Starting /dee2/code/volunteer_pipeline.sh SRR6958253 current disk space = 1550705623040 free memory = 1485595056 SRR6958253 SRAfilesize 52b6f689fa973afa6b041fadaf59064a SRR6958253.sra SRR6958253.sra file validated SRR6958253 is paired end SRR6958253 is conventional basespace SRR6958253 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958253_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.40525 18.0 18.0 30.0 18.0 32.0 2 22.97475 18.0 18.0 27.0 18.0 31.0 3 28.23575 29.0 27.0 31.0 25.0 33.0 4 31.80475 32.0 32.0 33.0 30.0 33.0 5 32.635 33.0 33.0 33.0 32.0 33.0 6 36.60275 38.0 37.0 38.0 34.0 38.0 7 37.324 38.0 38.0 38.0 36.0 38.0 8 37.41925 38.0 38.0 38.0 37.0 38.0 9 37.57925 38.0 38.0 38.0 37.0 38.0 10-14 37.5111 38.0 38.0 38.0 37.6 38.0 15-19 37.4517 38.0 38.0 38.0 37.4 38.0 20-24 37.4464 38.0 38.0 38.0 37.4 38.0 25-29 37.0443 38.0 38.0 38.0 35.6 38.0 30-34 37.41265 38.0 38.0 38.0 37.2 38.0 35-39 37.422250000000005 38.0 38.0 38.0 37.2 38.0 40-44 37.339200000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.310449999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.28605 38.0 38.0 38.0 37.0 38.0 55-59 37.2895 38.0 38.0 38.0 37.0 38.0 60-64 37.3403 38.0 38.0 38.0 37.0 38.0 65-69 37.3417 38.0 38.0 38.0 36.8 38.0 70-74 37.17685 38.0 38.0 38.0 36.6 38.0 75-79 37.24805 38.0 38.0 38.0 36.8 38.0 80-84 37.111450000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.873000000000005 38.0 38.0 38.0 35.4 38.0 90-94 35.560900000000004 38.0 36.8 38.0 29.2 38.0 95-99 35.912800000000004 38.0 37.0 38.0 31.6 38.0 100-104 35.8755 38.0 37.2 38.0 31.4 38.0 105-109 35.951899999999995 38.0 37.2 38.0 32.2 38.0 110-114 35.804899999999996 38.0 37.0 38.0 31.6 38.0 115-119 36.148450000000004 38.0 37.4 38.0 33.6 38.0 120-124 36.35575 38.0 38.0 38.0 34.0 38.0 125-129 36.425 38.0 38.0 38.0 34.0 38.0 130-134 36.152249999999995 38.0 37.6 38.0 33.4 38.0 135-139 36.11195 38.0 37.2 38.0 33.4 38.0 140-144 34.85295 37.6 34.6 38.0 28.8 38.0 145-149 34.07795 37.8 34.0 38.0 26.0 38.0 150-151 31.333125000000003 36.5 30.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 2.0 19 2.0 20 1.0 21 3.0 22 3.0 23 6.0 24 4.0 25 8.0 26 11.0 27 19.0 28 24.0 29 30.0 30 47.0 31 52.0 32 79.0 33 128.0 34 182.0 35 299.0 36 865.0 37 2232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.492459555799286 19.05675897998355 8.417877707704962 40.0329037565122 2 22.8 16.900000000000002 30.825000000000003 29.475 3 23.200000000000003 18.8 23.425 34.575 4 26.075 25.025 22.575 26.325 5 25.15 29.599999999999998 23.474999999999998 21.775 6 21.55 32.95 23.95 21.55 7 16.575 20.849999999999998 42.5 20.075000000000003 8 20.8 22.075 28.449999999999996 28.675 9 20.625 21.725 33.225 24.425 10-14 23.165 26.235000000000003 25.645 24.955 15-19 23.380000000000003 24.63 26.3 25.69 20-24 22.737273727372738 25.937593759375936 25.542554255425543 25.782578257825783 25-29 22.830000000000002 25.395 26.32 25.455 30-34 23.150000000000002 25.295 25.869999999999997 25.685000000000002 35-39 22.405 25.595000000000002 26.235000000000003 25.765 40-44 23.43 24.83 25.965 25.775 45-49 23.765 25.305 24.89 26.040000000000003 50-54 22.650000000000002 24.91 25.900000000000002 26.540000000000003 55-59 22.939999999999998 25.074999999999996 25.825 26.16 60-64 23.645 25.035 25.929999999999996 25.39 65-69 23.84 25.045 25.465 25.650000000000002 70-74 23.669999999999998 24.775 25.75 25.805 75-79 23.57 25.2 25.480000000000004 25.75 80-84 23.685000000000002 25.06 26.11 25.145 85-89 23.575 25.19 25.330000000000002 25.905 90-94 23.26 25.1 25.965 25.674999999999997 95-99 23.995 24.92 25.4 25.685000000000002 100-104 23.47 25.455 25.405 25.669999999999998 105-109 23.36 25.130000000000003 25.495 26.015 110-114 23.72 24.895 25.615 25.77 115-119 23.39 25.21 25.615 25.785000000000004 120-124 23.445 24.834999999999997 25.840000000000003 25.88 125-129 23.990000000000002 24.740000000000002 25.275 25.995 130-134 24.265 24.735 25.56 25.44 135-139 23.985 25.345000000000002 25.15 25.52 140-144 23.990000000000002 24.485 25.685000000000002 25.840000000000003 145-149 23.885 24.92 25.105 26.090000000000003 150-151 23.974999999999998 25.112499999999997 25.5375 25.374999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.0 24 0.0 25 0.0 26 2.0 27 2.5 28 3.5 29 6.0 30 8.0 31 14.0 32 15.5 33 19.5 34 28.5 35 35.5 36 47.0 37 64.5 38 76.0 39 93.0 40 122.0 41 137.5 42 153.0 43 177.5 44 199.0 45 206.0 46 212.5 47 208.5 48 198.5 49 193.0 50 178.5 51 164.0 52 136.5 53 120.0 54 118.5 55 107.5 56 93.0 57 77.0 58 72.0 59 77.5 60 79.5 61 74.0 62 62.5 63 64.5 64 66.0 65 49.5 66 40.0 67 38.0 68 35.5 69 29.5 70 20.5 71 19.0 72 15.0 73 9.5 74 10.0 75 8.0 76 4.0 77 2.5 78 1.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.2 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.55 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.0374999999999996 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.4000000000000004 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCACTC 10 0.006843168 144.91249 145 TTCATCG 10 0.006843168 144.91249 3 TCGCGTT 10 0.006843168 144.91249 7 GCGTTCA 10 0.006843168 144.91249 9 ATCGCGT 10 0.006843168 144.91249 6 AGTTTGG 10 0.006843168 144.91249 5 CGCGTTC 10 0.006843168 144.91249 8 CATCGCG 10 0.006843168 144.91249 5 >>END_MODULE SRR6958253 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958253_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9765 33.0 33.0 34.0 32.0 34.0 2 33.07525 34.0 33.0 34.0 33.0 34.0 3 33.12625 34.0 33.0 34.0 33.0 34.0 4 33.102 34.0 33.0 34.0 33.0 34.0 5 32.94975 34.0 33.0 34.0 32.0 34.0 6 37.1965 38.0 38.0 38.0 37.0 38.0 7 37.225 38.0 38.0 38.0 37.0 38.0 8 37.075 38.0 38.0 38.0 37.0 38.0 9 37.2435 38.0 38.0 38.0 37.0 38.0 10-14 36.85215000000001 38.0 38.0 38.0 35.4 38.0 15-19 36.83135 38.0 38.0 38.0 35.4 38.0 20-24 36.8318 38.0 38.0 38.0 35.8 38.0 25-29 36.971199999999996 38.0 38.0 38.0 36.2 38.0 30-34 36.68905 38.0 37.8 38.0 35.0 38.0 35-39 37.1805 38.0 38.0 38.0 36.8 38.0 40-44 36.86135 38.0 38.0 38.0 35.4 38.0 45-49 36.40045 38.0 37.8 38.0 32.6 38.0 50-54 36.0909 38.0 36.2 38.0 32.0 38.0 55-59 36.294200000000004 38.0 37.4 38.0 33.4 38.0 60-64 33.89205 37.2 32.0 38.0 24.4 38.0 65-69 36.574 38.0 37.8 38.0 34.6 38.0 70-74 35.65325 38.0 37.0 38.0 29.6 38.0 75-79 36.08045 38.0 37.6 38.0 32.2 38.0 80-84 34.59135 37.8 34.0 38.0 26.6 38.0 85-89 35.68894999999999 38.0 36.8 38.0 30.8 38.0 90-94 36.281600000000005 38.0 38.0 38.0 33.6 38.0 95-99 34.7989 37.8 33.6 38.0 28.4 38.0 100-104 36.30415 38.0 37.4 38.0 33.4 38.0 105-109 36.4281 38.0 38.0 38.0 34.2 38.0 110-114 35.991949999999996 38.0 38.0 38.0 33.2 38.0 115-119 35.96605 38.0 37.8 38.0 33.2 38.0 120-124 35.3596 38.0 36.6 38.0 29.6 38.0 125-129 34.413 38.0 34.6 38.0 23.6 38.0 130-134 34.721050000000005 38.0 35.0 38.0 24.8 38.0 135-139 35.27315 38.0 36.0 38.0 30.6 38.0 140-144 34.4713 38.0 34.6 38.0 25.0 38.0 145-149 34.538799999999995 38.0 35.8 38.0 29.0 38.0 150-151 30.029625000000003 35.5 28.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 1.0 4 2.0 5 1.0 6 0.0 7 2.0 8 1.0 9 0.0 10 2.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 0.0 17 1.0 18 2.0 19 7.0 20 3.0 21 8.0 22 9.0 23 6.0 24 14.0 25 14.0 26 17.0 27 36.0 28 34.0 29 55.0 30 56.0 31 84.0 32 94.0 33 134.0 34 194.0 35 372.0 36 894.0 37 1941.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.275000000000006 19.375 11.725 31.624999999999996 2 30.8 23.95 26.325 18.925 3 22.625 26.35 27.325 23.7 4 24.95 32.675 20.1 22.275 5 26.700000000000003 33.175 19.650000000000002 20.474999999999998 6 23.799999999999997 36.5 18.175 21.525 7 22.6 19.525000000000002 34.849999999999994 23.025000000000002 8 23.25 23.799999999999997 23.65 29.299999999999997 9 24.05 22.475 26.75 26.724999999999998 10-14 25.564999999999998 26.32 23.165 24.95 15-19 25.635 25.679999999999996 24.45 24.235 20-24 25.47 25.235000000000003 24.54 24.755 25-29 25.869999999999997 25.2 24.565 24.365000000000002 30-34 25.5 24.97 24.83 24.7 35-39 25.180000000000003 25.77 23.955000000000002 25.095 40-44 25.955000000000002 25.415 24.145 24.485 45-49 26.009999999999998 25.415 24.73 23.845 50-54 26.07 25.36 24.015 24.555 55-59 26.284999999999997 25.724999999999998 24.245 23.745 60-64 25.674999999999997 25.5 24.775 24.05 65-69 26.490000000000002 25.305 24.34 23.865 70-74 26.455000000000002 25.069999999999997 24.365000000000002 24.11 75-79 25.97 25.669999999999998 24.555 23.805 80-84 25.86 25.72 23.915 24.505 85-89 25.805 25.64 24.605 23.95 90-94 26.015 25.759999999999998 24.645 23.580000000000002 95-99 26.145000000000003 25.635 24.145 24.075 100-104 25.605 25.755 24.85 23.79 105-109 26.26 25.330000000000002 24.5 23.91 110-114 26.195 25.785000000000004 24.68 23.34 115-119 25.430000000000003 25.8 24.915000000000003 23.855 120-124 25.915 25.835 24.725 23.525 125-129 26.150000000000002 25.985000000000003 24.224999999999998 23.64 130-134 26.595000000000002 25.915 23.794999999999998 23.695 135-139 26.31 25.585 24.775 23.330000000000002 140-144 26.61 25.935000000000002 24.265 23.189999999999998 145-149 26.185000000000002 25.490000000000002 24.795 23.53 150-151 26.8 25.362499999999997 24.775 23.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 2.0 27 2.0 28 3.5 29 8.5 30 7.5 31 5.5 32 7.5 33 11.5 34 19.5 35 24.5 36 32.5 37 56.0 38 71.0 39 82.5 40 103.5 41 121.0 42 157.5 43 176.0 44 200.0 45 213.0 46 196.5 47 199.0 48 182.0 49 185.0 50 173.5 51 147.0 52 139.0 53 122.0 54 106.0 55 96.5 56 95.5 57 91.0 58 97.5 59 103.5 60 96.5 61 83.5 62 73.0 63 67.5 64 65.0 65 57.0 66 49.0 67 54.0 68 53.5 69 46.5 70 35.5 71 21.5 72 12.5 73 10.0 74 9.5 75 7.0 76 5.5 77 5.5 78 3.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.757002271006813 1.5 3 0.05046681806712087 0.15 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7125 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.4249999999999998 0.0 0.0 0.0 0.0 122-123 1.6125 0.0 0.0 0.0 0.0 124-125 1.7625000000000002 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTCAT 10 0.006830828 145.0 5 CTGAGCT 10 0.006830828 145.0 1 TCCGAAT 10 0.006830828 145.0 7 >>END_MODULE Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913246 spots for SRR6958253.sra Written 913246 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra Read 913236 spots for SRR6958253.sra Written 913236 spots for SRR6958253.sra SRR ids: ['SRR6958253.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3juovdhm SRR6958253.sra spots: 18264730 blocks: [[1, 913236], [913237, 1826472], [1826473, 2739708], [2739709, 3652944], [3652945, 4566180], [4566181, 5479416], [5479417, 6392652], [6392653, 7305888], [7305889, 8219124], [8219125, 9132360], [9132361, 10045596], [10045597, 10958832], [10958833, 11872068], [11872069, 12785304], [12785305, 13698540], [13698541, 14611776], [14611777, 15525012], [15525013, 16438248], [16438249, 17351484], [17351485, 18264730]] SRR6958253 file size 6167617 SRR6958253 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958253 SRR6958253_1.fastq SRR6958253_2.fastq Input file: SRR6958253_1.fastq Paired file: SRR6958253_2.fastq trimmed: SRR6958253-trimmed-pair1.fastq, SRR6958253-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:51:52 2024 >> started Fri Dec 6 17:55:21 2024 >> done (208.980s) 18264730 read pairs processed; of these: 13195 ( 0.07%) short read pairs filtered out after trimming by size control 9720 ( 0.05%) empty read pairs filtered out after trimming by size control 18241815 (99.87%) read pairs available; of these: 5874543 (32.20%) trimmed read pairs available after processing 12367272 (67.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 6 0.00% 21 4 0.00% 22 6 0.00% 23 5 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 9 0.00% 28 3 0.00% 29 5 0.00% 30 5 0.00% 31 2 0.00% 32 2 0.00% 33 6 0.00% 34 9 0.00% 35 5 0.00% 36 5 0.00% 37 9 0.00% 38 10 0.00% 39 10 0.00% 40 11 0.00% 41 12 0.00% 42 14 0.00% 43 8 0.00% 44 13 0.00% 45 12 0.00% 46 16 0.00% 47 12 0.00% 48 20 0.00% 49 20 0.00% 50 30 0.00% 51 35 0.00% 52 42 0.00% 53 44 0.00% 54 39 0.00% 55 50 0.00% 56 50 0.00% 57 61 0.00% 58 80 0.00% 59 65 0.00% 60 84 0.00% 61 106 0.00% 62 107 0.00% 63 136 0.00% 64 165 0.00% 65 151 0.00% 66 175 0.00% 67 205 0.00% 68 216 0.00% 69 243 0.00% 70 279 0.00% 71 333 0.00% 72 323 0.00% 73 449 0.00% 74 476 0.00% 75 573 0.00% 76 642 0.00% 77 713 0.00% 78 802 0.00% 79 845 0.00% 80 1002 0.01% 81 1156 0.01% 82 1353 0.01% 83 1455 0.01% 84 2164 0.01% 85 2697 0.01% 86 2878 0.02% 87 2857 0.02% 88 3152 0.02% 89 3224 0.02% 90 3575 0.02% 91 3825 0.02% 92 4227 0.02% 93 4426 0.02% 94 4732 0.03% 95 5171 0.03% 96 5319 0.03% 97 5860 0.03% 98 5906 0.03% 99 6506 0.04% 100 7012 0.04% 101 7361 0.04% 102 8016 0.04% 103 8625 0.05% 104 9117 0.05% 105 9848 0.05% 106 10237 0.06% 107 10839 0.06% 108 11014 0.06% 109 11952 0.07% 110 12351 0.07% 111 12810 0.07% 112 13887 0.08% 113 14867 0.08% 114 15700 0.09% 115 16644 0.09% 116 17162 0.09% 117 17980 0.10% 118 18670 0.10% 119 18857 0.10% 120 19706 0.11% 121 20744 0.11% 122 21709 0.12% 123 23064 0.13% 124 24313 0.13% 125 25745 0.14% 126 26582 0.15% 127 27686 0.15% 128 28286 0.16% 129 29662 0.16% 130 30281 0.17% 131 31880 0.17% 132 33596 0.18% 133 35339 0.19% 134 37229 0.20% 135 39835 0.22% 136 41196 0.23% 137 43339 0.24% 138 45732 0.25% 139 48897 0.27% 140 51646 0.28% 141 55984 0.31% 142 61756 0.34% 143 68903 0.38% 144 78942 0.43% 145 92500 0.51% 146 112576 0.62% 147 149465 0.82% 148 224119 1.23% 149 452589 2.48% 150 3559033 19.51% 151 12367272 67.80% 18241815 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=20 prefix-density=0.84 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=112.65 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.5 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=21 prefix-density=0.61 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=22.57 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=3.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958253 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:00:54 Started mapping on | Dec 06 18:00:58 Finished on | Dec 06 18:21:29 Mapping speed, Million of reads per hour | 53.35 Number of input reads | 18241815 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17668843 Uniquely mapped reads % | 96.86% Average mapped length | 297.40 Number of splices: Total | 20876986 Number of splices: Annotated (sjdb) | 19668925 Number of splices: GT/AG | 20594802 Number of splices: GC/AG | 248280 Number of splices: AT/AC | 8018 Number of splices: Non-canonical | 25886 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 155636 % of reads mapped to multiple loci | 0.85% Number of reads mapped to too many loci | 13200 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.78% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 425920 425920 425920 N_multimapping 155636 155636 155636 N_noFeature 552896 17176450 687677 N_ambiguous 431954 2525 75982 UnstrandedReadsAssigned:16683993 PositiveStrandReadsAssigned:489868 NegativeStrandReadsAssigned:16905184 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958253 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958253-trimmed-pair1.fastq SRR6958253-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,241,815 reads, 16,902,350 reads pseudoaligned [quant] estimated average fragment length: 273.05 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR6958253.ke.tsv 35125 SRR6958253.se.tsv 88098 total ==> SRR6958253.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.44 0 0 PNS24247 1044 771.95 50.3094 5.68346 PNS24249 1928 1655.95 30.402 1.60106 PNS24246 1044 771.95 50.3094 5.68346 PNS24248 1044 771.95 50.3094 5.68346 PNS24244 1471 1198.95 7.66976 0.55787 PNS24243 293 82.3371 0 0 KQK14069 1603 1330.95 3656.07 239.555 KQK14071 474 219.779 65.2325 25.884 ==> SRR6958253.se.tsv <== BRADI_1g14170v3 4222 BRADI_1g53295v3 167 BRADI_1g59795v3 198 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 217 BRADI_1g74790v3 88 BRADI_1g09890v3 0 BRADI_1g77505v3 222 BRADI_1g48960v3 0 SRR6958253 completed mapping pipeline successfully