Starting /dee2/code/volunteer_pipeline.sh SRR6958248 current disk space = 1550640381952 free memory = 1597952492 SRR6958248 SRAfilesize de6333dfee3ff8cf428f1e21488312a9 SRR6958248.sra SRR6958248.sra file validated SRR6958248 is paired end SRR6958248 is conventional basespace SRR6958248 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958248_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.165 33.0 32.0 33.0 2.0 34.0 2 30.6245 33.0 29.0 33.0 27.0 34.0 3 31.1215 33.0 31.0 33.0 27.0 33.0 4 32.5455 33.0 33.0 33.0 32.0 34.0 5 32.719 33.0 33.0 34.0 32.0 34.0 6 33.93025 38.0 34.0 38.0 16.0 38.0 7 36.7325 38.0 37.0 38.0 34.0 38.0 8 37.2505 38.0 38.0 38.0 36.0 38.0 9 37.50875 38.0 38.0 38.0 37.0 38.0 10-14 37.452650000000006 38.0 38.0 38.0 37.4 38.0 15-19 37.428599999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.266949999999994 38.0 38.0 38.0 36.6 38.0 25-29 37.0585 38.0 38.0 38.0 36.2 38.0 30-34 36.9387 38.0 37.8 38.0 35.2 38.0 35-39 37.0851 38.0 38.0 38.0 35.8 38.0 40-44 37.43895 38.0 38.0 38.0 37.2 38.0 45-49 37.3374 38.0 38.0 38.0 37.0 38.0 50-54 37.2236 38.0 38.0 38.0 36.8 38.0 55-59 37.2328 38.0 38.0 38.0 36.6 38.0 60-64 37.33855 38.0 38.0 38.0 37.0 38.0 65-69 36.6224 38.0 37.2 38.0 32.2 38.0 70-74 37.263149999999996 38.0 38.0 38.0 36.6 38.0 75-79 37.210350000000005 38.0 38.0 38.0 36.4 38.0 80-84 37.169200000000004 38.0 38.0 38.0 36.4 38.0 85-89 36.857099999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.32619999999999 38.0 37.8 38.0 33.4 38.0 95-99 34.21445 38.0 33.8 38.0 22.4 38.0 100-104 35.64845 38.0 37.0 38.0 29.8 38.0 105-109 35.5889 38.0 36.6 38.0 30.2 38.0 110-114 35.704899999999995 38.0 36.8 38.0 30.6 38.0 115-119 36.324400000000004 38.0 37.4 38.0 33.6 38.0 120-124 36.4178 38.0 38.0 38.0 34.0 38.0 125-129 36.3722 38.0 38.0 38.0 34.0 38.0 130-134 36.14275 38.0 37.4 38.0 33.4 38.0 135-139 35.630399999999995 38.0 36.0 38.0 32.0 38.0 140-144 35.2909 38.0 35.8 38.0 30.6 38.0 145-149 32.36045 37.0 29.4 38.0 20.8 38.0 150-151 29.18925 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 0.0 18 0.0 19 3.0 20 2.0 21 0.0 22 2.0 23 4.0 24 10.0 25 9.0 26 18.0 27 18.0 28 26.0 29 32.0 30 54.0 31 66.0 32 85.0 33 135.0 34 193.0 35 360.0 36 881.0 37 2098.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.49431818181818 8.835227272727272 8.75 38.92045454545455 2 26.8 13.450000000000001 32.975 26.775 3 22.15 17.0 25.5 35.35 4 26.825 23.825 22.45 26.900000000000002 5 25.8 29.849999999999998 24.0 20.349999999999998 6 21.25 32.875 23.825 22.05 7 16.375 21.95 41.25 20.424999999999997 8 19.6 24.05 28.999999999999996 27.35 9 19.6 22.225 33.225 24.95 10-14 22.875 26.895000000000003 25.81 24.42 15-19 22.49 25.155 26.755000000000003 25.6 20-24 22.065 25.605 26.855 25.474999999999998 25-29 22.85 25.835 26.345000000000002 24.97 30-34 23.169999999999998 25.080000000000002 26.279999999999998 25.47 35-39 22.78 25.624999999999996 26.6 24.995 40-44 23.16 25.445 26.02 25.374999999999996 45-49 22.655 25.474999999999998 26.38 25.490000000000002 50-54 23.125 25.685000000000002 25.885 25.305 55-59 22.2 25.264999999999997 26.275 26.26 60-64 22.37 26.005 26.0 25.624999999999996 65-69 22.725 25.755 25.974999999999998 25.545 70-74 22.770000000000003 26.174999999999997 25.75 25.305 75-79 23.49 25.575 25.605 25.330000000000002 80-84 22.6 25.555 26.36 25.485000000000003 85-89 22.7 25.174999999999997 26.44 25.685000000000002 90-94 23.11 25.05 26.185000000000002 25.655 95-99 23.255 25.22 25.715 25.81 100-104 23.400000000000002 24.615000000000002 26.185000000000002 25.8 105-109 22.62 25.174999999999997 25.965 26.240000000000002 110-114 23.215 25.679999999999996 25.979999999999997 25.124999999999996 115-119 23.155 24.81 25.974999999999998 26.06 120-124 23.24 25.365 26.035000000000004 25.36 125-129 22.85 25.245 25.965 25.94 130-134 23.485 25.119999999999997 26.015 25.380000000000003 135-139 22.75 25.569999999999997 25.64 26.040000000000003 140-144 23.715 25.035 25.555 25.695 145-149 23.544999999999998 25.52 26.064999999999998 24.87 150-151 23.4375 24.9875 25.137500000000003 26.437500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 3.0 28 5.0 29 4.0 30 5.0 31 7.0 32 11.0 33 17.5 34 21.0 35 35.0 36 53.5 37 67.0 38 91.0 39 121.5 40 144.0 41 167.0 42 184.5 43 208.0 44 220.0 45 208.0 46 219.0 47 209.5 48 193.0 49 188.0 50 168.0 51 153.5 52 132.0 53 118.5 54 103.0 55 94.5 56 96.0 57 79.0 58 67.5 59 66.5 60 63.5 61 59.0 62 53.0 63 52.0 64 52.0 65 39.5 66 33.5 67 38.5 68 32.0 69 24.0 70 23.0 71 18.5 72 15.0 73 12.5 74 6.5 75 3.0 76 4.0 77 3.5 78 1.5 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.0750000000000002 0.0 0.0 0.0 0.0 120-121 1.2375 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.6124999999999998 0.0 0.0 0.0 0.0 126-127 1.7625000000000002 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.3 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 3.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958248 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958248_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.866 33.0 33.0 34.0 32.0 34.0 2 33.07625 34.0 33.0 34.0 32.0 34.0 3 33.05075 34.0 33.0 34.0 32.0 34.0 4 32.81125 34.0 33.0 34.0 32.0 34.0 5 32.91075 34.0 33.0 34.0 32.0 34.0 6 37.1435 38.0 38.0 38.0 36.0 38.0 7 37.1535 38.0 38.0 38.0 37.0 38.0 8 37.057 38.0 38.0 38.0 36.0 38.0 9 37.0125 38.0 38.0 38.0 36.0 38.0 10-14 36.898999999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.4481 38.0 38.0 38.0 34.0 38.0 20-24 36.67465 38.0 38.0 38.0 34.6 38.0 25-29 36.8855 38.0 38.0 38.0 35.8 38.0 30-34 37.0838 38.0 38.0 38.0 36.4 38.0 35-39 37.1518 38.0 38.0 38.0 37.0 38.0 40-44 35.342999999999996 37.8 35.2 38.0 29.8 38.0 45-49 36.839150000000004 38.0 38.0 38.0 35.4 38.0 50-54 36.35209999999999 38.0 38.0 38.0 33.4 38.0 55-59 36.61709999999999 38.0 38.0 38.0 34.8 38.0 60-64 36.62955 38.0 38.0 38.0 34.6 38.0 65-69 36.55780000000001 38.0 38.0 38.0 34.6 38.0 70-74 36.2685 38.0 38.0 38.0 33.4 38.0 75-79 36.04595 38.0 37.6 38.0 31.6 38.0 80-84 36.03875000000001 38.0 38.0 38.0 32.8 38.0 85-89 35.82515 38.0 37.6 38.0 31.2 38.0 90-94 36.216350000000006 38.0 38.0 38.0 33.6 38.0 95-99 36.3712 38.0 38.0 38.0 34.0 38.0 100-104 36.3251 38.0 38.0 38.0 33.8 38.0 105-109 36.31675 38.0 38.0 38.0 34.0 38.0 110-114 36.120549999999994 38.0 38.0 38.0 33.8 38.0 115-119 35.5846 38.0 37.0 38.0 30.8 38.0 120-124 34.7476 38.0 35.4 38.0 25.6 38.0 125-129 32.9885 37.2 30.8 38.0 20.2 38.0 130-134 30.64495 34.8 25.4 38.0 18.4 38.0 135-139 34.588750000000005 38.0 34.8 38.0 27.6 38.0 140-144 34.26405 38.0 34.4 38.0 26.2 38.0 145-149 34.265049999999995 38.0 35.6 38.0 28.0 38.0 150-151 29.088 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 2.0 11 1.0 12 1.0 13 3.0 14 0.0 15 3.0 16 3.0 17 3.0 18 3.0 19 1.0 20 10.0 21 11.0 22 10.0 23 16.0 24 15.0 25 23.0 26 31.0 27 33.0 28 38.0 29 55.0 30 68.0 31 80.0 32 84.0 33 134.0 34 199.0 35 311.0 36 847.0 37 2002.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.699999999999996 19.025 12.475 32.800000000000004 2 31.05 23.200000000000003 26.875 18.875 3 22.5 27.0 27.325 23.175 4 25.374999999999996 33.2 19.650000000000002 21.775 5 26.825 33.0 20.225 19.950000000000003 6 24.025 35.099999999999994 19.975 20.9 7 21.9 20.275000000000002 34.825 23.0 8 26.0 23.25 23.325000000000003 27.425 9 23.775 23.525 27.125 25.575 10-14 25.46 26.22 23.905 24.415 15-19 25.009999999999998 25.7 25.240000000000002 24.05 20-24 25.665 25.874999999999996 24.55 23.91 25-29 25.105 26.040000000000003 24.745 24.11 30-34 25.629999999999995 26.245 24.26 23.865 35-39 25.275 26.064999999999998 24.779999999999998 23.880000000000003 40-44 25.69 25.995 24.335 23.98 45-49 25.395 26.07 25.124999999999996 23.41 50-54 25.385 25.77 24.93 23.915 55-59 26.095000000000002 25.41 24.84 23.655 60-64 25.4 25.869999999999997 25.355 23.375 65-69 25.535000000000004 25.755 25.130000000000003 23.580000000000002 70-74 25.840000000000003 25.795 24.705 23.66 75-79 25.074999999999996 26.200000000000003 25.39 23.335 80-84 25.335 25.974999999999998 25.0 23.69 85-89 25.495 26.08 25.419999999999998 23.005 90-94 25.785000000000004 25.979999999999997 24.695 23.54 95-99 26.05 26.13 25.169999999999998 22.650000000000002 100-104 25.235000000000003 26.165 24.585 24.015 105-109 25.740000000000002 25.88 25.195 23.185 110-114 26.08 26.384999999999998 24.735 22.8 115-119 26.185000000000002 26.21 24.985 22.62 120-124 25.785000000000004 26.58 24.57 23.064999999999998 125-129 25.585 26.150000000000002 25.259999999999998 23.005 130-134 26.365 25.895000000000003 24.75 22.99 135-139 25.635 26.46 25.435000000000002 22.470000000000002 140-144 26.3 26.77 24.39 22.54 145-149 26.43 26.405 25.014999999999997 22.15 150-151 25.8125 26.875 24.887500000000003 22.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 2.5 28 5.0 29 5.0 30 8.5 31 12.5 32 15.0 33 19.5 34 21.5 35 31.5 36 48.5 37 62.0 38 74.5 39 93.0 40 123.0 41 159.0 42 180.5 43 185.0 44 184.5 45 200.5 46 209.0 47 206.0 48 203.5 49 180.0 50 156.0 51 145.5 52 137.0 53 124.0 54 109.5 55 98.5 56 97.0 57 92.5 58 88.5 59 80.5 60 72.0 61 65.0 62 59.5 63 62.0 64 57.0 65 52.0 66 45.0 67 37.0 68 39.5 69 38.0 70 27.0 71 23.0 72 20.0 73 13.0 74 9.0 75 5.0 76 4.0 77 3.5 78 1.5 79 1.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7315842583249244 1.4500000000000002 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0125 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.05 0.0 0.025 0.0 0.0 80-81 0.05 0.0 0.025 0.0 0.0 82-83 0.05 0.0 0.025 0.0 0.0 84-85 0.05 0.0 0.025 0.0 0.0 86-87 0.0625 0.0 0.025 0.0 0.0 88-89 0.075 0.0 0.025 0.0 0.0 90-91 0.075 0.0 0.025 0.0 0.0 92-93 0.075 0.0 0.025 0.0 0.0 94-95 0.1375 0.0 0.025 0.0 0.0 96-97 0.1875 0.0 0.025 0.0 0.0 98-99 0.3125 0.0 0.025 0.0 0.0 100-101 0.35 0.0 0.025 0.0 0.0 102-103 0.35 0.0 0.025 0.0 0.0 104-105 0.4 0.0 0.025 0.0 0.0 106-107 0.4875 0.0 0.025 0.0 0.0 108-109 0.55 0.0 0.025 0.0 0.0 110-111 0.65 0.0 0.025 0.0 0.0 112-113 0.75 0.0 0.025 0.0 0.0 114-115 0.9125 0.0 0.025 0.0 0.0 116-117 1.025 0.0 0.025 0.0 0.0 118-119 1.0625 0.0 0.025 0.0 0.0 120-121 1.2 0.0 0.025 0.0 0.0 122-123 1.3625 0.0 0.025 0.0 0.0 124-125 1.4874999999999998 0.0 0.025 0.0 0.0 126-127 1.6375000000000002 0.0 0.025 0.0 0.0 128-129 1.725 0.0 0.025 0.0 0.0 130-131 1.8875 0.0 0.025 0.0 0.0 132-133 2.125 0.0 0.025 0.0 0.0 134-135 2.4000000000000004 0.0 0.025 0.0 0.0 136-137 2.6125 0.0 0.025 0.0 0.0 138-139 2.9125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAGAA 10 0.006830828 145.0 3 >>END_MODULE Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328341 spots for SRR6958248.sra Written 1328341 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra Read 1328337 spots for SRR6958248.sra Written 1328337 spots for SRR6958248.sra SRR ids: ['SRR6958248.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5_6doyi8 SRR6958248.sra spots: 26566744 blocks: [[1, 1328337], [1328338, 2656674], [2656675, 3985011], [3985012, 5313348], [5313349, 6641685], [6641686, 7970022], [7970023, 9298359], [9298360, 10626696], [10626697, 11955033], [11955034, 13283370], [13283371, 14611707], [14611708, 15940044], [15940045, 17268381], [17268382, 18596718], [18596719, 19925055], [19925056, 21253392], [21253393, 22581729], [22581730, 23910066], [23910067, 25238403], [25238404, 26566744]] SRR6958248 file size 8980897 SRR6958248 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958248 SRR6958248_1.fastq SRR6958248_2.fastq Input file: SRR6958248_1.fastq Paired file: SRR6958248_2.fastq trimmed: SRR6958248-trimmed-pair1.fastq, SRR6958248-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:35:30 2024 >> started Fri Dec 6 17:35:57 2024 >> done (27.172s) 26566744 read pairs processed; of these: 20899 ( 0.08%) short read pairs filtered out after trimming by size control 15957 ( 0.06%) empty read pairs filtered out after trimming by size control 26529888 (99.86%) read pairs available; of these: 8543929 (32.20%) trimmed read pairs available after processing 17985959 (67.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 8 0.00% 21 5 0.00% 22 8 0.00% 23 3 0.00% 24 3 0.00% 25 9 0.00% 26 7 0.00% 27 2 0.00% 28 10 0.00% 29 9 0.00% 30 7 0.00% 31 6 0.00% 32 13 0.00% 33 10 0.00% 34 12 0.00% 35 9 0.00% 36 16 0.00% 37 4 0.00% 38 15 0.00% 39 15 0.00% 40 14 0.00% 41 16 0.00% 42 12 0.00% 43 19 0.00% 44 20 0.00% 45 17 0.00% 46 24 0.00% 47 27 0.00% 48 25 0.00% 49 36 0.00% 50 42 0.00% 51 35 0.00% 52 50 0.00% 53 49 0.00% 54 56 0.00% 55 53 0.00% 56 67 0.00% 57 71 0.00% 58 64 0.00% 59 91 0.00% 60 117 0.00% 61 108 0.00% 62 142 0.00% 63 177 0.00% 64 193 0.00% 65 180 0.00% 66 218 0.00% 67 246 0.00% 68 261 0.00% 69 299 0.00% 70 314 0.00% 71 406 0.00% 72 445 0.00% 73 512 0.00% 74 577 0.00% 75 671 0.00% 76 762 0.00% 77 819 0.00% 78 977 0.00% 79 1028 0.00% 80 1215 0.00% 81 1326 0.00% 82 1664 0.01% 83 1890 0.01% 84 2937 0.01% 85 3696 0.01% 86 3846 0.01% 87 4001 0.02% 88 4057 0.02% 89 4364 0.02% 90 4615 0.02% 91 5048 0.02% 92 5416 0.02% 93 5874 0.02% 94 6159 0.02% 95 6547 0.02% 96 7026 0.03% 97 7336 0.03% 98 7621 0.03% 99 8410 0.03% 100 8859 0.03% 101 9514 0.04% 102 10357 0.04% 103 11178 0.04% 104 12070 0.05% 105 12636 0.05% 106 13438 0.05% 107 14033 0.05% 108 14590 0.05% 109 15323 0.06% 110 16519 0.06% 111 17235 0.06% 112 18684 0.07% 113 19678 0.07% 114 21107 0.08% 115 22247 0.08% 116 23516 0.09% 117 24225 0.09% 118 25353 0.10% 119 26043 0.10% 120 27327 0.10% 121 28396 0.11% 122 30252 0.11% 123 31874 0.12% 124 33865 0.13% 125 35588 0.13% 126 37281 0.14% 127 38959 0.15% 128 39866 0.15% 129 41667 0.16% 130 43413 0.16% 131 46061 0.17% 132 48295 0.18% 133 51118 0.19% 134 54222 0.20% 135 58033 0.22% 136 61299 0.23% 137 64375 0.24% 138 68290 0.26% 139 72534 0.27% 140 77264 0.29% 141 84800 0.32% 142 93785 0.35% 143 105425 0.40% 144 120491 0.45% 145 142724 0.54% 146 175434 0.66% 147 232621 0.88% 148 349591 1.32% 149 703492 2.65% 150 5106515 19.25% 151 17985959 67.80% 26529888 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=158.28 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.1 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=22 prefix-density=0.49 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=30.90 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=4.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958248 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:36:40 Started mapping on | Dec 06 17:36:40 Finished on | Dec 06 17:39:58 Mapping speed, Million of reads per hour | 482.36 Number of input reads | 26529888 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 25438766 Uniquely mapped reads % | 95.89% Average mapped length | 297.37 Number of splices: Total | 29682457 Number of splices: Annotated (sjdb) | 27963814 Number of splices: GT/AG | 29269226 Number of splices: GC/AG | 344957 Number of splices: AT/AC | 11332 Number of splices: Non-canonical | 56942 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320342 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 19083 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 784949 784949 784949 N_multimapping 320342 320342 320342 N_noFeature 984312 24637850 1182093 N_ambiguous 698004 3333 95790 UnstrandedReadsAssigned:23756450 PositiveStrandReadsAssigned:797583 NegativeStrandReadsAssigned:24160883 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958248 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958248-trimmed-pair1.fastq SRR6958248-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,529,888 reads, 24,134,903 reads pseudoaligned [quant] estimated average fragment length: 272.999 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52973 SRR6958248.ke.tsv 35125 SRR6958248.se.tsv 88098 total ==> SRR6958248.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.639 0 0 PNS24247 1044 772.001 75.5213 6.13008 PNS24249 1928 1656 72.6419 2.74878 PNS24246 1044 772.001 75.5213 6.13008 PNS24248 1044 772.001 75.5213 6.13008 PNS24244 1471 1199 59.7941 3.12502 PNS24243 293 81.2962 0 0 KQK14069 1603 1331 5984.23 281.737 KQK14071 474 219.803 71.3909 20.3528 ==> SRR6958248.se.tsv <== BRADI_1g14170v3 6632 BRADI_1g53295v3 1871 BRADI_1g59795v3 204 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 568 BRADI_1g74790v3 139 BRADI_1g09890v3 0 BRADI_1g77505v3 337 BRADI_1g48960v3 0 SRR6958248 completed mapping pipeline successfully