27.750000000000004 28.175 22.375 21.7 6 23.549999999999997 31.25 23.225 21.975 7 18.4 24.575 38.0 19.025 8 19.35 24.15 28.925 27.575 9 22.25 21.375 32.9 23.474999999999998 10-14 23.095 26.86 25.290000000000003 24.755 15-19 23.0 25.674999999999997 25.335 25.990000000000002 20-24 23.685000000000002 26.16 25.395 24.759999999999998 25-29 22.59 25.745 25.814999999999998 25.85 30-34 22.535 24.959999999999997 26.19 26.314999999999998 35-39 22.695 25.035 25.795 26.474999999999998 40-44 22.770000000000003 25.115 26.365 25.75 45-49 23.515 25.305 26.090000000000003 25.09 50-54 23.165 25.2 25.564999999999998 26.07 55-59 22.775000000000002 24.89 26.32 26.015 60-64 23.515 24.485 26.43 25.569999999999997 65-69 23.645 25.915 25.16 25.28 70-74 22.655 26.71 25.365 25.27 75-79 23.005 26.365 25.11 25.52 80-84 23.565 25.755 24.959999999999997 25.72 85-89 23.175 25.385 25.585 25.855 90-94 23.435 25.055 25.56 25.95 95-99 23.369999999999997 25.52 25.585 25.525 100-104 23.93 25.1 25.0 25.97 105-109 23.705000000000002 25.27 25.319999999999997 25.705 110-114 23.635 25.005 25.81 25.55 115-119 23.875 25.995 24.515 25.615 120-124 23.845 26.045 24.654999999999998 25.455 125-129 23.655 26.19 24.29 25.865 130-134 24.195 25.715 24.665 25.424999999999997 135-139 24.217421742174217 25.69256925692569 24.702470247024703 25.38753875387539 140-144 23.830000000000002 25.735000000000003 24.765 25.669999999999998 145-149 23.974999999999998 25.564999999999998 24.695 25.765 150-151 23.9 25.6125 23.8125 26.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 3.0 27 3.0 28 3.5 29 5.5 30 6.5 31 8.5 32 15.0 33 17.5 34 22.5 35 36.0 36 53.5 37 64.0 38 71.5 39 101.0 40 133.5 41 146.5 42 168.5 43 194.0 44 212.5 45 218.5 46 208.0 47 203.5 48 197.0 49 180.5 50 166.0 51 159.5 52 126.0 53 94.0 54 99.5 55 103.5 56 90.5 57 83.5 58 87.5 59 81.5 60 70.5 61 73.0 62 68.5 63 60.5 64 59.0 65 46.5 66 38.0 67 33.0 68 34.0 69 35.0 70 27.5 71 20.5 72 18.0 73 14.0 74 9.0 75 9.5 76 7.0 77 4.0 78 3.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.43748401943236 97.225 2 0.4858092559447712 0.95 3 0.051137816415239075 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025568908207619537 1.675 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTACGTTATCTCGTAT 67 1.675 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.4875 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.7625 0.0 0.0 0.0 0.0 128-129 5.4 0.0 0.0 0.0 0.0 130-131 5.9625 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 7.075 0.0 0.0 0.0 0.0 136-137 7.6625 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTATAA 10 0.006832588 144.9875 6 CGGAAGA 95 0.0041936426 30.523685 4 CTTCTGC 25 4.980164E-4 28.997501 55-59 AAAAAAA 145 8.8170054E-7 11.998966 65-69 >>END_MODULE SRR6958246 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958246_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99 33.0 33.0 34.0 32.0 34.0 2 33.11125 34.0 33.0 34.0 32.0 34.0 3 33.105 34.0 33.0 34.0 32.0 34.0 4 33.0045 34.0 33.0 34.0 32.0 34.0 5 32.8995 34.0 33.0 34.0 32.0 34.0 6 37.13175 38.0 38.0 38.0 37.0 38.0 7 37.06375 38.0 38.0 38.0 37.0 38.0 8 37.255 38.0 38.0 38.0 37.0 38.0 9 37.1645 38.0 38.0 38.0 37.0 38.0 10-14 37.18195 38.0 38.0 38.0 37.0 38.0 15-19 37.1953 38.0 38.0 38.0 37.0 38.0 20-24 37.22205 38.0 38.0 38.0 37.0 38.0 25-29 37.06695 38.0 38.0 38.0 36.6 38.0 30-34 37.09275 38.0 38.0 38.0 36.6 38.0 35-39 36.49675 38.0 38.0 38.0 34.4 38.0 40-44 36.30535 38.0 38.0 38.0 34.2 38.0 45-49 36.1681 38.0 38.0 38.0 33.4 38.0 50-54 36.471199999999996 38.0 38.0 38.0 35.4 38.0 55-59 35.359300000000005 38.0 36.8 38.0 27.8 38.0 60-64 36.501099999999994 38.0 38.0 38.0 35.4 38.0 65-69 36.519999999999996 38.0 38.0 38.0 35.4 38.0 70-74 36.524800000000006 38.0 38.0 38.0 35.2 38.0 75-79 36.1822 38.0 37.8 38.0 33.4 38.0 80-84 36.31755 38.0 38.0 38.0 34.4 38.0 85-89 35.3995 38.0 36.8 38.0 29.0 38.0 90-94 35.62425 38.0 37.4 38.0 32.4 38.0 95-99 35.770050000000005 38.0 38.0 38.0 33.4 38.0 100-104 35.79515 38.0 38.0 38.0 33.4 38.0 105-109 35.788599999999995 38.0 38.0 38.0 33.4 38.0 110-114 35.6293 38.0 38.0 38.0 32.6 38.0 115-119 35.521249999999995 38.0 38.0 38.0 32.2 38.0 120-124 35.0661 38.0 36.4 38.0 29.4 38.0 125-129 34.79575 38.0 36.0 38.0 28.0 38.0 130-134 33.73455 38.0 33.8 38.0 24.0 38.0 135-139 33.0563 38.0 32.6 38.0 19.6 38.0 140-144 33.7083 38.0 34.4 38.0 22.0 38.0 145-149 32.9687 38.0 33.2 38.0 14.0 38.0 150-151 27.484375 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 0.0 5 0.0 6 1.0 7 11.0 8 8.0 9 13.0 10 4.0 11 3.0 12 1.0 13 5.0 14 15.0 15 11.0 16 9.0 17 6.0 18 5.0 19 2.0 20 5.0 21 2.0 22 8.0 23 13.0 24 10.0 25 13.0 26 22.0 27 22.0 28 36.0 29 32.0 30 50.0 31 66.0 32 90.0 33 107.0 34 155.0 35 287.0 36 685.0 37 2294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.6 19.575 11.15 31.674999999999997 2 32.525 23.674999999999997 26.5 17.299999999999997 3 22.1 25.874999999999996 28.7 23.325000000000003 4 25.424999999999997 30.575000000000003 20.200000000000003 23.799999999999997 5 27.900000000000002 32.925 18.95 20.225 6 24.825 35.625 19.325 20.225 7 22.1 20.424999999999997 34.975 22.5 8 23.974999999999998 23.325000000000003 24.825 27.875 9 25.45 22.15 26.05 26.35 10-14 26.07 26.229999999999997 23.505000000000003 24.195 15-19 25.562668800640193 24.877463238971693 24.887466239871962 24.672401720516156 20-24 25.926481620405102 25.166291572893222 24.726181545386346 24.18104526131533 25-29 25.590000000000003 25.85 23.87 24.69 30-34 25.669999999999998 24.67 25.230000000000004 24.43 35-39 25.56011202240448 25.045009001800363 24.64492898579716 24.749949989998 40-44 26.181309065453274 24.846242312115603 24.89624481224061 24.07620381019051 45-49 25.445 25.775 24.490000000000002 24.29 50-54 26.00630031501575 25.256262813140655 24.71623581179059 24.021201060053002 55-59 26.74767476747675 24.98249824982498 24.312431243124312 23.957395739573958 60-64 26.740000000000002 25.515 24.175 23.57 65-69 25.716429107276817 25.291322830707674 25.331332833208304 23.6609152288072 70-74 26.035000000000004 26.97 23.75 23.244999999999997 75-79 25.585 26.55 24.47 23.395 80-84 25.755 26.655 24.21 23.380000000000003 85-89 25.641410352588146 26.266566641660415 24.491122780695175 23.600900225056265 90-94 25.6 25.865 24.675 23.86 95-99 25.724999999999998 26.040000000000003 24.6 23.635 100-104 26.385277055411084 26.505301060212044 23.76475295059012 23.344668933786757 105-109 26.506325316265812 25.676283814190707 24.411220561028053 23.406170308515424 110-114 26.26525305061012 25.79015803160632 24.484896979395877 23.459691938387678 115-119 26.07151787946987 26.186546636659163 24.316079019754937 23.42585646411603 120-124 26.400000000000002 26.25 23.645 23.705000000000002 125-129 26.735 25.990000000000002 24.015 23.26 130-134 26.990398079615925 26.090218043608722 24.134826965393078 22.784556911382275 135-139 27.09677419354839 26.54663665916479 24.066016504126033 22.290572643160793 140-144 27.38 26.16 24.275 22.185 145-149 28.225 26.005 24.14 21.63 150-151 27.4125 26.7125 24.025 21.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 3.5 27 3.5 28 4.0 29 6.0 30 9.5 31 11.0 32 11.5 33 15.0 34 18.0 35 23.5 36 44.5 37 62.5 38 82.0 39 104.5 40 118.5 41 144.0 42 162.5 43 169.0 44 184.0 45 196.5 46 191.0 47 185.0 48 184.0 49 177.5 50 164.0 51 153.0 52 138.0 53 116.5 54 108.0 55 102.5 56 98.0 57 94.5 58 80.0 59 75.0 60 81.0 61 74.5 62 76.0 63 74.5 64 64.0 65 61.0 66 47.0 67 39.5 68 42.0 69 40.5 70 36.5 71 34.5 72 29.0 73 18.5 74 13.0 75 9.5 76 7.0 77 4.5 78 2.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.03 20-24 0.025 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.005 45-49 0.0 50-54 0.005 55-59 0.01 60-64 0.0 65-69 0.025 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.005 110-114 0.02 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.025 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82892057026477 97.05 2 0.9674134419551934 1.9 3 0.10183299389002036 0.3 4 0.02545824847250509 0.1 5 0.0 0.0 6 0.02545824847250509 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05091649694501018 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCTACGTTGTGTAGATTT 10 0.25 Illumina Single End PCR Primer 1 (96% over 32bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCTACGTTGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (96% over 32bp) GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.025 4 0.0 0.0 0.0 0.0 0.025 5 0.0 0.0 0.0 0.0 0.025 6 0.0 0.0 0.0 0.0 0.025 7 0.0 0.0 0.0 0.0 0.025 8 0.0 0.0 0.0 0.0 0.025 9 0.0 0.0 0.0 0.0 0.025 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.025 0.0 0.0 0.0 0.025 60-61 0.025 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.037500000000000006 0.0 0.0 0.0 0.025 72-73 0.075 0.0 0.0 0.0 0.025 74-75 0.075 0.0 0.0 0.0 0.025 76-77 0.0875 0.0 0.0 0.0 0.025 78-79 0.125 0.0 0.0 0.0 0.025 80-81 0.125 0.0 0.0 0.0 0.025 82-83 0.16249999999999998 0.0 0.0 0.0 0.025 84-85 0.175 0.0 0.0 0.0 0.025 86-87 0.175 0.0 0.0 0.0 0.025 88-89 0.23750000000000002 0.0 0.0 0.0 0.025 90-91 0.275 0.0 0.0 0.0 0.025 92-93 0.3125 0.0 0.0 0.0 0.025 94-95 0.4375 0.0 0.0 0.0 0.025 96-97 0.5 0.0 0.0 0.0 0.025 98-99 0.6375 0.0 0.0 0.0 0.025 100-101 0.8 0.0 0.0 0.0 0.025 102-103 0.95 0.0 0.0 0.0 0.025 104-105 1.2125 0.0 0.0 0.0 0.025 106-107 1.4375 0.0 0.0 0.0 0.025 108-109 1.5375 0.0 0.0 0.0 0.025 110-111 1.675 0.0 0.0 0.0 0.025 112-113 1.9249999999999998 0.0 0.0 0.0 0.025 114-115 2.3 0.0 0.0 0.0 0.025 116-117 2.7 0.0 0.0 0.0 0.025 118-119 3.1125 0.0 0.0 0.0 0.025 120-121 3.475 0.0 0.0 0.0 0.025 122-123 3.8125 0.0 0.0 0.0 0.025 124-125 4.2125 0.0 0.0 0.0 0.025 126-127 4.6875 0.0 0.0 0.0 0.025 128-129 5.3 0.0 0.0 0.0 0.025 130-131 5.8625 0.0 0.0 0.0 0.025 132-133 6.300000000000001 0.0 0.0 0.0 0.025 134-135 6.925 0.0 0.0 0.0 0.025 136-137 7.487500000000001 0.0 0.0 0.0 0.025 138-139 8.2 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 160 2.886627E-6 10.875 70-74 >>END_MODULE Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082690 spots for SRR6958246.sra Written 1082690 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra Read 1082689 spots for SRR6958246.sra Written 1082689 spots for SRR6958246.sra SRR ids: ['SRR6958246.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7dr16arw SRR6958246.sra spots: 21653781 blocks: [[1, 1082689], [1082690, 2165378], [2165379, 3248067], [3248068, 4330756], [4330757, 5413445], [5413446, 6496134], [6496135, 7578823], [7578824, 8661512], [8661513, 9744201], [9744202, 10826890], [10826891, 11909579], [11909580, 12992268], [12992269, 14074957], [14074958, 15157646], [15157647, 16240335], [16240336, 17323024], [17323025, 18405713], [18405714, 19488402], [19488403, 20571091], [20571092, 21653781]] SRR6958246 file size 7316055 SRR6958246 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958246 SRR6958246_1.fastq SRR6958246_2.fastq Input file: SRR6958246_1.fastq Paired file: SRR6958246_2.fastq trimmed: SRR6958246-trimmed-pair1.fastq, SRR6958246-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:31:42 2024 >> started Fri Dec 6 17:32:08 2024 >> done (26.183s) 21653781 read pairs processed; of these: 16527 ( 0.08%) short read pairs filtered out after trimming by size control 411911 ( 1.90%) empty read pairs filtered out after trimming by size control 21225343 (98.02%) read pairs available; of these: 8521744 (40.15%) trimmed read pairs available after processing 12703599 (59.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 9 0.00% 21 10 0.00% 22 12 0.00% 23 14 0.00% 24 12 0.00% 25 18 0.00% 26 9 0.00% 27 12 0.00% 28 14 0.00% 29 11 0.00% 30 13 0.00% 31 18 0.00% 32 22 0.00% 33 19 0.00% 34 25 0.00% 35 21 0.00% 36 26 0.00% 37 28 0.00% 38 37 0.00% 39 30 0.00% 40 39 0.00% 41 37 0.00% 42 36 0.00% 43 48 0.00% 44 40 0.00% 45 64 0.00% 46 101 0.00% 47 119 0.00% 48 133 0.00% 49 130 0.00% 50 137 0.00% 51 160 0.00% 52 158 0.00% 53 194 0.00% 54 188 0.00% 55 233 0.00% 56 256 0.00% 57 318 0.00% 58 383 0.00% 59 408 0.00% 60 412 0.00% 61 424 0.00% 62 537 0.00% 63 580 0.00% 64 619 0.00% 65 657 0.00% 66 718 0.00% 67 740 0.00% 68 859 0.00% 69 947 0.00% 70 1094 0.01% 71 1246 0.01% 72 1465 0.01% 73 1694 0.01% 74 1868 0.01% 75 2016 0.01% 76 2831 0.01% 77 3485 0.02% 78 3224 0.02% 79 3275 0.02% 80 3492 0.02% 81 4103 0.02% 82 4409 0.02% 83 4928 0.02% 84 6266 0.03% 85 7149 0.03% 86 7857 0.04% 87 8285 0.04% 88 9043 0.04% 89 9543 0.04% 90 10351 0.05% 91 11429 0.05% 92 12634 0.06% 93 13435 0.06% 94 14707 0.07% 95 15448 0.07% 96 16629 0.08% 97 17633 0.08% 98 18878 0.09% 99 20332 0.10% 100 21523 0.10% 101 23012 0.11% 102 24646 0.12% 103 26194 0.12% 104 27355 0.13% 105 29153 0.14% 106 30558 0.14% 107 31996 0.15% 108 33428 0.16% 109 34716 0.16% 110 36326 0.17% 111 38217 0.18% 112 40257 0.19% 113 41697 0.20% 114 44211 0.21% 115 46211 0.22% 116 47228 0.22% 117 48823 0.23% 118 50372 0.24% 119 51321 0.24% 120 52945 0.25% 121 54477 0.26% 122 56023 0.26% 123 58604 0.28% 124 61641 0.29% 125 63689 0.30% 126 64803 0.31% 127 66524 0.31% 128 67543 0.32% 129 68899 0.32% 130 71354 0.34% 131 73316 0.35% 132 75757 0.36% 133 78804 0.37% 134 81588 0.38% 135 83009 0.39% 136 86018 0.41% 137 88158 0.42% 138 90694 0.43% 139 95229 0.45% 140 98442 0.46% 141 104006 0.49% 142 111399 0.52% 143 119523 0.56% 144 130310 0.61% 145 147469 0.69% 146 172068 0.81% 147 217324 1.02% 148 308489 1.45% 149 592559 2.79% 150 4105034 19.34% 151 12703599 59.85% 21225343 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=18 prefix-density=0.81 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=45.91 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=17 prefix-density=0.48 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=81.92 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958246 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:33:50 Started mapping on | Dec 06 17:33:50 Finished on | Dec 06 17:35:47 Mapping speed, Million of reads per hour | 653.09 Number of input reads | 21225343 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 20835637 Uniquely mapped reads % | 98.16% Average mapped length | 293.55 Number of splices: Total | 23120345 Number of splices: Annotated (sjdb) | 21677379 Number of splices: GT/AG | 22822386 Number of splices: GC/AG | 265702 Number of splices: AT/AC | 8877 Number of splices: Non-canonical | 23380 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.95 Insertion rate per base | 0.00% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 140018 % of reads mapped to multiple loci | 0.66% Number of reads mapped to too many loci | 12939 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.81% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 260024 260024 260024 N_multimapping 140018 140018 140018 N_noFeature 766192 20223618 965784 N_ambiguous 492285 2852 80940 UnstrandedReadsAssigned:19577160 PositiveStrandReadsAssigned:609167 NegativeStrandReadsAssigned:19788913 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958246 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958246-trimmed-pair1.fastq SRR6958246-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,225,343 reads, 19,811,885 reads pseudoaligned [quant] estimated average fragment length: 249.446 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52973 SRR6958246.ke.tsv 35125 SRR6958246.se.tsv 88098 total ==> SRR6958246.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.172 0 0 PNS24247 1044 795.554 63.8442 6.08167 PNS24249 1928 1679.55 48.1382 2.17204 PNS24246 1044 795.554 63.8442 6.08167 PNS24248 1044 795.554 63.8442 6.08167 PNS24244 1471 1222.55 35.3291 2.18996 PNS24243 293 99.3515 0 0 KQK14069 1603 1354.55 4281.33 239.526 KQK14071 474 242.95 81.9819 25.5725 ==> SRR6958246.se.tsv <== BRADI_1g14170v3 4899 BRADI_1g53295v3 333 BRADI_1g59795v3 221 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 327 BRADI_1g74790v3 138 BRADI_1g09890v3 0 BRADI_1g77505v3 223 BRADI_1g48960v3 0 SRR6958246 completed mapping pipeline successfully