Starting /dee2/code/volunteer_pipeline.sh SRR6958251 current disk space = 1550667190272 free memory = 1599934960 SRR6958251 SRAfilesize 9adc48c788d54634828c9fea3ccdaf32 SRR6958251.sra SRR6958251.sra file validated SRR6958251 is paired end SRR6958251 is conventional basespace SRR6958251 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958251_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.4235 18.0 18.0 18.0 18.0 32.0 2 21.194 18.0 18.0 25.0 18.0 30.0 3 27.085 27.0 27.0 29.0 25.0 31.0 4 29.97875 31.0 29.0 31.0 27.0 33.0 5 31.11575 33.0 31.0 33.0 29.0 33.0 6 35.7615 37.0 35.0 38.0 32.0 38.0 7 37.146 38.0 38.0 38.0 36.0 38.0 8 37.287 38.0 38.0 38.0 36.0 38.0 9 37.42475 38.0 38.0 38.0 37.0 38.0 10-14 37.402100000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.466950000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.536500000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.3168 38.0 38.0 38.0 37.0 38.0 30-34 37.395649999999996 38.0 38.0 38.0 37.2 38.0 35-39 37.14095 38.0 38.0 38.0 36.2 38.0 40-44 37.547200000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.405449999999995 38.0 38.0 38.0 37.2 38.0 50-54 37.30485 38.0 38.0 38.0 36.8 38.0 55-59 37.22815000000001 38.0 38.0 38.0 36.6 38.0 60-64 37.32435 38.0 38.0 38.0 36.8 38.0 65-69 37.35965 38.0 38.0 38.0 37.0 38.0 70-74 37.231399999999994 38.0 38.0 38.0 36.6 38.0 75-79 37.19584999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.13625 38.0 38.0 38.0 36.0 38.0 85-89 36.73205 38.0 38.0 38.0 34.8 38.0 90-94 36.15645 38.0 37.6 38.0 32.2 38.0 95-99 34.774350000000005 38.0 35.2 38.0 25.6 38.0 100-104 35.9369 38.0 37.0 38.0 32.0 38.0 105-109 35.8418 38.0 37.0 38.0 31.6 38.0 110-114 35.47789999999999 38.0 36.2 38.0 30.2 38.0 115-119 35.5255 38.0 36.0 38.0 31.0 38.0 120-124 35.382400000000004 38.0 36.0 38.0 29.6 38.0 125-129 35.2381 38.0 36.0 38.0 29.2 38.0 130-134 34.8552 38.0 35.4 38.0 27.6 38.0 135-139 34.13885 38.0 33.6 38.0 25.2 38.0 140-144 32.42535 37.4 31.4 38.0 17.2 38.0 145-149 31.857400000000002 37.8 31.8 38.0 10.6 38.0 150-151 25.694000000000003 32.0 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 0.0 19 6.0 20 1.0 21 4.0 22 5.0 23 5.0 24 14.0 25 12.0 26 21.0 27 23.0 28 33.0 29 46.0 30 58.0 31 79.0 32 95.0 33 173.0 34 261.0 35 468.0 36 1155.0 37 1536.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.058139534883722 22.832980972515855 8.060253699788584 49.04862579281184 2 18.475 22.0 23.3 36.225 3 21.325 18.75 24.099999999999998 35.825 4 25.75 24.349999999999998 23.025000000000002 26.875 5 26.025 29.525000000000002 22.3 22.15 6 23.65 32.375 22.8 21.175 7 17.45 22.325 41.425 18.8 8 20.5 23.925 28.849999999999998 26.724999999999998 9 19.425 22.325 31.95 26.3 10-14 22.615 25.855 26.185000000000002 25.345000000000002 15-19 22.305 25.095 26.55 26.05 20-24 23.135 25.490000000000002 26.035000000000004 25.34 25-29 22.515 25.05 26.590000000000003 25.845000000000002 30-34 22.805 25.035 26.479999999999997 25.679999999999996 35-39 23.055 24.93 25.974999999999998 26.040000000000003 40-44 22.905 25.259999999999998 26.06 25.775 45-49 22.259999999999998 25.095 26.590000000000003 26.055 50-54 23.549999999999997 24.89 25.435000000000002 26.125 55-59 22.7 24.884999999999998 26.665 25.75 60-64 22.585 25.83 25.7 25.885 65-69 23.135 25.180000000000003 26.61 25.074999999999996 70-74 23.16 25.64 25.669999999999998 25.53 75-79 23.07 25.285000000000004 26.21 25.435000000000002 80-84 23.21 24.8 26.105 25.885 85-89 23.01 24.79 26.314999999999998 25.885 90-94 23.580000000000002 24.89 25.525 26.005 95-99 23.105 25.0 25.885 26.009999999999998 100-104 23.52 25.064999999999998 26.085 25.330000000000002 105-109 23.555 24.86 25.995 25.590000000000003 110-114 24.16 25.009999999999998 25.465 25.365 115-119 23.585 25.575 24.925 25.915 120-124 23.605 25.040000000000003 25.490000000000002 25.865 125-129 23.575 25.11 25.509999999999998 25.805 130-134 23.995 24.845 25.47 25.69 135-139 23.65 25.619999999999997 25.61 25.119999999999997 140-144 23.48 25.074999999999996 25.46 25.985000000000003 145-149 23.82 24.94 25.724999999999998 25.515 150-151 24.325 24.05 25.85 25.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 2.5 29 3.5 30 7.0 31 11.5 32 18.0 33 24.0 34 26.0 35 35.0 36 50.5 37 69.0 38 86.0 39 100.0 40 113.0 41 160.0 42 191.5 43 194.5 44 195.0 45 211.0 46 232.5 47 210.0 48 180.0 49 172.0 50 166.5 51 143.5 52 140.0 53 131.0 54 98.0 55 87.5 56 94.5 57 86.0 58 80.0 59 83.0 60 76.5 61 70.5 62 65.5 63 52.0 64 52.0 65 52.5 66 40.0 67 37.5 68 30.5 69 23.0 70 25.0 71 19.0 72 15.5 73 12.0 74 7.0 75 6.0 76 3.0 77 1.5 78 1.0 79 1.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.6749999999999998 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 2.125 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.1500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATAGC 10 0.006836113 144.9625 6 >>END_MODULE SRR6958251 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958251_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01075 33.0 33.0 34.0 32.0 34.0 2 33.18525 34.0 33.0 34.0 33.0 34.0 3 33.137 34.0 33.0 34.0 33.0 34.0 4 33.11675 34.0 33.0 34.0 33.0 34.0 5 32.999 34.0 33.0 34.0 32.0 34.0 6 37.31875 38.0 38.0 38.0 37.0 38.0 7 37.2435 38.0 38.0 38.0 37.0 38.0 8 37.05075 38.0 38.0 38.0 37.0 38.0 9 37.0735 38.0 38.0 38.0 36.0 38.0 10-14 36.96155 38.0 38.0 38.0 36.0 38.0 15-19 37.02025 38.0 38.0 38.0 36.4 38.0 20-24 37.07025 38.0 38.0 38.0 36.8 38.0 25-29 37.1409 38.0 38.0 38.0 37.0 38.0 30-34 37.22345 38.0 38.0 38.0 37.0 38.0 35-39 37.2983 38.0 38.0 38.0 37.0 38.0 40-44 35.3989 38.0 36.0 38.0 27.4 38.0 45-49 35.407900000000005 38.0 36.0 38.0 26.2 38.0 50-54 35.64565 38.0 36.2 38.0 28.4 38.0 55-59 35.8334 38.0 36.8 38.0 29.6 38.0 60-64 36.5678 38.0 37.8 38.0 34.6 38.0 65-69 35.97355 38.0 37.2 38.0 29.6 38.0 70-74 35.99175 38.0 37.2 38.0 31.8 38.0 75-79 36.28815 38.0 38.0 38.0 33.6 38.0 80-84 36.237700000000004 38.0 38.0 38.0 33.8 38.0 85-89 36.03735 38.0 38.0 38.0 33.0 38.0 90-94 35.81995 38.0 37.2 38.0 32.2 38.0 95-99 35.9593 38.0 37.8 38.0 32.8 38.0 100-104 33.69185 37.2 30.8 38.0 24.8 38.0 105-109 35.8156 38.0 37.2 38.0 32.0 38.0 110-114 35.5231 38.0 37.0 38.0 31.0 38.0 115-119 34.7864 38.0 36.0 38.0 27.6 38.0 120-124 31.580899999999996 36.2 27.4 38.0 16.6 38.0 125-129 30.3679 36.0 24.6 38.0 13.8 38.0 130-134 29.583350000000003 34.8 23.4 38.0 12.4 38.0 135-139 32.48115 37.8 32.2 38.0 15.4 38.0 140-144 30.787600000000005 36.8 28.0 38.0 12.4 38.0 145-149 30.30215 36.8 29.2 38.0 3.8 38.0 150-151 23.894125 29.5 16.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 0.0 5 2.0 6 0.0 7 1.0 8 1.0 9 2.0 10 0.0 11 1.0 12 3.0 13 5.0 14 5.0 15 3.0 16 9.0 17 5.0 18 3.0 19 12.0 20 13.0 21 15.0 22 18.0 23 22.0 24 22.0 25 28.0 26 28.0 27 37.0 28 46.0 29 62.0 30 83.0 31 95.0 32 168.0 33 198.0 34 325.0 35 572.0 36 1176.0 37 1033.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.55 17.849999999999998 12.75 32.85 2 28.749999999999996 23.05 27.575 20.625 3 21.6 26.375 27.500000000000004 24.525 4 26.474999999999998 31.1 20.05 22.375 5 28.275 32.65 18.5 20.575 6 23.225 36.275 20.25 20.25 7 22.725 19.7 34.35 23.225 8 23.45 22.8 24.4 29.349999999999998 9 23.849999999999998 22.325 27.175 26.650000000000002 10-14 25.650000000000002 25.825 23.575 24.95 15-19 25.245 25.11 24.845 24.8 20-24 26.284999999999997 26.119999999999997 24.0 23.595 25-29 25.735000000000003 25.900000000000002 24.2 24.165 30-34 25.4 25.485000000000003 24.72 24.395 35-39 25.66 25.895000000000003 24.48 23.965 40-44 25.94 25.11 24.8 24.15 45-49 25.319999999999997 25.615 24.8 24.265 50-54 26.405 25.655 24.375 23.565 55-59 25.81 26.005 24.235 23.95 60-64 26.174999999999997 25.615 24.535 23.674999999999997 65-69 25.72 25.81 24.97 23.5 70-74 26.085 25.540000000000003 24.58 23.794999999999998 75-79 25.295 25.955000000000002 24.38 24.37 80-84 26.095000000000002 24.975 24.77 24.16 85-89 26.534999999999997 25.495 24.099999999999998 23.87 90-94 25.485000000000003 25.765 24.575 24.175 95-99 25.7 25.805 24.64 23.855 100-104 25.95 26.06 24.47 23.52 105-109 26.174999999999997 25.72 25.045 23.06 110-114 25.650000000000002 25.835 25.06 23.455000000000002 115-119 26.025 25.685000000000002 24.38 23.91 120-124 26.25 25.61 24.59 23.549999999999997 125-129 26.242624262426244 26.122612261226124 24.52245224522452 23.112311231123112 130-134 26.02 26.21 24.735 23.035 135-139 25.88 26.52 24.695 22.905 140-144 26.405 26.55 24.34 22.705000000000002 145-149 26.950000000000003 26.3 24.349999999999998 22.400000000000002 150-151 27.3 25.05 25.25 22.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 2.0 27 2.5 28 4.0 29 6.0 30 7.0 31 6.0 32 11.0 33 18.0 34 21.0 35 28.0 36 40.0 37 54.0 38 71.0 39 96.5 40 115.5 41 141.5 42 165.5 43 184.0 44 202.5 45 191.0 46 184.5 47 184.5 48 177.5 49 186.0 50 181.5 51 147.0 52 129.5 53 117.0 54 101.5 55 104.0 56 99.5 57 95.0 58 89.0 59 80.0 60 78.5 61 72.0 62 71.0 63 67.0 64 65.5 65 71.0 66 59.0 67 50.0 68 47.0 69 37.0 70 32.5 71 29.0 72 23.5 73 17.0 74 11.0 75 7.0 76 5.5 77 4.5 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.95 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.3375 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGGC 10 0.006830828 145.0 8 >>END_MODULE Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864078 spots for SRR6958251.sra Written 864078 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra Read 864070 spots for SRR6958251.sra Written 864070 spots for SRR6958251.sra SRR ids: ['SRR6958251.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l4l8h2nx SRR6958251.sra spots: 17281408 blocks: [[1, 864070], [864071, 1728140], [1728141, 2592210], [2592211, 3456280], [3456281, 4320350], [4320351, 5184420], [5184421, 6048490], [6048491, 6912560], [6912561, 7776630], [7776631, 8640700], [8640701, 9504770], [9504771, 10368840], [10368841, 11232910], [11232911, 12096980], [12096981, 12961050], [12961051, 13825120], [13825121, 14689190], [14689191, 15553260], [15553261, 16417330], [16417331, 17281408]] SRR6958251 file size 5834401 SRR6958251 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958251 SRR6958251_1.fastq SRR6958251_2.fastq Input file: SRR6958251_1.fastq Paired file: SRR6958251_2.fastq trimmed: SRR6958251-trimmed-pair1.fastq, SRR6958251-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:43:24 2024 >> started Fri Dec 6 17:43:48 2024 >> done (24.516s) 17281408 read pairs processed; of these: 10676 ( 0.06%) short read pairs filtered out after trimming by size control 13116 ( 0.08%) empty read pairs filtered out after trimming by size control 17257616 (99.86%) read pairs available; of these: 7537292 (43.68%) trimmed read pairs available after processing 9720324 (56.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 4 0.00% 26 3 0.00% 27 0 0.00% 28 2 0.00% 29 2 0.00% 30 7 0.00% 31 0 0.00% 32 6 0.00% 33 4 0.00% 34 1 0.00% 35 9 0.00% 36 3 0.00% 37 8 0.00% 38 6 0.00% 39 14 0.00% 40 4 0.00% 41 8 0.00% 42 10 0.00% 43 7 0.00% 44 18 0.00% 45 12 0.00% 46 8 0.00% 47 19 0.00% 48 17 0.00% 49 12 0.00% 50 21 0.00% 51 21 0.00% 52 37 0.00% 53 32 0.00% 54 35 0.00% 55 42 0.00% 56 45 0.00% 57 65 0.00% 58 51 0.00% 59 63 0.00% 60 67 0.00% 61 78 0.00% 62 85 0.00% 63 94 0.00% 64 119 0.00% 65 128 0.00% 66 152 0.00% 67 171 0.00% 68 182 0.00% 69 209 0.00% 70 247 0.00% 71 258 0.00% 72 345 0.00% 73 386 0.00% 74 405 0.00% 75 508 0.00% 76 509 0.00% 77 629 0.00% 78 632 0.00% 79 761 0.00% 80 907 0.01% 81 1018 0.01% 82 1055 0.01% 83 1310 0.01% 84 1843 0.01% 85 2213 0.01% 86 2355 0.01% 87 2498 0.01% 88 2622 0.02% 89 2874 0.02% 90 3135 0.02% 91 3302 0.02% 92 3535 0.02% 93 3821 0.02% 94 4105 0.02% 95 4452 0.03% 96 4712 0.03% 97 4986 0.03% 98 5432 0.03% 99 5748 0.03% 100 6150 0.04% 101 6588 0.04% 102 7383 0.04% 103 7611 0.04% 104 8412 0.05% 105 9014 0.05% 106 9360 0.05% 107 9937 0.06% 108 10409 0.06% 109 10880 0.06% 110 11453 0.07% 111 12016 0.07% 112 13101 0.08% 113 13703 0.08% 114 14752 0.09% 115 15435 0.09% 116 16383 0.09% 117 16993 0.10% 118 17745 0.10% 119 18265 0.11% 120 19655 0.11% 121 20301 0.12% 122 21427 0.12% 123 23029 0.13% 124 24217 0.14% 125 25299 0.15% 126 26853 0.16% 127 28163 0.16% 128 29444 0.17% 129 31391 0.18% 130 32993 0.19% 131 34551 0.20% 132 37231 0.22% 133 39482 0.23% 134 42121 0.24% 135 44774 0.26% 136 47531 0.28% 137 51004 0.30% 138 53990 0.31% 139 58371 0.34% 140 63358 0.37% 141 69535 0.40% 142 77989 0.45% 143 88369 0.51% 144 103615 0.60% 145 124226 0.72% 146 157068 0.91% 147 218824 1.27% 148 341869 1.98% 149 713979 4.14% 150 4582544 26.55% 151 9720324 56.32% 17257616 reads passed initial QC criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=15 prefix-density=1.05 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=142.40 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.8 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=14 prefix-density=0.72 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=22.12 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958251 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:44:28 Started mapping on | Dec 06 17:44:28 Finished on | Dec 06 17:45:56 Mapping speed, Million of reads per hour | 705.99 Number of input reads | 17257616 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16841634 Uniquely mapped reads % | 97.59% Average mapped length | 296.98 Number of splices: Total | 19898446 Number of splices: Annotated (sjdb) | 18772650 Number of splices: GT/AG | 19634448 Number of splices: GC/AG | 232768 Number of splices: AT/AC | 7091 Number of splices: Non-canonical | 24139 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 134376 % of reads mapped to multiple loci | 0.78% Number of reads mapped to too many loci | 11308 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 288841 288841 288841 N_multimapping 134376 134376 134376 N_noFeature 535865 16363888 665460 N_ambiguous 415397 2384 68393 UnstrandedReadsAssigned:15890372 PositiveStrandReadsAssigned:475362 NegativeStrandReadsAssigned:16107781 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958251 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958251-trimmed-pair1.fastq SRR6958251-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,257,616 reads, 16,100,072 reads pseudoaligned [quant] estimated average fragment length: 267.757 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR6958251.ke.tsv 35125 SRR6958251.se.tsv 88098 total ==> SRR6958251.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.711 0 0 PNS24247 1044 777.243 52.7019 6.34085 PNS24249 1928 1661.24 33.3269 1.87603 PNS24246 1044 777.243 52.7019 6.34085 PNS24248 1044 777.243 52.7019 6.34085 PNS24244 1471 1204.24 45.5675 3.5385 PNS24243 293 82.6058 0 0 KQK14069 1603 1336.24 3605.69 252.337 KQK14071 474 222.833 44.1264 18.5181 ==> SRR6958251.se.tsv <== BRADI_1g14170v3 3970 BRADI_1g53295v3 236 BRADI_1g59795v3 169 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 336 BRADI_1g74790v3 92 BRADI_1g09890v3 0 BRADI_1g77505v3 209 BRADI_1g48960v3 0 SRR6958251 completed mapping pipeline successfully