Starting /dee2/code/volunteer_pipeline.sh SRR6958252 current disk space = 1550660833280 free memory = 1600419464 SRR6958252 SRAfilesize 0e8d1c966451121ccd5ba134bea8e2bd SRR6958252.sra SRR6958252.sra file validated SRR6958252 is paired end SRR6958252 is conventional basespace SRR6958252 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958252_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.99375 32.0 25.0 33.0 2.0 33.0 2 28.67075 29.0 27.0 33.0 18.0 33.0 3 30.6655 31.0 29.0 33.0 27.0 33.0 4 32.47475 33.0 32.0 33.0 32.0 34.0 5 32.251 33.0 33.0 33.0 32.0 34.0 6 36.45575 38.0 36.0 38.0 34.0 38.0 7 37.2775 38.0 38.0 38.0 36.0 38.0 8 37.31 38.0 38.0 38.0 36.0 38.0 9 37.59425 38.0 38.0 38.0 38.0 38.0 10-14 37.57299999999999 38.0 38.0 38.0 37.8 38.0 15-19 37.571999999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.501599999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.28065 38.0 38.0 38.0 37.0 38.0 30-34 37.3118 38.0 38.0 38.0 37.2 38.0 35-39 37.629200000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.609300000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.505849999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.4582 38.0 38.0 38.0 37.4 38.0 55-59 37.40845 38.0 38.0 38.0 37.0 38.0 60-64 37.525349999999996 38.0 38.0 38.0 37.4 38.0 65-69 37.4674 38.0 38.0 38.0 37.0 38.0 70-74 37.41439999999999 38.0 38.0 38.0 37.0 38.0 75-79 36.3393 38.0 37.0 38.0 31.4 38.0 80-84 37.158500000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.946600000000004 38.0 38.0 38.0 35.6 38.0 90-94 36.729 38.0 38.0 38.0 35.2 38.0 95-99 36.378750000000004 38.0 38.0 38.0 33.8 38.0 100-104 36.1793 38.0 38.0 38.0 33.0 38.0 105-109 36.1246 38.0 37.8 38.0 33.0 38.0 110-114 36.09060000000001 38.0 37.8 38.0 33.0 38.0 115-119 36.55595 38.0 38.0 38.0 34.0 38.0 120-124 36.75785 38.0 38.0 38.0 34.8 38.0 125-129 36.6982 38.0 38.0 38.0 34.2 38.0 130-134 36.4688 38.0 38.0 38.0 34.2 38.0 135-139 35.7548 38.0 36.6 38.0 30.8 38.0 140-144 35.6393 38.0 36.4 38.0 31.2 38.0 145-149 33.54885 38.0 33.0 38.0 21.8 38.0 150-151 29.8125 35.5 27.0 38.0 10.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 3.0 24 6.0 25 7.0 26 7.0 27 15.0 28 15.0 29 28.0 30 43.0 31 49.0 32 75.0 33 107.0 34 144.0 35 294.0 36 754.0 37 2447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.020920502092046 9.456066945606695 7.615062761506277 37.90794979079498 2 26.025 12.425 32.725 28.825 3 22.525000000000002 16.3 24.075 37.1 4 26.150000000000002 24.349999999999998 21.275 28.225 5 25.724999999999998 28.4 23.925 21.95 6 22.775000000000002 31.025000000000002 24.575 21.625 7 18.3 22.650000000000002 39.95 19.1 8 20.825 22.6 30.075000000000003 26.5 9 18.375 21.85 35.25 24.525 10-14 21.965 27.245 26.245 24.545 15-19 22.555 25.22 26.784999999999997 25.44 20-24 22.745 25.56 26.41 25.285000000000004 25-29 22.86 25.900000000000002 26.145000000000003 25.095 30-34 22.79 25.650000000000002 26.419999999999998 25.14 35-39 22.84 25.465 26.255 25.44 40-44 23.35 25.35 26.41 24.89 45-49 22.770000000000003 25.174999999999997 26.41 25.645 50-54 23.150000000000002 25.71 25.974999999999998 25.165 55-59 22.919999999999998 25.629999999999995 25.919999999999998 25.53 60-64 23.200000000000003 25.645 25.855 25.3 65-69 23.06 25.455 26.035000000000004 25.45 70-74 23.400000000000002 24.555 25.85 26.195 75-79 22.575 25.195 26.11 26.119999999999997 80-84 23.395 25.28 25.835 25.490000000000002 85-89 23.165 25.15 26.075 25.61 90-94 23.075000000000003 25.2 26.33 25.395 95-99 23.455000000000002 24.575 26.195 25.775 100-104 23.44 25.495 25.825 25.240000000000002 105-109 23.98 24.884999999999998 26.085 25.05 110-114 23.665 25.195 26.085 25.055 115-119 23.65 24.67 26.345000000000002 25.335 120-124 23.65 24.855 26.064999999999998 25.430000000000003 125-129 23.84 24.9 25.929999999999996 25.330000000000002 130-134 23.755000000000003 25.52 25.805 24.92 135-139 23.52 25.424999999999997 25.7 25.355 140-144 23.31 25.295 25.645 25.75 145-149 23.71 25.009999999999998 25.635 25.645 150-151 23.400000000000002 25.424999999999997 25.9625 25.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 1.0 27 2.0 28 2.0 29 4.0 30 7.0 31 12.0 32 17.0 33 20.0 34 26.0 35 36.5 36 49.0 37 65.0 38 78.5 39 95.5 40 134.0 41 164.0 42 173.5 43 185.5 44 204.5 45 233.5 46 238.0 47 220.0 48 203.0 49 190.5 50 182.0 51 155.5 52 121.5 53 102.5 54 96.5 55 92.0 56 83.5 57 77.0 58 77.0 59 77.5 60 71.0 61 61.5 62 55.0 63 56.0 64 50.0 65 47.5 66 46.5 67 39.5 68 32.5 69 24.5 70 24.0 71 19.5 72 15.5 73 9.0 74 6.5 75 6.0 76 2.5 77 1.5 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09159727479182 98.175 2 0.8831693161746152 1.7500000000000002 3 0.025233409033560434 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.9624999999999999 0.0 0.0 0.0 0.0 120-121 1.1125 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.425 0.0 0.0 0.0 0.0 126-127 1.5750000000000002 0.0 0.0 0.0 0.0 128-129 1.8250000000000002 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.55 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958252 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958252_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04275 33.0 33.0 34.0 32.0 34.0 2 33.152 34.0 33.0 34.0 33.0 34.0 3 33.28025 34.0 33.0 34.0 33.0 34.0 4 33.2545 34.0 33.0 34.0 33.0 34.0 5 33.21125 34.0 33.0 34.0 33.0 34.0 6 37.3755 38.0 38.0 38.0 37.0 38.0 7 37.2355 38.0 38.0 38.0 37.0 38.0 8 37.3105 38.0 38.0 38.0 37.0 38.0 9 37.39975 38.0 38.0 38.0 37.0 38.0 10-14 37.2034 38.0 38.0 38.0 36.8 38.0 15-19 37.116699999999994 38.0 38.0 38.0 36.8 38.0 20-24 37.07965 38.0 38.0 38.0 36.6 38.0 25-29 37.192949999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.40045 38.0 38.0 38.0 37.4 38.0 35-39 37.422549999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.437799999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.333299999999994 38.0 38.0 38.0 37.4 38.0 50-54 37.0319 38.0 38.0 38.0 36.2 38.0 55-59 37.0938 38.0 38.0 38.0 36.4 38.0 60-64 37.05245 38.0 38.0 38.0 36.4 38.0 65-69 37.039550000000006 38.0 38.0 38.0 36.4 38.0 70-74 36.93825 38.0 38.0 38.0 36.0 38.0 75-79 36.7173 38.0 38.0 38.0 35.2 38.0 80-84 36.488350000000004 38.0 38.0 38.0 34.2 38.0 85-89 36.2183 38.0 38.0 38.0 33.4 38.0 90-94 36.69675 38.0 38.0 38.0 34.6 38.0 95-99 36.87375 38.0 38.0 38.0 35.4 38.0 100-104 36.88255 38.0 38.0 38.0 35.4 38.0 105-109 36.761900000000004 38.0 38.0 38.0 34.8 38.0 110-114 36.59845 38.0 38.0 38.0 34.6 38.0 115-119 34.187250000000006 37.4 33.0 38.0 26.2 38.0 120-124 32.49805 36.2 28.4 38.0 20.4 38.0 125-129 34.93785 38.0 35.2 38.0 27.8 38.0 130-134 33.926500000000004 37.8 33.2 38.0 22.8 38.0 135-139 30.291499999999996 34.0 24.6 38.0 16.6 38.0 140-144 34.78995 38.0 35.2 38.0 28.6 38.0 145-149 34.065099999999994 38.0 35.2 38.0 24.6 38.0 150-151 28.258375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 5.0 4 0.0 5 2.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 0.0 18 2.0 19 1.0 20 3.0 21 8.0 22 9.0 23 10.0 24 11.0 25 14.0 26 15.0 27 22.0 28 24.0 29 47.0 30 41.0 31 70.0 32 84.0 33 131.0 34 195.0 35 356.0 36 979.0 37 1963.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.625 18.2 12.775 33.4 2 30.175 23.200000000000003 27.55 19.075 3 23.025000000000002 25.85 27.85 23.275000000000002 4 24.75 31.95 20.925 22.375 5 27.425 32.125 20.724999999999998 19.725 6 22.35 36.975 19.975 20.7 7 23.599999999999998 18.975 34.925 22.5 8 23.925 23.0 24.375 28.7 9 22.725 22.775000000000002 28.1 26.400000000000002 10-14 25.295 26.529999999999998 23.53 24.645 15-19 25.64 25.740000000000002 24.435000000000002 24.185000000000002 20-24 25.424999999999997 25.97 24.805 23.799999999999997 25-29 25.669999999999998 25.674999999999997 24.654999999999998 24.0 30-34 25.705 25.46 24.825 24.01 35-39 25.82 25.935000000000002 24.37 23.875 40-44 26.174999999999997 25.419999999999998 24.67 23.735 45-49 25.46 25.545 24.86 24.135 50-54 25.990000000000002 26.095000000000002 24.145 23.77 55-59 25.34 25.705 25.095 23.86 60-64 25.074999999999996 26.279999999999998 24.9 23.745 65-69 25.465 25.695 25.259999999999998 23.580000000000002 70-74 25.430000000000003 25.405 25.064999999999998 24.099999999999998 75-79 25.495 25.915 24.72 23.87 80-84 25.69 26.075 24.709999999999997 23.525 85-89 25.3 25.929999999999996 24.98 23.79 90-94 25.55 25.46 24.759999999999998 24.23 95-99 25.22 26.06 25.264999999999997 23.455000000000002 100-104 25.505 25.814999999999998 24.735 23.945 105-109 25.335 26.400000000000002 24.66 23.605 110-114 25.585 26.640000000000004 24.505 23.27 115-119 25.545 26.245 24.82 23.39 120-124 25.929999999999996 25.765 24.595 23.71 125-129 25.919999999999998 26.27 24.55 23.26 130-134 26.240000000000002 25.88 24.91 22.97 135-139 26.334999999999997 25.735000000000003 24.765 23.165 140-144 26.06 26.87 24.060000000000002 23.01 145-149 26.369999999999997 26.295 24.435000000000002 22.900000000000002 150-151 25.575 26.1625 25.2875 22.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 2.5 27 2.5 28 5.0 29 7.5 30 7.5 31 11.0 32 13.5 33 20.0 34 31.0 35 39.5 36 41.5 37 48.0 38 80.0 39 118.5 40 138.0 41 136.0 42 163.0 43 186.5 44 187.0 45 203.0 46 209.0 47 205.5 48 193.5 49 175.0 50 158.0 51 141.0 52 116.5 53 98.5 54 97.5 55 92.0 56 83.0 57 83.5 58 82.0 59 88.5 60 89.5 61 72.0 62 69.0 63 75.5 64 62.0 65 50.0 66 52.0 67 52.0 68 44.5 69 36.0 70 33.0 71 27.5 72 19.0 73 14.0 74 12.5 75 10.0 76 6.5 77 2.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.55072463768117 96.89999999999999 2 1.245868293923214 2.45 3 0.15255530129672007 0.44999999999999996 4 0.05085176709890668 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.2375 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.5125000000000002 0.0 0.0 0.0 0.0 132-133 1.6375000000000002 0.0 0.0 0.0 0.0 134-135 1.8875000000000002 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215264 spots for SRR6958252.sra Written 1215264 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra Read 1215250 spots for SRR6958252.sra Written 1215250 spots for SRR6958252.sra SRR ids: ['SRR6958252.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bhgbv_v6 SRR6958252.sra spots: 24305014 blocks: [[1, 1215250], [1215251, 2430500], [2430501, 3645750], [3645751, 4861000], [4861001, 6076250], [6076251, 7291500], [7291501, 8506750], [8506751, 9722000], [9722001, 10937250], [10937251, 12152500], [12152501, 13367750], [13367751, 14583000], [14583001, 15798250], [15798251, 17013500], [17013501, 18228750], [18228751, 19444000], [19444001, 20659250], [20659251, 21874500], [21874501, 23089750], [23089751, 24305014]] SRR6958252 file size 8214471 SRR6958252 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958252 SRR6958252_1.fastq SRR6958252_2.fastq Input file: SRR6958252_1.fastq Paired file: SRR6958252_2.fastq trimmed: SRR6958252-trimmed-pair1.fastq, SRR6958252-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:44:17 2024 >> started Fri Dec 6 17:44:42 2024 >> done (24.756s) 24305014 read pairs processed; of these: 12668 ( 0.05%) short read pairs filtered out after trimming by size control 10527 ( 0.04%) empty read pairs filtered out after trimming by size control 24281819 (99.90%) read pairs available; of these: 7501572 (30.89%) trimmed read pairs available after processing 16780247 (69.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 4 0.00% 23 6 0.00% 24 2 0.00% 25 4 0.00% 26 9 0.00% 27 5 0.00% 28 8 0.00% 29 5 0.00% 30 9 0.00% 31 5 0.00% 32 6 0.00% 33 2 0.00% 34 9 0.00% 35 8 0.00% 36 7 0.00% 37 7 0.00% 38 11 0.00% 39 15 0.00% 40 7 0.00% 41 10 0.00% 42 7 0.00% 43 9 0.00% 44 10 0.00% 45 18 0.00% 46 8 0.00% 47 15 0.00% 48 23 0.00% 49 25 0.00% 50 28 0.00% 51 35 0.00% 52 20 0.00% 53 37 0.00% 54 43 0.00% 55 45 0.00% 56 31 0.00% 57 51 0.00% 58 59 0.00% 59 60 0.00% 60 79 0.00% 61 100 0.00% 62 84 0.00% 63 102 0.00% 64 113 0.00% 65 124 0.00% 66 158 0.00% 67 188 0.00% 68 215 0.00% 69 198 0.00% 70 258 0.00% 71 265 0.00% 72 320 0.00% 73 404 0.00% 74 395 0.00% 75 506 0.00% 76 556 0.00% 77 603 0.00% 78 695 0.00% 79 759 0.00% 80 893 0.00% 81 1032 0.00% 82 1209 0.00% 83 1338 0.01% 84 2023 0.01% 85 2557 0.01% 86 2784 0.01% 87 2882 0.01% 88 3075 0.01% 89 3305 0.01% 90 3437 0.01% 91 3681 0.02% 92 3981 0.02% 93 4313 0.02% 94 4848 0.02% 95 5132 0.02% 96 5423 0.02% 97 6018 0.02% 98 6246 0.03% 99 6833 0.03% 100 7414 0.03% 101 7806 0.03% 102 8167 0.03% 103 8822 0.04% 104 9619 0.04% 105 10098 0.04% 106 10750 0.04% 107 11341 0.05% 108 11994 0.05% 109 12742 0.05% 110 13431 0.06% 111 14378 0.06% 112 15537 0.06% 113 16033 0.07% 114 16905 0.07% 115 18291 0.08% 116 19056 0.08% 117 20116 0.08% 118 20599 0.08% 119 21612 0.09% 120 22715 0.09% 121 23959 0.10% 122 24872 0.10% 123 26230 0.11% 124 27447 0.11% 125 29052 0.12% 126 30268 0.12% 127 31697 0.13% 128 32569 0.13% 129 34369 0.14% 130 36195 0.15% 131 37787 0.16% 132 40009 0.16% 133 42066 0.17% 134 44086 0.18% 135 46187 0.19% 136 48868 0.20% 137 51885 0.21% 138 54768 0.23% 139 58860 0.24% 140 62798 0.26% 141 68270 0.28% 142 75784 0.31% 143 84561 0.35% 144 96127 0.40% 145 112000 0.46% 146 136539 0.56% 147 181311 0.75% 148 274642 1.13% 149 568882 2.34% 150 4744248 19.54% 151 16780247 69.11% 24281819 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=18 prefix-density=0.89 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=39.60 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=17 prefix-density=0.59 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=21.81 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958252 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:45:34 Started mapping on | Dec 06 17:45:34 Finished on | Dec 06 17:47:55 Mapping speed, Million of reads per hour | 619.96 Number of input reads | 24281819 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23648861 Uniquely mapped reads % | 97.39% Average mapped length | 298.07 Number of splices: Total | 27461958 Number of splices: Annotated (sjdb) | 25827567 Number of splices: GT/AG | 27090394 Number of splices: GC/AG | 326346 Number of splices: AT/AC | 10072 Number of splices: Non-canonical | 35146 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.01% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190330 % of reads mapped to multiple loci | 0.78% Number of reads mapped to too many loci | 11826 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451345 451345 451345 N_multimapping 190330 190330 190330 N_noFeature 918580 22949296 1141073 N_ambiguous 581964 3717 106415 UnstrandedReadsAssigned:22148317 PositiveStrandReadsAssigned:695848 NegativeStrandReadsAssigned:22401373 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958252 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958252-trimmed-pair1.fastq SRR6958252-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,281,819 reads, 22,401,047 reads pseudoaligned [quant] estimated average fragment length: 275.731 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR6958252.ke.tsv 35125 SRR6958252.se.tsv 88098 total ==> SRR6958252.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.796 0 0 PNS24247 1044 769.269 86.2625 7.65105 PNS24249 1928 1653.27 47.0824 1.94309 PNS24246 1044 769.269 86.2625 7.65105 PNS24248 1044 769.269 86.2625 7.65105 PNS24244 1471 1196.27 34.1301 1.94664 PNS24243 293 80.6399 0 0 KQK14069 1603 1328.27 5918.32 304.011 KQK14071 474 217.487 63.6609 19.9718 ==> SRR6958252.se.tsv <== BRADI_1g14170v3 6497 BRADI_1g53295v3 295 BRADI_1g59795v3 356 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 248 BRADI_1g74790v3 96 BRADI_1g09890v3 0 BRADI_1g77505v3 263 BRADI_1g48960v3 0 SRR6958252 completed mapping pipeline successfully