Starting /dee2/code/volunteer_pipeline.sh SRR6958247 current disk space = 1550643617792 free memory = 1601609956 SRR6958247 SRAfilesize f6b0e5d34292272214537756b2931df2 SRR6958247.sra SRR6958247.sra file validated SRR6958247 is paired end SRR6958247 is conventional basespace SRR6958247 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958247_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.195 32.0 25.0 33.0 18.0 33.0 2 28.0295 29.0 25.0 33.0 18.0 33.0 3 29.6995 31.0 29.0 33.0 25.0 33.0 4 31.859 33.0 31.0 33.0 29.0 33.0 5 32.508 33.0 33.0 33.0 31.0 34.0 6 36.1265 38.0 36.0 38.0 33.0 38.0 7 37.29425 38.0 38.0 38.0 36.0 38.0 8 37.472 38.0 38.0 38.0 37.0 38.0 9 37.6875 38.0 38.0 38.0 38.0 38.0 10-14 37.7303 38.0 38.0 38.0 38.0 38.0 15-19 37.72155 38.0 38.0 38.0 38.0 38.0 20-24 37.678999999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.698 38.0 38.0 38.0 38.0 38.0 30-34 37.65955 38.0 38.0 38.0 38.0 38.0 35-39 37.665200000000006 38.0 38.0 38.0 37.8 38.0 40-44 37.68079999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.6703 38.0 38.0 38.0 38.0 38.0 50-54 37.60445 38.0 38.0 38.0 38.0 38.0 55-59 37.55425 38.0 38.0 38.0 38.0 38.0 60-64 37.569849999999995 38.0 38.0 38.0 38.0 38.0 65-69 37.4678 38.0 38.0 38.0 37.6 38.0 70-74 37.4232 38.0 38.0 38.0 37.0 38.0 75-79 37.388400000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.391149999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.19005 38.0 38.0 38.0 36.6 38.0 90-94 37.21995 38.0 38.0 38.0 36.4 38.0 95-99 37.2057 38.0 38.0 38.0 36.2 38.0 100-104 37.04305 38.0 38.0 38.0 36.0 38.0 105-109 37.0511 38.0 38.0 38.0 36.0 38.0 110-114 36.85595 38.0 38.0 38.0 35.2 38.0 115-119 36.8317 38.0 38.0 38.0 35.0 38.0 120-124 36.7342 38.0 38.0 38.0 34.6 38.0 125-129 36.585750000000004 38.0 38.0 38.0 34.4 38.0 130-134 36.5939 38.0 38.0 38.0 34.4 38.0 135-139 36.4896 38.0 38.0 38.0 34.2 38.0 140-144 34.93455 38.0 35.8 38.0 27.6 38.0 145-149 35.47295 38.0 35.2 38.0 31.8 38.0 150-151 32.839625 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 2.0 20 0.0 21 1.0 22 0.0 23 2.0 24 5.0 25 5.0 26 3.0 27 12.0 28 6.0 29 10.0 30 25.0 31 26.0 32 39.0 33 53.0 34 104.0 35 183.0 36 635.0 37 2883.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.4037412314887 10.782021304234867 5.429981813458041 29.384255650818393 2 26.8 11.600000000000001 35.225 26.375 3 21.125 17.95 24.8 36.125 4 26.150000000000002 25.55 21.675 26.625 5 26.125 28.975 24.275 20.625 6 21.275 32.300000000000004 23.674999999999997 22.75 7 16.425 24.2 40.975 18.4 8 18.45 23.5 30.875000000000004 27.175 9 18.925 21.65 33.975 25.45 10-14 22.625 27.015 26.0 24.36 15-19 23.465 25.665 26.515 24.355 20-24 22.05 26.265 27.025 24.66 25-29 22.85 26.355 25.775 25.019999999999996 30-34 22.085 26.83 26.44 24.645 35-39 22.37 26.340000000000003 26.21 25.080000000000002 40-44 21.88 26.474999999999998 26.450000000000003 25.195 45-49 22.88 26.125 26.484999999999996 24.51 50-54 22.67 26.31 26.665 24.355 55-59 23.055 26.534999999999997 25.669999999999998 24.740000000000002 60-64 22.08 26.645000000000003 25.785000000000004 25.490000000000002 65-69 23.425 26.245 26.07 24.26 70-74 22.495 26.450000000000003 25.735000000000003 25.319999999999997 75-79 22.365 25.905 26.25 25.480000000000004 80-84 22.57 25.724999999999998 26.405 25.3 85-89 22.86 25.580000000000002 26.345000000000002 25.215 90-94 22.795 25.929999999999996 26.674999999999997 24.6 95-99 22.935 25.955000000000002 26.44 24.67 100-104 23.06191857557267 25.547664299289785 26.122836851055315 25.267580274082224 105-109 23.375 25.540000000000003 26.384999999999998 24.7 110-114 22.596779033710114 26.162848854656396 26.202860858257477 25.03751125337601 115-119 23.241972591777532 26.272881864559366 25.557667300190058 24.927478243473043 120-124 22.665 26.135 25.919999999999998 25.28 125-129 22.567080496595914 26.18141770124149 25.92611133360032 25.325390468562276 130-134 23.255 26.095000000000002 25.669999999999998 24.98 135-139 23.625 26.555 25.045 24.775 140-144 23.23 26.245 25.5 25.025 145-149 23.25 26.515 25.31 24.925 150-151 23.425 25.412499999999998 25.55 25.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.5 26 3.5 27 3.0 28 4.5 29 7.5 30 9.5 31 12.0 32 18.5 33 24.5 34 31.5 35 42.5 36 58.0 37 72.0 38 86.5 39 120.5 40 141.0 41 153.0 42 181.5 43 207.0 44 221.0 45 220.0 46 227.5 47 223.5 48 196.5 49 185.0 50 177.0 51 153.5 52 133.5 53 120.0 54 106.0 55 94.5 56 78.5 57 77.5 58 79.5 59 75.0 60 69.0 61 57.5 62 50.0 63 45.0 64 40.5 65 32.0 66 29.5 67 27.0 68 23.0 69 23.5 70 13.5 71 7.0 72 7.5 73 6.0 74 8.0 75 5.0 76 1.5 77 2.5 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.03 115-119 0.03 120-124 0.0 125-129 0.12 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.680786686838124 1.35 3 0.05042864346949068 0.15 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.1625 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.3625 0.0 0.0 0.0 0.0 126-127 4.8625 0.0 0.0 0.0 0.0 128-129 5.5375 0.0 0.0 0.0 0.0 130-131 5.9625 0.0 0.0 0.0 0.0 132-133 6.525 0.0 0.0 0.0 0.0 134-135 7.3375 0.0 0.0 0.0 0.0 136-137 7.9 0.0 0.0 0.0 0.0 138-139 8.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTATTA 10 0.006836113 144.9625 5 AAGACAA 10 0.006836113 144.9625 5 AGACAAA 10 0.006836113 144.9625 6 CTATTAT 10 0.006836113 144.9625 6 >>END_MODULE SRR6958247 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958247_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.05875 33.0 27.0 33.0 18.0 34.0 2 31.7505 33.0 32.0 34.0 27.0 34.0 3 32.5395 33.0 32.0 34.0 31.0 34.0 4 32.93175 33.0 33.0 34.0 32.0 34.0 5 33.13975 33.0 33.0 34.0 33.0 34.0 6 37.567 38.0 38.0 38.0 38.0 38.0 7 37.58975 38.0 38.0 38.0 38.0 38.0 8 37.62425 38.0 38.0 38.0 38.0 38.0 9 37.56625 38.0 38.0 38.0 38.0 38.0 10-14 37.596199999999996 38.0 38.0 38.0 38.0 38.0 15-19 36.54455 38.0 37.0 38.0 32.2 38.0 20-24 36.408300000000004 38.0 37.0 38.0 31.8 38.0 25-29 37.4289 38.0 38.0 38.0 37.4 38.0 30-34 37.5881 38.0 38.0 38.0 38.0 38.0 35-39 37.516999999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.44355 38.0 38.0 38.0 37.8 38.0 45-49 37.1323 38.0 38.0 38.0 36.4 38.0 50-54 37.493399999999994 38.0 38.0 38.0 38.0 38.0 55-59 37.4894 38.0 38.0 38.0 38.0 38.0 60-64 37.46995 38.0 38.0 38.0 38.0 38.0 65-69 37.4356 38.0 38.0 38.0 38.0 38.0 70-74 37.363 38.0 38.0 38.0 38.0 38.0 75-79 37.289699999999996 38.0 38.0 38.0 37.8 38.0 80-84 37.303200000000004 38.0 38.0 38.0 38.0 38.0 85-89 37.294149999999995 38.0 38.0 38.0 37.8 38.0 90-94 37.26475 38.0 38.0 38.0 37.8 38.0 95-99 37.18195 38.0 38.0 38.0 37.0 38.0 100-104 37.07625 38.0 38.0 38.0 36.4 38.0 105-109 36.987300000000005 38.0 38.0 38.0 36.6 38.0 110-114 36.83155000000001 38.0 38.0 38.0 35.6 38.0 115-119 36.94185 38.0 38.0 38.0 36.0 38.0 120-124 36.79545 38.0 38.0 38.0 35.4 38.0 125-129 35.44035 38.0 36.0 38.0 29.0 38.0 130-134 35.944900000000004 38.0 37.4 38.0 32.8 38.0 135-139 35.75485 38.0 37.4 38.0 31.8 38.0 140-144 35.36435 38.0 36.4 38.0 31.4 38.0 145-149 33.44805 38.0 33.4 38.0 23.8 38.0 150-151 29.689625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 0.0 5 1.0 6 1.0 7 2.0 8 1.0 9 3.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 3.0 17 0.0 18 2.0 19 0.0 20 1.0 21 5.0 22 2.0 23 4.0 24 7.0 25 16.0 26 7.0 27 7.0 28 16.0 29 12.0 30 22.0 31 34.0 32 36.0 33 78.0 34 121.0 35 208.0 36 651.0 37 2752.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.8 22.175 10.674999999999999 24.349999999999998 2 31.525 22.7 27.700000000000003 18.075 3 21.85 24.375 30.425 23.35 4 25.275 31.95 22.225 20.549999999999997 5 26.3 34.325 19.35 20.025000000000002 6 23.150000000000002 37.375 19.950000000000003 19.525000000000002 7 22.575 19.55 36.1 21.775 8 22.775000000000002 24.45 25.35 27.425 9 24.55 23.200000000000003 27.224999999999998 25.025 10-14 25.230000000000004 27.605 23.73 23.435 15-19 25.180000000000003 26.240000000000002 25.455 23.125 20-24 24.525 27.21 25.019999999999996 23.244999999999997 25-29 25.230000000000004 26.11 25.465 23.195 30-34 24.834999999999997 27.04 24.845 23.28 35-39 24.87 26.435 25.485000000000003 23.21 40-44 25.405 26.125 24.75 23.72 45-49 24.97 26.115 25.365 23.549999999999997 50-54 25.15 26.055 25.3 23.494999999999997 55-59 25.945 26.14 24.535 23.380000000000003 60-64 24.81 25.795 25.75 23.645 65-69 25.27 25.895000000000003 25.729999999999997 23.105 70-74 25.074999999999996 26.179999999999996 25.505 23.24 75-79 25.115 26.424999999999997 25.874999999999996 22.585 80-84 25.45 26.384999999999998 25.94 22.225 85-89 25.045 26.26 25.974999999999998 22.720000000000002 90-94 25.5 26.26 25.845000000000002 22.395 95-99 25.305 26.22 25.724999999999998 22.75 100-104 24.610000000000003 26.090000000000003 25.474999999999998 23.825 105-109 25.590000000000003 26.97 24.715 22.725 110-114 25.424999999999997 26.674999999999997 25.314999999999998 22.585 115-119 25.314999999999998 27.065 24.91 22.71 120-124 26.1 26.35 25.365 22.185 125-129 25.795 26.935 24.845 22.425 130-134 26.840000000000003 26.41 24.959999999999997 21.790000000000003 135-139 26.169999999999998 26.56 25.650000000000002 21.62 140-144 26.075 26.76 25.28 21.884999999999998 145-149 26.575 26.845000000000002 24.83 21.75 150-151 26.6125 27.025 24.575 21.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 1.5 24 0.5 25 1.5 26 2.5 27 3.0 28 3.0 29 6.0 30 9.0 31 11.0 32 17.0 33 24.5 34 33.0 35 40.0 36 49.0 37 71.0 38 89.0 39 117.0 40 141.5 41 161.0 42 187.5 43 192.5 44 201.5 45 213.5 46 207.5 47 213.5 48 204.5 49 182.0 50 165.0 51 129.0 52 114.0 53 110.0 54 101.5 55 104.5 56 92.0 57 77.0 58 87.0 59 95.0 60 87.5 61 70.5 62 53.0 63 41.5 64 40.5 65 37.5 66 35.5 67 34.5 68 29.0 69 27.5 70 19.5 71 15.0 72 14.0 73 8.5 74 7.0 75 7.0 76 5.0 77 2.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.2 0.0 0.0 0.0 0.0 126-127 4.675000000000001 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 5.725 0.0 0.0 0.0 0.0 132-133 6.25 0.0 0.0 0.0 0.0 134-135 7.050000000000001 0.0 0.0 0.0 0.0 136-137 7.625 0.0 0.0 0.0 0.0 138-139 8.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911232 spots for SRR6958247.sra Written 911232 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra Read 911224 spots for SRR6958247.sra Written 911224 spots for SRR6958247.sra SRR ids: ['SRR6958247.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5gwx1nsy SRR6958247.sra spots: 18224488 blocks: [[1, 911224], [911225, 1822448], [1822449, 2733672], [2733673, 3644896], [3644897, 4556120], [4556121, 5467344], [5467345, 6378568], [6378569, 7289792], [7289793, 8201016], [8201017, 9112240], [9112241, 10023464], [10023465, 10934688], [10934689, 11845912], [11845913, 12757136], [12757137, 13668360], [13668361, 14579584], [14579585, 15490808], [15490809, 16402032], [16402033, 17313256], [17313257, 18224488]] SRR6958247 file size 6153980 SRR6958247 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958247 SRR6958247_1.fastq SRR6958247_2.fastq Input file: SRR6958247_1.fastq Paired file: SRR6958247_2.fastq trimmed: SRR6958247-trimmed-pair1.fastq, SRR6958247-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:32:34 2024 >> started Fri Dec 6 17:32:56 2024 >> done (21.339s) 18224488 read pairs processed; of these: 11113 ( 0.06%) short read pairs filtered out after trimming by size control 13892 ( 0.08%) empty read pairs filtered out after trimming by size control 18199483 (99.86%) read pairs available; of these: 6617820 (36.36%) trimmed read pairs available after processing 11581663 (63.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 4 0.00% 21 6 0.00% 22 9 0.00% 23 6 0.00% 24 5 0.00% 25 11 0.00% 26 7 0.00% 27 12 0.00% 28 16 0.00% 29 15 0.00% 30 15 0.00% 31 11 0.00% 32 11 0.00% 33 11 0.00% 34 17 0.00% 35 14 0.00% 36 19 0.00% 37 16 0.00% 38 15 0.00% 39 25 0.00% 40 29 0.00% 41 23 0.00% 42 41 0.00% 43 15 0.00% 44 31 0.00% 45 40 0.00% 46 56 0.00% 47 55 0.00% 48 58 0.00% 49 65 0.00% 50 69 0.00% 51 75 0.00% 52 105 0.00% 53 86 0.00% 54 106 0.00% 55 110 0.00% 56 122 0.00% 57 135 0.00% 58 155 0.00% 59 203 0.00% 60 226 0.00% 61 256 0.00% 62 283 0.00% 63 296 0.00% 64 350 0.00% 65 392 0.00% 66 408 0.00% 67 461 0.00% 68 526 0.00% 69 673 0.00% 70 681 0.00% 71 846 0.00% 72 909 0.00% 73 993 0.01% 74 1179 0.01% 75 1306 0.01% 76 1540 0.01% 77 1767 0.01% 78 1849 0.01% 79 2109 0.01% 80 2300 0.01% 81 2636 0.01% 82 2953 0.02% 83 3404 0.02% 84 4278 0.02% 85 4851 0.03% 86 4995 0.03% 87 5412 0.03% 88 5909 0.03% 89 6468 0.04% 90 6951 0.04% 91 7803 0.04% 92 8198 0.05% 93 9258 0.05% 94 9950 0.05% 95 10588 0.06% 96 11463 0.06% 97 12233 0.07% 98 12893 0.07% 99 14381 0.08% 100 16885 0.09% 101 18997 0.10% 102 16853 0.09% 103 17903 0.10% 104 19035 0.10% 105 20172 0.11% 106 21367 0.12% 107 22309 0.12% 108 23291 0.13% 109 24286 0.13% 110 25191 0.14% 111 26989 0.15% 112 28756 0.16% 113 29787 0.16% 114 31661 0.17% 115 33291 0.18% 116 34072 0.19% 117 35662 0.20% 118 36122 0.20% 119 37353 0.21% 120 38392 0.21% 121 39999 0.22% 122 41495 0.23% 123 43897 0.24% 124 45425 0.25% 125 47237 0.26% 126 48251 0.27% 127 50104 0.28% 128 50671 0.28% 129 52416 0.29% 130 54034 0.30% 131 55328 0.30% 132 58064 0.32% 133 59971 0.33% 134 61775 0.34% 135 64684 0.36% 136 66865 0.37% 137 67680 0.37% 138 70240 0.39% 139 73488 0.40% 140 76296 0.42% 141 79767 0.44% 142 85721 0.47% 143 91417 0.50% 144 101093 0.56% 145 116496 0.64% 146 136647 0.75% 147 167103 0.92% 148 258464 1.42% 149 497781 2.74% 150 3231223 17.75% 151 11581663 63.64% 18199483 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=19 prefix-density=0.79 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=43.57 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=18 prefix-density=0.49 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=193.05 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=7.7 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958247 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:33:47 Started mapping on | Dec 06 17:33:47 Finished on | Dec 06 17:35:57 Mapping speed, Million of reads per hour | 503.99 Number of input reads | 18199483 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17560569 Uniquely mapped reads % | 96.49% Average mapped length | 294.20 Number of splices: Total | 19826662 Number of splices: Annotated (sjdb) | 18632448 Number of splices: GT/AG | 19548789 Number of splices: GC/AG | 229720 Number of splices: AT/AC | 7170 Number of splices: Non-canonical | 40983 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217596 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 7219 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 429800 429800 429800 N_multimapping 217596 217596 217596 N_noFeature 700678 17021946 864341 N_ambiguous 437245 2409 62671 UnstrandedReadsAssigned:16422646 PositiveStrandReadsAssigned:536214 NegativeStrandReadsAssigned:16633557 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958247 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958247-trimmed-pair1.fastq SRR6958247-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,199,483 reads, 16,639,159 reads pseudoaligned [quant] estimated average fragment length: 239.121 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52973 SRR6958247.ke.tsv 35125 SRR6958247.se.tsv 88098 total ==> SRR6958247.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.255 0 0 PNS24247 1044 805.879 47.0837 5.32415 PNS24249 1928 1689.88 41.0281 2.21246 PNS24246 1044 805.879 47.0837 5.32415 PNS24248 1044 805.879 47.0837 5.32415 PNS24244 1471 1232.88 42.7208 3.15768 PNS24243 293 96.6546 0 0 KQK14069 1603 1364.88 3226.97 215.452 KQK14071 474 245.08 55.4593 20.6213 ==> SRR6958247.se.tsv <== BRADI_1g14170v3 3705 BRADI_1g53295v3 1009 BRADI_1g59795v3 109 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 384 BRADI_1g74790v3 59 BRADI_1g09890v3 1 BRADI_1g77505v3 238 BRADI_1g48960v3 0 SRR6958247 completed mapping pipeline successfully