Starting /dee2/code/volunteer_pipeline.sh SRR6958256 current disk space = 1550710157312 free memory = 1603013276 SRR6958256 SRAfilesize 437a165f729aed391dd08fcd06a4cd2f SRR6958256.sra SRR6958256.sra file validated SRR6958256 is paired end SRR6958256 is conventional basespace SRR6958256 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958256_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.5815 33.0 32.0 33.0 25.0 34.0 2 31.931 33.0 31.0 33.0 28.0 34.0 3 31.94725 33.0 31.0 33.0 28.0 34.0 4 31.807 33.0 31.0 34.0 29.0 34.0 5 32.18 33.0 33.0 34.0 31.0 34.0 6 36.394 38.0 37.0 38.0 34.0 38.0 7 36.9035 38.0 38.0 38.0 35.0 38.0 8 37.057 38.0 38.0 38.0 36.0 38.0 9 37.116 38.0 38.0 38.0 36.0 38.0 10-14 37.2234 38.0 38.0 38.0 36.4 38.0 15-19 37.19555 38.0 38.0 38.0 36.4 38.0 20-24 37.2778 38.0 38.0 38.0 36.8 38.0 25-29 37.10765 38.0 38.0 38.0 36.0 38.0 30-34 36.96464999999999 38.0 38.0 38.0 35.6 38.0 35-39 36.9092 38.0 38.0 38.0 35.6 38.0 40-44 36.757999999999996 38.0 38.0 38.0 34.6 38.0 45-49 36.909349999999996 38.0 38.0 38.0 35.4 38.0 50-54 36.84755 38.0 38.0 38.0 34.8 38.0 55-59 36.617200000000004 38.0 38.0 38.0 34.2 38.0 60-64 36.616499999999995 38.0 38.0 38.0 34.2 38.0 65-69 36.7307 38.0 38.0 38.0 34.4 38.0 70-74 36.696349999999995 38.0 38.0 38.0 34.6 38.0 75-79 36.60045 38.0 38.0 38.0 34.0 38.0 80-84 36.25750000000001 38.0 37.6 38.0 33.2 38.0 85-89 36.20655 38.0 37.2 38.0 33.0 38.0 90-94 36.248949999999994 38.0 37.0 38.0 33.2 38.0 95-99 36.2145 38.0 37.4 38.0 33.4 38.0 100-104 36.01775 38.0 37.0 38.0 32.6 38.0 105-109 35.67645 38.0 36.2 38.0 31.0 38.0 110-114 35.6484 38.0 36.0 38.0 31.0 38.0 115-119 35.592600000000004 38.0 36.0 38.0 31.0 38.0 120-124 35.3391 38.0 35.6 38.0 29.4 38.0 125-129 35.03305 38.0 35.2 38.0 27.8 38.0 130-134 34.785 38.0 35.0 38.0 27.4 38.0 135-139 34.49 38.0 34.8 38.0 26.0 38.0 140-144 34.0524 38.0 34.4 38.0 23.4 38.0 145-149 32.944 38.0 33.6 38.0 16.6 38.0 150-151 28.31525 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 2.0 19 1.0 20 5.0 21 3.0 22 6.0 23 6.0 24 7.0 25 19.0 26 14.0 27 26.0 28 43.0 29 61.0 30 78.0 31 82.0 32 110.0 33 148.0 34 230.0 35 383.0 36 797.0 37 1973.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.00524934383202 9.291338582677165 9.081364829396325 43.62204724409449 2 21.82182182182182 12.162162162162163 37.46246246246246 28.553553553553552 3 21.175 14.649999999999999 25.4 38.775 4 24.7 21.925 23.45 29.925 5 26.57815631262525 26.377755511022045 25.0 22.044088176352705 6 23.7 31.1 23.0 22.2 7 18.45 26.075 36.875 18.6 8 19.125 23.65 30.0 27.224999999999998 9 20.575 22.35 33.074999999999996 24.0 10-14 22.285 25.990000000000002 26.029999999999998 25.695 15-19 22.84 24.84 26.790000000000003 25.53 20-24 23.31 25.185000000000002 26.1 25.405 25-29 22.470000000000002 25.215 26.165 26.150000000000002 30-34 22.895 25.055 26.484999999999996 25.564999999999998 35-39 22.25 25.69 25.435000000000002 26.625 40-44 23.03 25.605 25.55 25.814999999999998 45-49 22.54 24.725 26.5 26.235000000000003 50-54 23.105 25.235000000000003 25.650000000000002 26.009999999999998 55-59 23.44 25.215 25.900000000000002 25.445 60-64 23.395 24.125 26.055 26.424999999999997 65-69 23.375 25.085 25.96 25.580000000000002 70-74 23.064999999999998 24.98 25.945 26.009999999999998 75-79 23.369999999999997 24.965 25.935000000000002 25.729999999999997 80-84 23.16 25.435000000000002 25.374999999999996 26.029999999999998 85-89 23.435 24.740000000000002 26.07 25.755 90-94 24.0 24.775 25.985000000000003 25.240000000000002 95-99 23.31 25.05 25.52 26.119999999999997 100-104 23.59 24.63 25.635 26.145000000000003 105-109 23.674999999999997 24.695 25.895000000000003 25.735000000000003 110-114 23.365 24.5 25.785000000000004 26.35 115-119 23.71 24.709999999999997 25.88 25.7 120-124 23.794999999999998 25.145 25.069999999999997 25.990000000000002 125-129 22.91 24.709999999999997 25.985000000000003 26.395000000000003 130-134 23.95 24.92 25.45 25.679999999999996 135-139 24.185000000000002 24.935 25.39 25.490000000000002 140-144 23.169999999999998 25.46 25.865 25.505 145-149 23.849999999999998 24.385 26.39 25.374999999999996 150-151 24.902967321898085 24.56491799173657 24.82784524852886 25.704269437836487 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.0 28 2.0 29 1.0 30 2.0 31 3.0 32 6.0 33 15.5 34 22.5 35 28.5 36 37.0 37 50.5 38 78.5 39 111.5 40 131.0 41 141.5 42 172.0 43 196.5 44 195.5 45 207.5 46 223.0 47 215.5 48 203.5 49 186.5 50 163.0 51 157.0 52 153.0 53 130.5 54 118.5 55 103.5 56 94.5 57 101.5 58 85.5 59 74.0 60 74.5 61 66.5 62 59.5 63 54.5 64 46.5 65 41.5 66 40.5 67 39.0 68 34.0 69 26.0 70 21.5 71 21.0 72 16.5 73 13.5 74 10.0 75 5.5 76 5.0 77 4.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.75 2 0.1 3 0.0 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.1749999999999998 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.5750000000000002 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.9125 0.0 0.0 0.0 0.0 132-133 2.025 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138-139 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCACA 10 0.0065789125 146.81013 1 >>END_MODULE SRR6958256 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958256_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85975 33.0 33.0 34.0 32.0 34.0 2 32.8225 33.0 33.0 34.0 32.0 34.0 3 32.8635 34.0 33.0 34.0 32.0 34.0 4 32.82375 34.0 33.0 34.0 32.0 34.0 5 32.81475 34.0 33.0 34.0 32.0 34.0 6 36.82325 38.0 38.0 38.0 35.0 38.0 7 36.84575 38.0 38.0 38.0 36.0 38.0 8 36.906 38.0 38.0 38.0 36.0 38.0 9 36.93175 38.0 38.0 38.0 36.0 38.0 10-14 36.7517 38.0 38.0 38.0 35.2 38.0 15-19 36.6922 38.0 38.0 38.0 34.6 38.0 20-24 36.8018 38.0 38.0 38.0 35.0 38.0 25-29 36.92125 38.0 38.0 38.0 35.6 38.0 30-34 36.9542 38.0 38.0 38.0 36.0 38.0 35-39 36.8612 38.0 38.0 38.0 35.6 38.0 40-44 36.653549999999996 38.0 38.0 38.0 34.8 38.0 45-49 36.61985 38.0 38.0 38.0 34.2 38.0 50-54 36.6571 38.0 38.0 38.0 34.6 38.0 55-59 36.72115 38.0 38.0 38.0 35.0 38.0 60-64 36.6634 38.0 38.0 38.0 34.6 38.0 65-69 36.505849999999995 38.0 38.0 38.0 34.0 38.0 70-74 36.38725 38.0 38.0 38.0 34.0 38.0 75-79 36.304050000000004 38.0 38.0 38.0 33.4 38.0 80-84 36.21365 38.0 38.0 38.0 33.2 38.0 85-89 36.01085 38.0 37.6 38.0 32.6 38.0 90-94 36.018499999999996 38.0 37.2 38.0 32.6 38.0 95-99 35.844849999999994 38.0 37.0 38.0 31.6 38.0 100-104 35.7194 38.0 37.0 38.0 31.0 38.0 105-109 35.4734 38.0 36.2 38.0 29.8 38.0 110-114 35.16949999999999 38.0 35.8 38.0 28.6 38.0 115-119 35.178 38.0 35.8 38.0 28.6 38.0 120-124 34.96509999999999 38.0 35.4 38.0 27.6 38.0 125-129 34.8472 38.0 35.0 38.0 27.2 38.0 130-134 34.386250000000004 38.0 35.0 38.0 24.4 38.0 135-139 33.961200000000005 38.0 34.4 38.0 22.4 38.0 140-144 33.77569999999999 38.0 34.2 38.0 21.8 38.0 145-149 33.1663 38.0 33.8 38.0 17.4 38.0 150-151 28.607875 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 5.0 4 2.0 5 0.0 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 2.0 16 1.0 17 7.0 18 7.0 19 3.0 20 5.0 21 8.0 22 8.0 23 8.0 24 20.0 25 27.0 26 25.0 27 42.0 28 42.0 29 54.0 30 77.0 31 82.0 32 104.0 33 143.0 34 210.0 35 291.0 36 660.0 37 2159.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.974999999999998 18.6 12.675 36.75 2 29.675 23.5 28.575 18.25 3 22.475 26.0 26.674999999999997 24.85 4 26.481620405101275 29.48237059264816 20.230057514378593 23.80595148787197 5 26.974999999999998 31.85 21.525 19.650000000000002 6 24.175 36.199999999999996 19.725 19.900000000000002 7 23.35 20.0 33.175 23.474999999999998 8 23.849999999999998 24.45 24.2 27.500000000000004 9 24.349999999999998 23.65 27.425 24.575 10-14 25.365 25.72 23.745 25.169999999999998 15-19 25.385 25.91 24.044999999999998 24.66 20-24 25.505 25.515 24.4 24.58 25-29 25.995 25.83 23.94 24.235 30-34 26.215 26.07 23.825 23.89 35-39 25.174999999999997 25.86 24.11 24.855 40-44 26.200000000000003 25.1 24.43 24.27 45-49 25.44 25.11 24.91 24.54 50-54 26.040000000000003 25.624999999999996 24.055 24.279999999999998 55-59 26.355 25.135 24.099999999999998 24.41 60-64 25.929999999999996 25.39 24.25 24.43 65-69 26.314999999999998 25.055 24.84 23.79 70-74 25.6 25.045 24.465 24.89 75-79 26.045 25.16 24.495 24.3 80-84 26.1 25.295 24.19 24.415 85-89 26.14 25.224999999999998 24.46 24.175 90-94 25.94 25.124999999999996 24.77 24.165 95-99 26.105 25.185000000000002 24.585 24.125 100-104 26.205000000000002 25.595000000000002 24.03 24.169999999999998 105-109 25.96 25.4 24.529999999999998 24.11 110-114 25.995 25.865 24.9 23.24 115-119 26.325 25.39 24.25 24.035 120-124 26.435 25.990000000000002 24.560000000000002 23.015 125-129 26.355 26.075 23.995 23.575 130-134 26.575 25.71 24.575 23.14 135-139 26.715 26.075 24.33 22.88 140-144 27.22 25.685000000000002 24.42 22.675 145-149 26.901345067253363 25.566278313915696 24.276213810690532 23.256162808140406 150-151 26.77096370463079 26.921151439299123 23.9549436795995 22.35294117647059 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 1.0 29 2.0 30 3.0 31 8.5 32 13.0 33 14.5 34 15.0 35 19.5 36 35.0 37 55.5 38 69.5 39 77.5 40 101.0 41 132.0 42 155.0 43 167.0 44 177.0 45 201.0 46 225.5 47 227.5 48 200.5 49 174.5 50 167.5 51 155.0 52 130.5 53 116.0 54 107.0 55 112.0 56 110.0 57 98.5 58 95.0 59 93.0 60 93.0 61 84.5 62 74.0 63 61.0 64 46.0 65 48.5 66 57.0 67 41.0 68 36.5 69 43.0 70 40.0 71 39.5 72 31.5 73 16.5 74 8.5 75 8.0 76 6.5 77 3.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21618204804045 98.1 2 0.606826801517067 1.2 3 0.1011378002528445 0.3 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.05056890012642225 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 6 0.15 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.1749999999999998 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.8875 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.5375 0.0 0.0 0.0 0.0 138-139 2.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 50 0.0013298223 17.4 115-119 >>END_MODULE Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440587 spots for SRR6958256.sra Written 1440587 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra Read 1440568 spots for SRR6958256.sra Written 1440568 spots for SRR6958256.sra SRR ids: ['SRR6958256.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8kliyk8q SRR6958256.sra spots: 28811379 blocks: [[1, 1440568], [1440569, 2881136], [2881137, 4321704], [4321705, 5762272], [5762273, 7202840], [7202841, 8643408], [8643409, 10083976], [10083977, 11524544], [11524545, 12965112], [12965113, 14405680], [14405681, 15846248], [15846249, 17286816], [17286817, 18727384], [18727385, 20167952], [20167953, 21608520], [21608521, 23049088], [23049089, 24489656], [24489657, 25930224], [25930225, 27370792], [27370793, 28811379]] SRR6958256 file size 9741530 SRR6958256 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958256 SRR6958256_1.fastq SRR6958256_2.fastq Input file: SRR6958256_1.fastq Paired file: SRR6958256_2.fastq trimmed: SRR6958256-trimmed-pair1.fastq, SRR6958256-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:53:47 2024 >> started Fri Dec 6 17:54:39 2024 >> done (52.085s) 28811379 read pairs processed; of these: 12921 ( 0.04%) short read pairs filtered out after trimming by size control 8471 ( 0.03%) empty read pairs filtered out after trimming by size control 28789987 (99.93%) read pairs available; of these: 10133035 (35.20%) trimmed read pairs available after processing 18656952 (64.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 4 0.00% 21 6 0.00% 22 2 0.00% 23 7 0.00% 24 8 0.00% 25 6 0.00% 26 12 0.00% 27 10 0.00% 28 5 0.00% 29 7 0.00% 30 3 0.00% 31 16 0.00% 32 9 0.00% 33 11 0.00% 34 12 0.00% 35 17 0.00% 36 15 0.00% 37 14 0.00% 38 17 0.00% 39 20 0.00% 40 16 0.00% 41 14 0.00% 42 39 0.00% 43 27 0.00% 44 24 0.00% 45 20 0.00% 46 33 0.00% 47 20 0.00% 48 36 0.00% 49 44 0.00% 50 58 0.00% 51 34 0.00% 52 46 0.00% 53 68 0.00% 54 67 0.00% 55 73 0.00% 56 66 0.00% 57 82 0.00% 58 106 0.00% 59 116 0.00% 60 132 0.00% 61 151 0.00% 62 146 0.00% 63 201 0.00% 64 172 0.00% 65 253 0.00% 66 251 0.00% 67 245 0.00% 68 256 0.00% 69 328 0.00% 70 364 0.00% 71 410 0.00% 72 462 0.00% 73 536 0.00% 74 537 0.00% 75 671 0.00% 76 781 0.00% 77 813 0.00% 78 976 0.00% 79 1065 0.00% 80 1105 0.00% 81 1375 0.00% 82 1498 0.01% 83 1726 0.01% 84 2475 0.01% 85 3015 0.01% 86 3261 0.01% 87 3460 0.01% 88 3720 0.01% 89 4058 0.01% 90 4213 0.01% 91 4686 0.02% 92 4879 0.02% 93 5208 0.02% 94 5788 0.02% 95 6272 0.02% 96 6616 0.02% 97 7076 0.02% 98 7714 0.03% 99 8224 0.03% 100 8733 0.03% 101 9530 0.03% 102 9834 0.03% 103 10666 0.04% 104 11341 0.04% 105 12307 0.04% 106 13297 0.05% 107 13839 0.05% 108 14804 0.05% 109 15743 0.05% 110 16593 0.06% 111 17700 0.06% 112 18763 0.07% 113 19716 0.07% 114 20901 0.07% 115 22182 0.08% 116 23729 0.08% 117 25035 0.09% 118 26172 0.09% 119 27782 0.10% 120 29299 0.10% 121 30507 0.11% 122 31825 0.11% 123 33799 0.12% 124 35334 0.12% 125 37601 0.13% 126 39011 0.14% 127 41613 0.14% 128 43613 0.15% 129 46159 0.16% 130 48563 0.17% 131 51008 0.18% 132 54144 0.19% 133 58287 0.20% 134 61462 0.21% 135 65395 0.23% 136 70158 0.24% 137 74122 0.26% 138 79744 0.28% 139 86142 0.30% 140 94169 0.33% 141 102078 0.35% 142 114719 0.40% 143 130340 0.45% 144 151248 0.53% 145 184176 0.64% 146 228806 0.79% 147 313338 1.09% 148 490910 1.71% 149 1009021 3.50% 150 5861457 20.36% 151 18656952 64.80% 28789987 reads passed initial QC criterion=sequence-density sequence-density=1.07 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=14 prefix-density=1.12 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=42.81 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.6 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=13 prefix-density=0.85 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=25.15 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958256 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:56:47 Started mapping on | Dec 06 17:56:47 Finished on | Dec 06 17:58:55 Mapping speed, Million of reads per hour | 809.72 Number of input reads | 28789987 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 28211814 Uniquely mapped reads % | 97.99% Average mapped length | 297.69 Number of splices: Total | 33250605 Number of splices: Annotated (sjdb) | 31428871 Number of splices: GT/AG | 32819696 Number of splices: GC/AG | 384058 Number of splices: AT/AC | 11925 Number of splices: Non-canonical | 34926 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.48 Insertion rate per base | 0.01% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248075 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 23934 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 338435 338435 338435 N_multimapping 248075 248075 248075 N_noFeature 808706 27423287 1015298 N_ambiguous 693860 3432 114318 UnstrandedReadsAssigned:26709248 PositiveStrandReadsAssigned:785095 NegativeStrandReadsAssigned:27082198 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958256 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958256-trimmed-pair1.fastq SRR6958256-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,789,987 reads, 27,077,552 reads pseudoaligned [quant] estimated average fragment length: 271.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52973 SRR6958256.ke.tsv 35125 SRR6958256.se.tsv 88098 total ==> SRR6958256.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.127 0 0 PNS24247 1044 773.525 87.933 6.10804 PNS24249 1928 1657.53 45.4707 1.47399 PNS24246 1044 773.525 87.933 6.10804 PNS24248 1044 773.525 87.933 6.10804 PNS24244 1471 1200.53 28.7302 1.28585 PNS24243 293 79.4878 0 0 KQK14069 1603 1332.53 8082.35 325.902 KQK14071 474 219.152 120.014 29.4247 ==> SRR6958256.se.tsv <== BRADI_1g14170v3 9027 BRADI_1g53295v3 225 BRADI_1g59795v3 230 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 319 BRADI_1g74790v3 142 BRADI_1g09890v3 0 BRADI_1g77505v3 316 BRADI_1g48960v3 0 SRR6958256 completed mapping pipeline successfully