Starting /dee2/code/volunteer_pipeline.sh SRR6958254 current disk space = 1550707286016 free memory = 1601791000 SRR6958254 SRAfilesize 99078aba3caab843d76673c39c3746e1 SRR6958254.sra SRR6958254.sra file validated SRR6958254 is paired end SRR6958254 is conventional basespace SRR6958254 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958254_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.575 18.0 18.0 18.0 18.0 32.0 2 20.6005 18.0 18.0 25.0 18.0 27.0 3 24.99375 27.0 18.0 27.0 18.0 29.0 4 28.383 28.0 27.0 32.0 25.0 32.0 5 29.557 32.0 27.0 32.0 25.0 33.0 6 35.139 37.0 35.0 38.0 29.0 38.0 7 35.8425 38.0 36.0 38.0 31.0 38.0 8 36.4625 38.0 37.0 38.0 34.0 38.0 9 36.806 38.0 38.0 38.0 35.0 38.0 10-14 37.06245 38.0 38.0 38.0 35.8 38.0 15-19 37.256099999999996 38.0 38.0 38.0 36.4 38.0 20-24 37.183899999999994 38.0 38.0 38.0 36.0 38.0 25-29 37.129850000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.9601 38.0 38.0 38.0 35.8 38.0 35-39 36.90455 38.0 38.0 38.0 35.2 38.0 40-44 36.93984999999999 38.0 38.0 38.0 35.4 38.0 45-49 36.829 38.0 38.0 38.0 35.0 38.0 50-54 36.67115 38.0 38.0 38.0 34.4 38.0 55-59 36.58765 38.0 38.0 38.0 34.0 38.0 60-64 36.625099999999996 38.0 38.0 38.0 34.2 38.0 65-69 36.5861 38.0 38.0 38.0 34.0 38.0 70-74 36.2584 38.0 37.2 38.0 33.2 38.0 75-79 36.1124 38.0 37.0 38.0 32.8 38.0 80-84 35.999199999999995 38.0 37.0 38.0 32.2 38.0 85-89 36.02425 38.0 37.0 38.0 32.6 38.0 90-94 35.84740000000001 38.0 36.6 38.0 31.4 38.0 95-99 35.6343 38.0 36.2 38.0 30.2 38.0 100-104 35.173500000000004 38.0 35.8 38.0 28.2 38.0 105-109 34.880050000000004 38.0 35.0 38.0 27.2 38.0 110-114 34.8249 38.0 35.0 38.0 27.0 38.0 115-119 34.8767 38.0 35.0 38.0 27.6 38.0 120-124 34.4068 38.0 34.4 38.0 25.0 38.0 125-129 34.237 38.0 34.0 38.0 23.8 38.0 130-134 33.4613 38.0 33.6 38.0 20.2 38.0 135-139 32.95695 37.2 33.2 38.0 18.4 38.0 140-144 32.12185 36.4 32.2 38.0 14.2 38.0 145-149 30.59285 36.0 30.6 38.0 8.6 38.0 150-151 25.898875 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 2.0 17 1.0 18 3.0 19 6.0 20 4.0 21 11.0 22 6.0 23 6.0 24 14.0 25 22.0 26 31.0 27 41.0 28 59.0 29 74.0 30 98.0 31 126.0 32 163.0 33 231.0 34 294.0 35 536.0 36 1206.0 37 1059.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.201560468140443 33.185955786736024 2.1586475942782837 39.453836150845255 2 11.15 30.825000000000003 23.025000000000002 35.0 3 18.775 19.900000000000002 24.85 36.475 4 23.724999999999998 24.925 24.099999999999998 27.250000000000004 5 24.7 26.974999999999998 23.175 25.15 6 24.2 32.300000000000004 22.5 21.0 7 16.75 23.549999999999997 39.5 20.200000000000003 8 20.424999999999997 24.2 27.650000000000002 27.725 9 19.85 21.8 33.45 24.9 10-14 22.375 27.029999999999998 25.71 24.884999999999998 15-19 22.3 25.05 26.77 25.88 20-24 22.68 25.814999999999998 26.169999999999998 25.335 25-29 22.62 25.474999999999998 26.700000000000003 25.205 30-34 22.814999999999998 25.814999999999998 25.624999999999996 25.745 35-39 22.555 25.25 26.55 25.645 40-44 22.38 25.46 26.290000000000003 25.869999999999997 45-49 22.869999999999997 25.205 25.95 25.974999999999998 50-54 22.795 25.16 26.450000000000003 25.595000000000002 55-59 22.965 25.06 26.119999999999997 25.855 60-64 22.34 25.775 26.235000000000003 25.650000000000002 65-69 22.855 25.705 25.895000000000003 25.545 70-74 23.57 25.115 25.564999999999998 25.75 75-79 23.294999999999998 25.1 25.979999999999997 25.624999999999996 80-84 22.314999999999998 25.19 26.340000000000003 26.155 85-89 23.35 25.16 25.94 25.55 90-94 22.79 25.085 26.314999999999998 25.81 95-99 23.605 24.65 26.36 25.385 100-104 23.155 24.57 26.845000000000002 25.430000000000003 105-109 23.485 24.279999999999998 26.345000000000002 25.89 110-114 23.395 25.119999999999997 25.845000000000002 25.64 115-119 23.69 25.25 25.724999999999998 25.335 120-124 23.3 25.540000000000003 25.365 25.795 125-129 23.5 25.15 25.705 25.645 130-134 23.645 25.055 25.66 25.64 135-139 22.965 25.22 26.11 25.705 140-144 23.685000000000002 25.16 25.629999999999995 25.525 145-149 23.400000000000002 25.169999999999998 25.6 25.83 150-151 24.0 24.575 25.874999999999996 25.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 3.5 29 4.0 30 5.5 31 7.5 32 11.5 33 19.5 34 25.0 35 36.0 36 55.5 37 69.5 38 82.5 39 105.0 40 139.5 41 166.0 42 174.0 43 196.5 44 219.5 45 226.5 46 226.0 47 211.0 48 191.0 49 191.5 50 177.0 51 149.5 52 138.5 53 119.5 54 101.0 55 99.5 56 94.0 57 79.0 58 66.0 59 60.5 60 64.0 61 67.0 62 69.0 63 58.5 64 45.5 65 40.0 66 38.0 67 35.0 68 26.5 69 20.0 70 22.0 71 20.5 72 14.5 73 10.0 74 5.5 75 4.5 76 2.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 0.9625 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.9375 0.0 0.0 0.0 0.0 138-139 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGAAA 10 0.005853838 152.57895 1 CTGGTGA 20 0.005945122 28.99 100-104 CGATGGT 20 0.005945122 28.99 110-114 >>END_MODULE SRR6958254 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958254_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06175 33.0 33.0 34.0 30.0 34.0 2 32.02425 33.0 33.0 34.0 28.0 34.0 3 32.067 33.0 33.0 34.0 30.0 34.0 4 32.0095 33.0 33.0 34.0 30.0 34.0 5 32.12325 33.0 33.0 34.0 31.0 34.0 6 36.1055 38.0 38.0 38.0 33.0 38.0 7 35.41825 38.0 37.0 38.0 29.0 38.0 8 36.10375 38.0 38.0 38.0 33.0 38.0 9 36.01175 38.0 38.0 38.0 32.0 38.0 10-14 35.99375 38.0 38.0 38.0 31.4 38.0 15-19 36.109500000000004 38.0 38.0 38.0 33.0 38.0 20-24 36.0299 38.0 38.0 38.0 32.6 38.0 25-29 36.0244 38.0 38.0 38.0 32.2 38.0 30-34 36.08095 38.0 38.0 38.0 33.2 38.0 35-39 35.8733 38.0 37.8 38.0 32.2 38.0 40-44 35.8497 38.0 37.8 38.0 31.8 38.0 45-49 35.6623 38.0 37.2 38.0 30.6 38.0 50-54 35.74720000000001 38.0 37.0 38.0 30.8 38.0 55-59 35.61305 38.0 37.0 38.0 30.0 38.0 60-64 35.3949 38.0 36.8 38.0 29.0 38.0 65-69 35.47085 38.0 37.0 38.0 29.0 38.0 70-74 35.211949999999995 38.0 36.4 38.0 28.4 38.0 75-79 35.143100000000004 38.0 36.0 38.0 28.6 38.0 80-84 35.09645 38.0 36.0 38.0 28.6 38.0 85-89 35.02285 38.0 36.0 38.0 28.4 38.0 90-94 34.63815 38.0 35.6 38.0 26.2 38.0 95-99 34.187850000000005 38.0 34.6 38.0 23.2 38.0 100-104 33.765 38.0 34.0 38.0 17.8 38.0 105-109 33.6291 38.0 34.0 38.0 18.6 38.0 110-114 33.2393 38.0 33.8 38.0 17.4 38.0 115-119 33.19325 38.0 33.8 38.0 16.2 38.0 120-124 32.81635000000001 38.0 33.2 38.0 15.0 38.0 125-129 32.35365 37.8 32.4 38.0 14.6 38.0 130-134 31.6076 36.2 31.0 38.0 13.8 38.0 135-139 30.897250000000003 36.0 29.6 38.0 13.0 38.0 140-144 29.948050000000002 36.0 27.4 38.0 8.6 38.0 145-149 28.458299999999998 34.2 23.8 38.0 2.0 38.0 150-151 22.474375000000002 28.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 7.0 4 4.0 5 9.0 6 3.0 7 4.0 8 2.0 9 0.0 10 5.0 11 4.0 12 1.0 13 5.0 14 7.0 15 7.0 16 13.0 17 10.0 18 6.0 19 13.0 20 20.0 21 20.0 22 26.0 23 28.0 24 31.0 25 41.0 26 50.0 27 52.0 28 71.0 29 80.0 30 117.0 31 112.0 32 169.0 33 222.0 34 266.0 35 453.0 36 863.0 37 1257.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.35 19.775000000000002 12.4 27.474999999999998 2 30.75 22.325 26.025 20.9 3 23.45 25.7 28.125 22.725 4 26.575 32.2 18.725 22.5 5 26.700000000000003 32.95 19.45 20.9 6 22.7 35.9 20.225 21.175 7 21.925 20.200000000000003 34.599999999999994 23.275000000000002 8 24.349999999999998 22.875 23.150000000000002 29.625 9 24.099999999999998 23.325000000000003 26.525 26.05 10-14 25.86 25.89 23.36 24.89 15-19 25.290000000000003 25.569999999999997 24.89 24.25 20-24 25.85 25.61 24.529999999999998 24.01 25-29 25.495 25.94 24.2 24.365000000000002 30-34 25.89 25.480000000000004 24.07 24.560000000000002 35-39 25.755 25.905 24.05 24.29 40-44 25.669999999999998 25.61 24.04 24.68 45-49 25.445 25.509999999999998 24.86 24.185000000000002 50-54 25.685000000000002 25.595000000000002 25.2 23.52 55-59 25.91 24.94 24.38 24.77 60-64 25.64 25.240000000000002 24.95 24.169999999999998 65-69 26.150000000000002 25.95 24.44 23.46 70-74 26.21 25.41 24.47 23.91 75-79 26.205000000000002 24.65 25.035 24.11 80-84 25.790000000000003 25.805 24.715 23.69 85-89 26.1 25.7 24.48 23.72 90-94 25.305 25.5 25.275 23.919999999999998 95-99 25.88 25.66 24.610000000000003 23.849999999999998 100-104 26.505000000000003 25.45 24.94 23.105 105-109 25.669999999999998 25.645 25.0 23.685000000000002 110-114 25.525 26.505000000000003 25.09 22.88 115-119 26.040000000000003 26.08 24.5 23.380000000000003 120-124 25.775 26.415 24.805 23.005 125-129 25.629999999999995 26.07 24.845 23.455000000000002 130-134 26.765 25.745 24.57 22.919999999999998 135-139 25.945 25.44 25.495 23.119999999999997 140-144 26.235000000000003 26.14 24.779999999999998 22.845 145-149 26.674999999999997 26.25 24.565 22.509999999999998 150-151 26.575 25.8 25.0375 22.5875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.5 26 1.0 27 3.0 28 5.0 29 4.0 30 4.0 31 10.0 32 9.5 33 8.0 34 14.5 35 26.0 36 37.0 37 50.5 38 75.5 39 95.5 40 113.5 41 130.5 42 155.0 43 183.0 44 197.5 45 193.0 46 198.0 47 208.5 48 195.0 49 186.5 50 179.5 51 161.5 52 141.0 53 127.5 54 111.0 55 94.0 56 88.0 57 94.0 58 92.0 59 77.5 60 72.5 61 77.0 62 74.5 63 66.5 64 62.5 65 54.0 66 50.5 67 54.5 68 46.5 69 41.5 70 37.0 71 19.5 72 20.5 73 21.0 74 11.0 75 8.0 76 5.5 77 2.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.4278882456581928 0.8500000000000001 3 0.05033979360684621 0.15 4 0.05033979360684621 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.925 0.0 0.0 0.0 0.0 124-125 1.0125 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.4500000000000002 0.0 0.0 0.0 0.0 132-133 1.6375 0.0 0.0 0.0 0.0 134-135 1.875 0.0 0.0 0.0 0.0 136-137 2.05 0.0 0.0 0.0 0.0 138-139 2.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGGCGT 10 0.006830828 145.0 7 GCAATTG 10 0.006830828 145.0 3 CGGCGTA 10 0.006830828 145.0 8 >>END_MODULE Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721928 spots for SRR6958254.sra Written 721928 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra Read 721914 spots for SRR6958254.sra Written 721914 spots for SRR6958254.sra SRR ids: ['SRR6958254.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l2e2yvur SRR6958254.sra spots: 14438294 blocks: [[1, 721914], [721915, 1443828], [1443829, 2165742], [2165743, 2887656], [2887657, 3609570], [3609571, 4331484], [4331485, 5053398], [5053399, 5775312], [5775313, 6497226], [6497227, 7219140], [7219141, 7941054], [7941055, 8662968], [8662969, 9384882], [9384883, 10106796], [10106797, 10828710], [10828711, 11550624], [11550625, 12272538], [12272539, 12994452], [12994453, 13716366], [13716367, 14438294]] SRR6958254 file size 4870963 SRR6958254 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958254 SRR6958254_1.fastq SRR6958254_2.fastq Input file: SRR6958254_1.fastq Paired file: SRR6958254_2.fastq trimmed: SRR6958254-trimmed-pair1.fastq, SRR6958254-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:49:36 2024 >> started Fri Dec 6 17:49:52 2024 >> done (16.653s) 14438294 read pairs processed; of these: 39101 ( 0.27%) short read pairs filtered out after trimming by size control 30436 ( 0.21%) empty read pairs filtered out after trimming by size control 14368757 (99.52%) read pairs available; of these: 6290196 (43.78%) trimmed read pairs available after processing 8078561 (56.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 6 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 3 0.00% 25 2 0.00% 26 7 0.00% 27 4 0.00% 28 5 0.00% 29 4 0.00% 30 7 0.00% 31 2 0.00% 32 5 0.00% 33 2 0.00% 34 10 0.00% 35 10 0.00% 36 5 0.00% 37 9 0.00% 38 5 0.00% 39 8 0.00% 40 6 0.00% 41 11 0.00% 42 15 0.00% 43 12 0.00% 44 22 0.00% 45 17 0.00% 46 20 0.00% 47 23 0.00% 48 23 0.00% 49 29 0.00% 50 24 0.00% 51 43 0.00% 52 45 0.00% 53 38 0.00% 54 61 0.00% 55 66 0.00% 56 55 0.00% 57 63 0.00% 58 82 0.00% 59 77 0.00% 60 98 0.00% 61 112 0.00% 62 116 0.00% 63 133 0.00% 64 132 0.00% 65 139 0.00% 66 165 0.00% 67 175 0.00% 68 186 0.00% 69 202 0.00% 70 232 0.00% 71 278 0.00% 72 285 0.00% 73 354 0.00% 74 368 0.00% 75 413 0.00% 76 471 0.00% 77 512 0.00% 78 548 0.00% 79 639 0.00% 80 658 0.00% 81 842 0.01% 82 978 0.01% 83 1202 0.01% 84 2531 0.02% 85 3378 0.02% 86 3109 0.02% 87 3123 0.02% 88 3068 0.02% 89 3125 0.02% 90 3177 0.02% 91 3451 0.02% 92 3316 0.02% 93 3480 0.02% 94 3596 0.03% 95 3745 0.03% 96 3953 0.03% 97 4079 0.03% 98 4385 0.03% 99 4813 0.03% 100 4918 0.03% 101 5105 0.04% 102 5548 0.04% 103 5939 0.04% 104 6070 0.04% 105 6562 0.05% 106 7012 0.05% 107 7614 0.05% 108 7761 0.05% 109 8430 0.06% 110 8648 0.06% 111 9224 0.06% 112 9794 0.07% 113 10594 0.07% 114 11543 0.08% 115 12072 0.08% 116 12806 0.09% 117 13679 0.10% 118 14406 0.10% 119 14983 0.10% 120 15746 0.11% 121 16407 0.11% 122 17532 0.12% 123 18746 0.13% 124 20241 0.14% 125 21307 0.15% 126 22925 0.16% 127 23796 0.17% 128 25523 0.18% 129 27433 0.19% 130 28950 0.20% 131 31049 0.22% 132 33265 0.23% 133 35782 0.25% 134 38411 0.27% 135 41548 0.29% 136 43826 0.31% 137 47766 0.33% 138 52031 0.36% 139 57123 0.40% 140 62378 0.43% 141 69041 0.48% 142 78425 0.55% 143 89613 0.62% 144 105433 0.73% 145 129297 0.90% 146 166115 1.16% 147 229073 1.59% 148 353794 2.46% 149 710004 4.94% 150 3428506 23.86% 151 8078561 56.22% 14368757 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=19 prefix-density=0.60 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=37.42 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.91 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=3.1 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.14 sequence-density-rank=19 fanout-score=46.96 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=9.9 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958254 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:50:41 Started mapping on | Dec 06 17:50:41 Finished on | Dec 06 17:52:09 Mapping speed, Million of reads per hour | 587.81 Number of input reads | 14368757 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13800175 Uniquely mapped reads % | 96.04% Average mapped length | 296.51 Number of splices: Total | 16188789 Number of splices: Annotated (sjdb) | 15210125 Number of splices: GT/AG | 15968692 Number of splices: GC/AG | 195235 Number of splices: AT/AC | 5920 Number of splices: Non-canonical | 18942 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.48 Insertion rate per base | 0.01% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 119065 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 5662 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 470685 470685 470685 N_multimapping 119065 119065 119065 N_noFeature 412398 13428145 508933 N_ambiguous 335671 1985 60980 UnstrandedReadsAssigned:13052106 PositiveStrandReadsAssigned:370045 NegativeStrandReadsAssigned:13230262 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958254 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958254-trimmed-pair1.fastq SRR6958254-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,368,757 reads, 13,245,602 reads pseudoaligned [quant] estimated average fragment length: 276.136 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR6958254.ke.tsv 35125 SRR6958254.se.tsv 88098 total ==> SRR6958254.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.286 0 0 PNS24247 1044 768.864 59.026 8.49933 PNS24249 1928 1652.86 43.3147 2.90128 PNS24246 1044 768.864 59.026 8.49933 PNS24248 1044 768.864 59.026 8.49933 PNS24244 1471 1195.86 15.6071 1.44488 PNS24243 293 75.0659 0 0 KQK14069 1603 1327.86 3864.29 322.186 KQK14071 474 213.589 74.3564 38.5417 ==> SRR6958254.se.tsv <== BRADI_1g14170v3 4487 BRADI_1g53295v3 158 BRADI_1g59795v3 321 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 176 BRADI_1g74790v3 62 BRADI_1g09890v3 0 BRADI_1g77505v3 183 BRADI_1g48960v3 0 SRR6958254 completed mapping pipeline successfully