Starting /dee2/code/volunteer_pipeline.sh SRR6958250 current disk space = 1550568980480 free memory = 1601632780 SRR6958250 SRAfilesize 1f803df7292fdb84167caadac9bb8b1a SRR6958250.sra SRR6958250.sra file validated SRR6958250 is paired end SRR6958250 is conventional basespace SRR6958250 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958250_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.006 33.0 31.0 33.0 18.0 34.0 2 31.915 33.0 31.0 33.0 28.0 34.0 3 31.7325 33.0 31.0 33.0 28.0 34.0 4 32.2985 33.0 33.0 34.0 31.0 34.0 5 32.48525 33.0 33.0 34.0 31.0 34.0 6 36.56025 38.0 37.0 38.0 34.0 38.0 7 36.8505 38.0 38.0 38.0 35.0 38.0 8 37.28325 38.0 38.0 38.0 37.0 38.0 9 37.32675 38.0 38.0 38.0 37.0 38.0 10-14 37.311749999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.344550000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.4162 38.0 38.0 38.0 37.0 38.0 25-29 37.365750000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.18745 38.0 38.0 38.0 36.6 38.0 35-39 36.977199999999996 38.0 38.0 38.0 36.0 38.0 40-44 37.0585 38.0 38.0 38.0 36.0 38.0 45-49 37.116550000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.99455 38.0 38.0 38.0 35.6 38.0 55-59 36.9089 38.0 38.0 38.0 35.2 38.0 60-64 36.940250000000006 38.0 38.0 38.0 35.4 38.0 65-69 36.98870000000001 38.0 38.0 38.0 35.4 38.0 70-74 36.9966 38.0 38.0 38.0 35.6 38.0 75-79 36.7535 38.0 38.0 38.0 34.6 38.0 80-84 36.3889 38.0 37.6 38.0 33.6 38.0 85-89 36.39175 38.0 37.8 38.0 33.8 38.0 90-94 36.538000000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.51135 38.0 37.8 38.0 34.0 38.0 100-104 36.2713 38.0 37.2 38.0 33.4 38.0 105-109 35.808550000000004 38.0 36.6 38.0 31.0 38.0 110-114 35.846500000000006 38.0 36.4 38.0 31.4 38.0 115-119 35.851749999999996 38.0 36.6 38.0 31.6 38.0 120-124 35.51505 38.0 35.8 38.0 30.0 38.0 125-129 35.050599999999996 38.0 35.0 38.0 28.2 38.0 130-134 34.8291 38.0 35.0 38.0 27.6 38.0 135-139 34.6169 38.0 34.8 38.0 27.0 38.0 140-144 34.43135 38.0 34.8 38.0 26.4 38.0 145-149 33.02105000000001 38.0 33.8 38.0 17.0 38.0 150-151 28.1115 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 0.0 19 1.0 20 1.0 21 3.0 22 5.0 23 4.0 24 12.0 25 10.0 26 14.0 27 28.0 28 21.0 29 38.0 30 62.0 31 67.0 32 111.0 33 151.0 34 231.0 35 389.0 36 846.0 37 2001.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.11755607115236 9.332302139726734 9.074503738076825 45.47563805104408 2 20.1 12.65 37.55 29.7 3 20.925 14.2 26.125 38.75 4 24.925 22.125 22.15 30.8 5 25.900000000000002 27.775 25.424999999999997 20.9 6 23.25 30.925000000000004 23.525 22.3 7 17.724999999999998 23.75 39.225 19.3 8 20.4 25.45 29.75 24.4 9 20.175 22.475 33.800000000000004 23.549999999999997 10-14 22.795 26.935 25.895000000000003 24.375 15-19 22.125 25.71 26.400000000000002 25.765 20-24 22.88 25.759999999999998 26.46 24.9 25-29 22.575 25.97 26.040000000000003 25.415 30-34 22.48 25.605 26.345000000000002 25.569999999999997 35-39 22.875 25.35 26.490000000000002 25.285000000000004 40-44 22.67 25.569999999999997 26.125 25.635 45-49 22.34 26.205000000000002 26.015 25.44 50-54 22.650000000000002 25.89 25.895000000000003 25.564999999999998 55-59 22.62 26.035000000000004 25.91 25.435000000000002 60-64 22.705000000000002 25.615 25.424999999999997 26.255 65-69 22.62 25.264999999999997 26.185000000000002 25.929999999999996 70-74 22.84 25.88 25.869999999999997 25.41 75-79 23.025000000000002 25.195 26.33 25.45 80-84 22.465 25.669999999999998 25.979999999999997 25.885 85-89 23.1 25.36 26.235000000000003 25.305 90-94 22.785 25.4 26.08 25.735000000000003 95-99 23.43 25.415 25.44 25.715 100-104 23.175 25.31 26.32 25.195 105-109 23.474999999999998 24.715 26.279999999999998 25.53 110-114 22.91 25.324999999999996 25.995 25.77 115-119 22.814999999999998 25.180000000000003 26.340000000000003 25.665 120-124 22.939999999999998 25.165 25.71 26.185000000000002 125-129 23.14 25.115 26.534999999999997 25.21 130-134 23.7 25.495 25.540000000000003 25.264999999999997 135-139 23.150000000000002 25.419999999999998 25.985000000000003 25.445 140-144 22.98 25.64 25.685000000000002 25.695 145-149 23.325000000000003 25.135 25.795 25.745 150-151 23.962500000000002 25.224999999999998 25.837500000000002 24.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 1.5 29 4.5 30 7.5 31 9.5 32 14.5 33 18.5 34 26.5 35 37.0 36 45.5 37 66.5 38 89.5 39 110.0 40 123.5 41 136.5 42 175.0 43 211.5 44 223.5 45 224.5 46 219.5 47 219.0 48 208.5 49 196.5 50 185.0 51 162.0 52 136.5 53 106.5 54 99.0 55 93.0 56 87.0 57 86.0 58 72.5 59 68.0 60 61.0 61 57.0 62 57.5 63 56.5 64 55.5 65 55.5 66 44.0 67 28.0 68 26.5 69 23.5 70 17.5 71 13.0 72 13.5 73 10.5 74 5.0 75 4.0 76 3.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.7250000000000001 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.325 0.0 0.0 0.0 0.0 130-131 1.5375 0.0 0.0 0.0 0.0 132-133 1.7625 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.2 0.0 0.0 0.0 0.0 138-139 2.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCTT 10 0.006836113 144.9625 9 AAACATG 10 0.006836113 144.9625 145 >>END_MODULE SRR6958250 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958250_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84175 33.0 33.0 34.0 32.0 34.0 2 32.947 33.0 33.0 34.0 32.0 34.0 3 32.96475 34.0 33.0 34.0 32.0 34.0 4 33.06875 34.0 33.0 34.0 32.0 34.0 5 32.9915 34.0 33.0 34.0 32.0 34.0 6 36.9875 38.0 38.0 38.0 36.0 38.0 7 36.929 38.0 38.0 38.0 36.0 38.0 8 36.80475 38.0 38.0 38.0 35.0 38.0 9 36.90325 38.0 38.0 38.0 35.0 38.0 10-14 36.81515 38.0 38.0 38.0 35.2 38.0 15-19 36.89184999999999 38.0 38.0 38.0 35.4 38.0 20-24 36.932449999999996 38.0 38.0 38.0 35.8 38.0 25-29 37.00535 38.0 38.0 38.0 36.0 38.0 30-34 37.015150000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.90505 38.0 38.0 38.0 35.8 38.0 40-44 36.798950000000005 38.0 38.0 38.0 35.0 38.0 45-49 36.84525000000001 38.0 38.0 38.0 35.0 38.0 50-54 36.726350000000004 38.0 38.0 38.0 34.8 38.0 55-59 36.7636 38.0 38.0 38.0 34.8 38.0 60-64 36.7735 38.0 38.0 38.0 35.0 38.0 65-69 36.6076 38.0 38.0 38.0 34.4 38.0 70-74 36.447950000000006 38.0 38.0 38.0 34.0 38.0 75-79 36.2513 38.0 37.8 38.0 33.6 38.0 80-84 36.164249999999996 38.0 37.6 38.0 33.0 38.0 85-89 36.076550000000005 38.0 37.0 38.0 32.8 38.0 90-94 35.990750000000006 38.0 37.4 38.0 32.6 38.0 95-99 35.925149999999995 38.0 37.0 38.0 32.0 38.0 100-104 35.6506 38.0 36.8 38.0 30.8 38.0 105-109 35.5391 38.0 36.8 38.0 30.6 38.0 110-114 35.308499999999995 38.0 36.0 38.0 29.2 38.0 115-119 34.799899999999994 38.0 35.0 38.0 27.2 38.0 120-124 34.94485000000001 38.0 35.0 38.0 28.0 38.0 125-129 34.6558 38.0 35.0 38.0 26.6 38.0 130-134 34.01905000000001 38.0 34.2 38.0 23.0 38.0 135-139 33.669000000000004 38.0 34.0 38.0 22.2 38.0 140-144 33.3946 38.0 33.6 38.0 20.6 38.0 145-149 32.304 38.0 32.4 38.0 13.2 38.0 150-151 27.3955 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 3.0 13 3.0 14 0.0 15 3.0 16 4.0 17 1.0 18 1.0 19 6.0 20 6.0 21 11.0 22 7.0 23 12.0 24 20.0 25 21.0 26 36.0 27 31.0 28 49.0 29 48.0 30 62.0 31 78.0 32 109.0 33 144.0 34 223.0 35 361.0 36 788.0 37 1965.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.8 16.7 13.15 39.35 2 28.575 23.95 28.025 19.45 3 22.625 25.724999999999998 26.974999999999998 24.675 4 26.138069034517258 29.314657328664335 21.435717858929465 23.111555777888945 5 27.763881940970485 31.49074537268634 20.535267633816908 20.210105052526263 6 21.5 36.425000000000004 21.675 20.4 7 22.325 19.575 34.449999999999996 23.65 8 24.4 23.35 25.75 26.5 9 23.325000000000003 23.0 30.275000000000002 23.400000000000002 10-14 25.174999999999997 26.875 23.385 24.565 15-19 25.635 25.885 24.57 23.91 20-24 25.11 26.07 25.005 23.815 25-29 25.185000000000002 26.724999999999998 24.240000000000002 23.849999999999998 30-34 25.795 25.674999999999997 24.490000000000002 24.04 35-39 25.72 25.990000000000002 24.2 24.09 40-44 25.56 25.665 24.48 24.295 45-49 25.619999999999997 25.795 24.805 23.78 50-54 25.995 25.695 24.560000000000002 23.75 55-59 25.39 26.13 24.245 24.235 60-64 25.324999999999996 25.735000000000003 25.035 23.905 65-69 25.224999999999998 26.555 24.73 23.49 70-74 25.715 25.825 24.775 23.685000000000002 75-79 25.66 25.865 24.905 23.57 80-84 25.929999999999996 25.585 25.095 23.39 85-89 26.025 25.35 25.324999999999996 23.3 90-94 25.474999999999998 25.5 25.785000000000004 23.24 95-99 25.705 26.51 24.545 23.24 100-104 25.8 25.430000000000003 25.290000000000003 23.48 105-109 25.255 25.895000000000003 25.455 23.395 110-114 26.305 26.33 24.759999999999998 22.605 115-119 25.990000000000002 26.16 24.555 23.294999999999998 120-124 25.919999999999998 25.655 25.46 22.965 125-129 26.02 26.150000000000002 24.665 23.165 130-134 26.135 26.009999999999998 24.959999999999997 22.895 135-139 26.76 25.72 24.895 22.625 140-144 25.855 26.085 25.124999999999996 22.935 145-149 26.44 26.58 24.345 22.634999999999998 150-151 26.5 26.137500000000003 24.3875 22.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.5 25 2.0 26 0.5 27 1.0 28 3.5 29 3.0 30 1.5 31 7.5 32 14.5 33 16.0 34 20.5 35 25.5 36 36.5 37 58.5 38 85.5 39 107.5 40 128.5 41 151.0 42 170.0 43 193.5 44 217.5 45 216.0 46 187.0 47 186.0 48 204.0 49 182.0 50 148.0 51 135.5 52 129.0 53 120.5 54 111.0 55 102.5 56 97.5 57 99.0 58 91.5 59 89.0 60 82.0 61 71.0 62 72.0 63 66.0 64 55.5 65 42.0 66 39.5 67 48.5 68 46.0 69 31.0 70 20.5 71 18.0 72 13.5 73 12.0 74 14.5 75 10.5 76 4.5 77 1.5 78 1.5 79 1.0 80 0.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16476841305999 97.95 2 0.6327512022272842 1.25 3 0.12655024044545685 0.375 4 0.02531004808909137 0.1 5 0.0 0.0 6 0.02531004808909137 0.15 7 0.02531004808909137 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.7749999999999999 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 0.9625 0.0 0.0 0.0 0.0 126-127 1.125 0.0 0.0 0.0 0.0 128-129 1.325 0.0 0.0 0.0 0.0 130-131 1.5375 0.0 0.0 0.0 0.0 132-133 1.7375 0.0 0.0 0.0 0.0 134-135 1.975 0.0 0.0 0.0 0.0 136-137 2.175 0.0 0.0 0.0 0.0 138-139 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334382 spots for SRR6958250.sra Written 1334382 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra Read 1334364 spots for SRR6958250.sra Written 1334364 spots for SRR6958250.sra SRR ids: ['SRR6958250.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ufsf2h6b SRR6958250.sra spots: 26687298 blocks: [[1, 1334364], [1334365, 2668728], [2668729, 4003092], [4003093, 5337456], [5337457, 6671820], [6671821, 8006184], [8006185, 9340548], [9340549, 10674912], [10674913, 12009276], [12009277, 13343640], [13343641, 14678004], [14678005, 16012368], [16012369, 17346732], [17346733, 18681096], [18681097, 20015460], [20015461, 21349824], [21349825, 22684188], [22684189, 24018552], [24018553, 25352916], [25352917, 26687298]] SRR6958250 file size 9021749 SRR6958250 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958250 SRR6958250_1.fastq SRR6958250_2.fastq Input file: SRR6958250_1.fastq Paired file: SRR6958250_2.fastq trimmed: SRR6958250-trimmed-pair1.fastq, SRR6958250-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:37:08 2024 >> started Fri Dec 6 17:37:35 2024 >> done (26.655s) 26687298 read pairs processed; of these: 11761 ( 0.04%) short read pairs filtered out after trimming by size control 7768 ( 0.03%) empty read pairs filtered out after trimming by size control 26667769 (99.93%) read pairs available; of these: 9547871 (35.80%) trimmed read pairs available after processing 17119898 (64.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 6 0.00% 21 5 0.00% 22 2 0.00% 23 2 0.00% 24 10 0.00% 25 3 0.00% 26 3 0.00% 27 9 0.00% 28 5 0.00% 29 6 0.00% 30 9 0.00% 31 6 0.00% 32 11 0.00% 33 4 0.00% 34 12 0.00% 35 11 0.00% 36 6 0.00% 37 6 0.00% 38 6 0.00% 39 13 0.00% 40 13 0.00% 41 10 0.00% 42 11 0.00% 43 14 0.00% 44 16 0.00% 45 18 0.00% 46 21 0.00% 47 30 0.00% 48 30 0.00% 49 31 0.00% 50 34 0.00% 51 36 0.00% 52 38 0.00% 53 40 0.00% 54 45 0.00% 55 68 0.00% 56 60 0.00% 57 55 0.00% 58 82 0.00% 59 78 0.00% 60 89 0.00% 61 92 0.00% 62 133 0.00% 63 136 0.00% 64 124 0.00% 65 176 0.00% 66 160 0.00% 67 194 0.00% 68 199 0.00% 69 274 0.00% 70 279 0.00% 71 309 0.00% 72 351 0.00% 73 375 0.00% 74 400 0.00% 75 509 0.00% 76 548 0.00% 77 574 0.00% 78 661 0.00% 79 677 0.00% 80 809 0.00% 81 955 0.00% 82 1065 0.00% 83 1170 0.00% 84 1877 0.01% 85 2377 0.01% 86 2441 0.01% 87 2527 0.01% 88 2759 0.01% 89 2841 0.01% 90 2997 0.01% 91 3324 0.01% 92 3454 0.01% 93 3712 0.01% 94 4058 0.02% 95 4356 0.02% 96 4571 0.02% 97 5063 0.02% 98 5485 0.02% 99 5591 0.02% 100 6133 0.02% 101 6520 0.02% 102 6998 0.03% 103 7578 0.03% 104 8232 0.03% 105 8512 0.03% 106 9288 0.03% 107 9943 0.04% 108 10371 0.04% 109 11269 0.04% 110 12170 0.05% 111 12748 0.05% 112 13702 0.05% 113 14404 0.05% 114 15464 0.06% 115 16548 0.06% 116 17891 0.07% 117 18653 0.07% 118 20186 0.08% 119 20953 0.08% 120 22153 0.08% 121 23579 0.09% 122 24458 0.09% 123 26250 0.10% 124 27948 0.10% 125 29514 0.11% 126 31175 0.12% 127 33248 0.12% 128 35272 0.13% 129 37029 0.14% 130 39877 0.15% 131 42427 0.16% 132 45250 0.17% 133 48641 0.18% 134 51427 0.19% 135 55061 0.21% 136 59626 0.22% 137 64436 0.24% 138 69754 0.26% 139 75921 0.28% 140 82515 0.31% 141 91426 0.34% 142 103430 0.39% 143 118061 0.44% 144 139223 0.52% 145 169235 0.63% 146 214353 0.80% 147 298039 1.12% 148 468457 1.76% 149 976073 3.66% 150 5727889 21.48% 151 17119898 64.20% 26667769 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=21 prefix-density=0.69 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=26.37 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=28 prefix-density=0.53 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=62.61 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.1 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958250 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:38:16 Started mapping on | Dec 06 17:38:16 Finished on | Dec 06 17:40:54 Mapping speed, Million of reads per hour | 607.62 Number of input reads | 26667769 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 25996317 Uniquely mapped reads % | 97.48% Average mapped length | 297.85 Number of splices: Total | 31395055 Number of splices: Annotated (sjdb) | 29632867 Number of splices: GT/AG | 30958957 Number of splices: GC/AG | 368591 Number of splices: AT/AC | 11937 Number of splices: Non-canonical | 55570 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303861 % of reads mapped to multiple loci | 1.14% Number of reads mapped to too many loci | 9945 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 375579 375579 375579 N_multimapping 303861 303861 303861 N_noFeature 890379 25236466 1072708 N_ambiguous 675608 3078 99208 UnstrandedReadsAssigned:24430330 PositiveStrandReadsAssigned:756773 NegativeStrandReadsAssigned:24824401 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958250 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958250-trimmed-pair1.fastq SRR6958250-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,667,769 reads, 24,781,689 reads pseudoaligned [quant] estimated average fragment length: 276.548 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52973 SRR6958250.ke.tsv 35125 SRR6958250.se.tsv 88098 total ==> SRR6958250.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.003 0 0 PNS24247 1044 768.452 77.8891 6.06035 PNS24249 1928 1652.45 56.571 2.04693 PNS24246 1044 768.452 77.8891 6.06035 PNS24248 1044 768.452 77.8891 6.06035 PNS24244 1471 1195.45 19.7617 0.988396 PNS24243 293 75.8771 1 0.788002 KQK14069 1603 1327.45 6156.62 277.307 KQK14071 474 213.781 81.8478 22.8916 ==> SRR6958250.se.tsv <== BRADI_1g14170v3 6991 BRADI_1g53295v3 1716 BRADI_1g59795v3 160 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 470 BRADI_1g74790v3 130 BRADI_1g09890v3 1 BRADI_1g77505v3 393 BRADI_1g48960v3 0 SRR6958250 completed mapping pipeline successfully