Starting /dee2/code/volunteer_pipeline.sh SRR6958257 current disk space = 1550714294272 free memory = 1603009248 SRR6958257 SRAfilesize 5e6c4994e25c1b17de2125b7c7cc32ac SRR6958257.sra SRR6958257.sra file validated SRR6958257 is paired end SRR6958257 is conventional basespace SRR6958257 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958257_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.18675 18.0 18.0 18.0 18.0 32.0 2 20.69475 18.0 18.0 25.0 18.0 28.0 3 24.603 27.0 18.0 27.0 18.0 29.0 4 27.183 27.0 27.0 30.0 25.0 31.0 5 30.594 32.0 32.0 33.0 27.0 33.0 6 35.4105 37.0 35.0 38.0 31.0 38.0 7 36.57425 38.0 37.0 38.0 34.0 38.0 8 36.803 38.0 38.0 38.0 35.0 38.0 9 36.852 38.0 38.0 38.0 35.0 38.0 10-14 37.24285 38.0 38.0 38.0 36.4 38.0 15-19 37.288700000000006 38.0 38.0 38.0 36.6 38.0 20-24 37.290150000000004 38.0 38.0 38.0 36.6 38.0 25-29 37.05995 38.0 38.0 38.0 36.0 38.0 30-34 37.0157 38.0 38.0 38.0 35.8 38.0 35-39 36.827099999999994 38.0 38.0 38.0 35.2 38.0 40-44 36.8607 38.0 38.0 38.0 35.2 38.0 45-49 36.807700000000004 38.0 38.0 38.0 35.0 38.0 50-54 36.6512 38.0 38.0 38.0 34.2 38.0 55-59 36.51275 38.0 38.0 38.0 34.0 38.0 60-64 36.63249999999999 38.0 38.0 38.0 34.0 38.0 65-69 36.64465 38.0 38.0 38.0 34.0 38.0 70-74 36.508500000000005 38.0 37.8 38.0 34.0 38.0 75-79 35.8531 38.0 36.8 38.0 31.2 38.0 80-84 35.65405 38.0 36.8 38.0 30.2 38.0 85-89 35.75855 38.0 36.8 38.0 30.6 38.0 90-94 35.7587 38.0 36.8 38.0 31.0 38.0 95-99 35.64675 38.0 36.4 38.0 30.6 38.0 100-104 34.97775 38.0 35.4 38.0 27.6 38.0 105-109 34.77974999999999 38.0 35.0 38.0 26.6 38.0 110-114 34.7106 38.0 34.8 38.0 26.4 38.0 115-119 34.56815 38.0 34.8 38.0 26.4 38.0 120-124 34.328700000000005 38.0 34.2 38.0 24.4 38.0 125-129 33.88969999999999 38.0 33.8 38.0 21.6 38.0 130-134 33.6281 38.0 34.0 38.0 21.8 38.0 135-139 32.75865 37.2 32.6 38.0 14.8 38.0 140-144 32.0717 36.2 31.8 38.0 14.0 38.0 145-149 30.40395 36.0 29.4 38.0 8.6 38.0 150-151 25.133125 32.5 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 0.0 14 2.0 15 3.0 16 5.0 17 1.0 18 4.0 19 10.0 20 4.0 21 12.0 22 7.0 23 9.0 24 31.0 25 20.0 26 33.0 27 38.0 28 47.0 29 65.0 30 76.0 31 112.0 32 151.0 33 243.0 34 347.0 35 562.0 36 1218.0 37 995.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.197314049586778 47.985537190082646 1.6270661157024795 37.1900826446281 2 13.450000000000001 37.375 17.549999999999997 31.624999999999996 3 18.75 17.299999999999997 22.275 41.675000000000004 4 26.700000000000003 21.3 20.825 31.175000000000004 5 26.275 25.45 24.375 23.9 6 24.625 31.175000000000004 22.400000000000002 21.8 7 18.825 26.125 36.15 18.9 8 20.525 25.624999999999996 26.55 27.3 9 19.3 23.200000000000003 31.85 25.650000000000002 10-14 21.67 27.500000000000004 24.895 25.935000000000002 15-19 22.24 25.46 26.200000000000003 26.1 20-24 22.695 25.555 25.629999999999995 26.119999999999997 25-29 23.115 25.369999999999997 25.69 25.825 30-34 22.85 25.580000000000002 25.445 26.125 35-39 22.675 25.019999999999996 25.94 26.365 40-44 22.755 25.590000000000003 25.455 26.200000000000003 45-49 22.805 25.374999999999996 25.365 26.455000000000002 50-54 23.09 25.480000000000004 25.430000000000003 26.0 55-59 23.294999999999998 24.68 25.89 26.135 60-64 23.115 25.27 25.105 26.51 65-69 23.52 24.705 25.69 26.085 70-74 22.745 25.064999999999998 25.635 26.555 75-79 23.380000000000003 25.180000000000003 25.145 26.295 80-84 23.075000000000003 25.419999999999998 25.759999999999998 25.745 85-89 23.43 24.85 25.505 26.215 90-94 23.794999999999998 24.94 25.645 25.619999999999997 95-99 23.669999999999998 24.515 25.650000000000002 26.165 100-104 23.645 24.845 25.55 25.96 105-109 24.265 24.635 25.555 25.545 110-114 23.605 25.155 25.319999999999997 25.919999999999998 115-119 23.835 25.3 25.074999999999996 25.790000000000003 120-124 24.044999999999998 25.22 25.105 25.629999999999995 125-129 24.060000000000002 24.925 25.22 25.795 130-134 24.165 25.290000000000003 24.474999999999998 26.07 135-139 24.705 25.240000000000002 24.21 25.845000000000002 140-144 24.335 24.89 24.595 26.179999999999996 145-149 23.905 25.180000000000003 24.715 26.200000000000003 150-151 24.3 25.025 24.425 26.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 0.0 28 0.5 29 3.0 30 5.0 31 6.5 32 11.5 33 17.5 34 27.5 35 40.0 36 52.5 37 79.5 38 105.5 39 111.5 40 126.5 41 152.5 42 179.5 43 202.5 44 204.5 45 202.5 46 198.5 47 188.0 48 184.0 49 171.0 50 151.5 51 139.0 52 129.5 53 126.5 54 117.5 55 102.5 56 88.5 57 72.5 58 69.0 59 72.0 60 74.0 61 70.5 62 64.5 63 62.5 64 56.0 65 47.0 66 43.0 67 39.0 68 34.5 69 34.0 70 29.0 71 29.0 72 22.0 73 11.0 74 11.0 75 11.0 76 8.0 77 3.5 78 1.0 79 2.0 80 2.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69864389753893 99.25 2 0.22601707684580613 0.44999999999999996 3 0.025113008538422906 0.075 4 0.025113008538422906 0.1 5 0.025113008538422906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTACGTTATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.5499999999999998 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.7125000000000004 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.8625 0.0 0.0 0.0 0.0 124-125 4.4125 0.0 0.0 0.0 0.0 126-127 5.0375 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 6.0 0.0 0.0 0.0 0.0 132-133 6.55 0.0 0.0 0.0 0.0 134-135 7.125 0.0 0.0 0.0 0.0 136-137 7.9375 0.0 0.0 0.0 0.0 138-139 8.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCCTT 10 0.006577216 146.82278 1 TCAATGT 10 0.006832588 144.9875 9 CATCATA 20 3.5889345E-4 108.74062 5 CCATCAT 20 3.5889345E-4 108.74062 4 >>END_MODULE SRR6958257 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958257_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4055 33.0 33.0 34.0 32.0 34.0 2 32.46475 33.0 33.0 34.0 32.0 34.0 3 32.44325 33.0 33.0 34.0 31.0 34.0 4 32.382 33.0 33.0 34.0 31.0 34.0 5 32.3515 33.0 33.0 34.0 31.0 34.0 6 36.21075 38.0 38.0 38.0 33.0 38.0 7 36.3945 38.0 38.0 38.0 34.0 38.0 8 36.1485 38.0 38.0 38.0 33.0 38.0 9 36.1525 38.0 38.0 38.0 33.0 38.0 10-14 36.1854 38.0 38.0 38.0 33.4 38.0 15-19 36.3375 38.0 38.0 38.0 34.0 38.0 20-24 36.384899999999995 38.0 38.0 38.0 34.2 38.0 25-29 36.409349999999996 38.0 38.0 38.0 34.2 38.0 30-34 36.3671 38.0 38.0 38.0 34.4 38.0 35-39 36.220349999999996 38.0 38.0 38.0 33.8 38.0 40-44 36.03805 38.0 38.0 38.0 33.2 38.0 45-49 35.87575 38.0 38.0 38.0 32.2 38.0 50-54 36.038349999999994 38.0 38.0 38.0 33.2 38.0 55-59 36.08415 38.0 38.0 38.0 33.4 38.0 60-64 35.932599999999994 38.0 38.0 38.0 33.0 38.0 65-69 35.75325 38.0 37.6 38.0 31.8 38.0 70-74 35.66895000000001 38.0 37.0 38.0 31.0 38.0 75-79 35.43675 38.0 37.0 38.0 29.6 38.0 80-84 35.478300000000004 38.0 37.0 38.0 30.2 38.0 85-89 35.36075 38.0 37.0 38.0 29.6 38.0 90-94 35.2622 38.0 37.0 38.0 29.4 38.0 95-99 35.07185 38.0 36.4 38.0 28.4 38.0 100-104 34.78 38.0 35.6 38.0 27.0 38.0 105-109 34.4585 38.0 35.0 38.0 25.4 38.0 110-114 34.28009999999999 38.0 35.0 38.0 24.0 38.0 115-119 34.03775 38.0 34.8 38.0 23.0 38.0 120-124 33.7711 38.0 34.2 38.0 21.8 38.0 125-129 33.37689999999999 38.0 34.0 38.0 18.6 38.0 130-134 32.91135 38.0 33.8 38.0 14.6 38.0 135-139 32.431200000000004 38.0 33.0 38.0 14.0 38.0 140-144 31.5019 37.0 31.4 38.0 13.2 38.0 145-149 30.1291 36.0 29.8 38.0 6.4 38.0 150-151 24.777124999999998 32.5 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 7.0 4 4.0 5 4.0 6 3.0 7 3.0 8 5.0 9 1.0 10 3.0 11 6.0 12 3.0 13 4.0 14 4.0 15 5.0 16 7.0 17 7.0 18 10.0 19 11.0 20 14.0 21 8.0 22 11.0 23 12.0 24 29.0 25 36.0 26 28.0 27 43.0 28 39.0 29 81.0 30 85.0 31 98.0 32 124.0 33 175.0 34 224.0 35 404.0 36 811.0 37 1665.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.724999999999994 19.225 13.125 29.925 2 29.214607303651825 24.312156078039017 25.63781890945473 20.83541770885443 3 22.961480740370185 26.463231615807903 27.363681840920464 23.21160580290145 4 26.988494247123562 28.73936968484242 21.210605302651324 23.06153076538269 5 28.489244622311155 31.315657828914457 19.35967983991996 20.83541770885443 6 24.087043521760883 35.467733866933465 19.909954977488745 20.535267633816908 7 23.1615807903952 20.185092546273136 33.11655827913957 23.536768384192097 8 24.137068534267133 23.911955977988995 23.461730865432717 28.489244622311155 9 24.95 23.625 26.25 25.174999999999997 10-14 26.09304652326163 26.128064032016006 23.1615807903952 24.617308654327164 15-19 26.8384192096048 25.532766383191596 23.901950975487743 23.72686343171586 20-24 26.176779550797857 25.371417137711973 24.070831874343455 24.380971437146716 25-29 25.94037615046018 24.964985994397757 24.689875950380152 24.404761904761905 30-34 25.631534190385675 24.876194287429342 24.886198789455253 24.60607273272973 35-39 26.375550220088034 25.52521008403361 24.18467386954782 23.914565826330534 40-44 26.205000000000002 25.009999999999998 23.89 24.895 45-49 26.183927589138374 25.288793318997847 24.108616292443866 24.418662799419913 50-54 26.57297189156747 24.98249474842453 24.67740322096629 23.76713013904171 55-59 26.320528211284515 25.240096038415366 24.439775910364144 23.999599839935975 60-64 26.498249124562278 25.127563781890945 24.447223611805903 23.92696348174087 65-69 26.400560224089638 25.170068027210885 24.264705882352942 24.16466586634654 70-74 26.427928378513556 25.31259377813344 24.487346203861158 23.772131639491846 75-79 26.098049024512253 25.372686343171587 24.732366183091546 23.796898449224614 80-84 26.387638763876385 25.662566256625663 24.242424242424242 23.707370737073706 85-89 26.708012403721114 24.812443733119935 24.492347704311292 23.987196158847652 90-94 26.05042016806723 24.884953981592638 25.135054021608642 23.92957182873149 95-99 26.464262491872155 25.568949132196266 24.513579752913518 23.453208623018057 100-104 26.255502200880354 25.140056022408963 25.090036014405765 23.51440576230492 105-109 26.791697924481124 25.646411602900727 24.571142785696424 22.99074768692173 110-114 27.0717679419855 24.901225306326584 24.681170292573142 23.34583645911478 115-119 27.11177794448612 25.936484121030258 24.20605151287822 22.745686421605402 120-124 27.077707770777078 25.91259125912591 23.817381738173818 23.192319231923193 125-129 26.974999999999998 25.515 24.435000000000002 23.075000000000003 130-134 27.450000000000003 25.790000000000003 24.21 22.55 135-139 27.532753275327533 25.90759075907591 24.837483748374837 21.722172217221722 140-144 28.132813281328133 25.997599759975998 24.362436243624362 21.507150715071507 145-149 28.012003000750184 25.571392848212053 24.566141535383846 21.850462615653914 150-151 29.35733933483371 25.35633908477119 24.143535883970994 21.142785696424106 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 2.0 29 2.5 30 5.5 31 13.5 32 13.0 33 10.5 34 18.0 35 24.5 36 37.0 37 54.5 38 75.5 39 101.0 40 109.0 41 118.5 42 141.5 43 164.0 44 184.5 45 197.0 46 198.5 47 195.0 48 204.0 49 189.5 50 164.5 51 154.0 52 146.5 53 129.0 54 103.0 55 97.5 56 95.5 57 87.5 58 83.0 59 75.5 60 71.5 61 80.0 62 79.5 63 69.0 64 67.5 65 56.0 66 47.0 67 55.0 68 43.5 69 32.0 70 43.5 71 42.5 72 28.5 73 27.5 74 19.5 75 7.5 76 8.0 77 6.5 78 3.5 79 3.0 80 2.5 81 1.5 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.0 10-14 0.05 15-19 0.05 20-24 0.045 25-29 0.04 30-34 0.045 35-39 0.04 40-44 0.0 45-49 0.015 50-54 0.03 55-59 0.04 60-64 0.05 65-69 0.04 70-74 0.03 75-79 0.05 80-84 0.01 85-89 0.03 90-94 0.04 95-99 0.034999999999999996 100-104 0.04 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.01 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59778783308195 99.05000000000001 2 0.32679738562091504 0.65 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.025138260432378077 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCTACGTTGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.35 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.975 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.5625 0.0 0.0 0.0 0.0 134-135 7.1125 0.0 0.0 0.0 0.0 136-137 7.8999999999999995 0.0 0.0 0.0 0.0 138-139 8.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750598 spots for SRR6958257.sra Written 750598 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra Read 750585 spots for SRR6958257.sra Written 750585 spots for SRR6958257.sra SRR ids: ['SRR6958257.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_946z1apl SRR6958257.sra spots: 15011713 blocks: [[1, 750585], [750586, 1501170], [1501171, 2251755], [2251756, 3002340], [3002341, 3752925], [3752926, 4503510], [4503511, 5254095], [5254096, 6004680], [6004681, 6755265], [6755266, 7505850], [7505851, 8256435], [8256436, 9007020], [9007021, 9757605], [9757606, 10508190], [10508191, 11258775], [11258776, 12009360], [12009361, 12759945], [12759946, 13510530], [13510531, 14261115], [14261116, 15011713]] SRR6958257 file size 5065276 SRR6958257 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958257 SRR6958257_1.fastq SRR6958257_2.fastq Input file: SRR6958257_1.fastq Paired file: SRR6958257_2.fastq trimmed: SRR6958257-trimmed-pair1.fastq, SRR6958257-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:49:41 2024 >> started Fri Dec 6 17:49:58 2024 >> done (17.339s) 15011713 read pairs processed; of these: 29700 ( 0.20%) short read pairs filtered out after trimming by size control 55811 ( 0.37%) empty read pairs filtered out after trimming by size control 14926202 (99.43%) read pairs available; of these: 6972447 (46.71%) trimmed read pairs available after processing 7953755 (53.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 2 0.00% 24 5 0.00% 25 2 0.00% 26 5 0.00% 27 2 0.00% 28 1 0.00% 29 4 0.00% 30 5 0.00% 31 7 0.00% 32 7 0.00% 33 12 0.00% 34 5 0.00% 35 9 0.00% 36 9 0.00% 37 11 0.00% 38 10 0.00% 39 10 0.00% 40 9 0.00% 41 20 0.00% 42 16 0.00% 43 20 0.00% 44 15 0.00% 45 24 0.00% 46 23 0.00% 47 23 0.00% 48 27 0.00% 49 34 0.00% 50 36 0.00% 51 36 0.00% 52 48 0.00% 53 45 0.00% 54 56 0.00% 55 62 0.00% 56 78 0.00% 57 83 0.00% 58 106 0.00% 59 134 0.00% 60 139 0.00% 61 134 0.00% 62 160 0.00% 63 182 0.00% 64 215 0.00% 65 246 0.00% 66 238 0.00% 67 291 0.00% 68 333 0.00% 69 368 0.00% 70 438 0.00% 71 497 0.00% 72 551 0.00% 73 684 0.00% 74 743 0.00% 75 798 0.01% 76 958 0.01% 77 1115 0.01% 78 1195 0.01% 79 1426 0.01% 80 1506 0.01% 81 1843 0.01% 82 2111 0.01% 83 2494 0.02% 84 3580 0.02% 85 4441 0.03% 86 4520 0.03% 87 4885 0.03% 88 5381 0.04% 89 5724 0.04% 90 5938 0.04% 91 6633 0.04% 92 6953 0.05% 93 7858 0.05% 94 8409 0.06% 95 9094 0.06% 96 9894 0.07% 97 10679 0.07% 98 11356 0.08% 99 12089 0.08% 100 13102 0.09% 101 14039 0.09% 102 14925 0.10% 103 15994 0.11% 104 17700 0.12% 105 18456 0.12% 106 20009 0.13% 107 20872 0.14% 108 22079 0.15% 109 23110 0.15% 110 24770 0.17% 111 25503 0.17% 112 27569 0.18% 113 29018 0.19% 114 30832 0.21% 115 32791 0.22% 116 34241 0.23% 117 35468 0.24% 118 37079 0.25% 119 38346 0.26% 120 39340 0.26% 121 40864 0.27% 122 42920 0.29% 123 44918 0.30% 124 47528 0.32% 125 49206 0.33% 126 51015 0.34% 127 53318 0.36% 128 54497 0.37% 129 56409 0.38% 130 58428 0.39% 131 60450 0.40% 132 62539 0.42% 133 65653 0.44% 134 68693 0.46% 135 71541 0.48% 136 74718 0.50% 137 77620 0.52% 138 80792 0.54% 139 84679 0.57% 140 88636 0.59% 141 94302 0.63% 142 101344 0.68% 143 111606 0.75% 144 125078 0.84% 145 143613 0.96% 146 170934 1.15% 147 219512 1.47% 148 316863 2.12% 149 627717 4.21% 150 3154701 21.14% 151 7953755 53.29% 14926202 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=18 prefix-density=0.38 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=22 fanout-score=45.02 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=10.4 sequence=GGCGGCGGCGGCCTCGAAGCCTGACTTGGTCGCCGGCGGCGCAACGCCCATGACGAGTGTCTGGGAAGAAGTCGCCTCCTCGGCCATCATCTCTGGGTACAT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=12.04 fanout-score-rank=10 prefix-density=0.54 prefix-fanout=6.5 sequence=AAGATCAAGGAGAAGCTCCCTGGTGGTGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=140.48 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.9 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAG SRR6958257 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:50:39 Started mapping on | Dec 06 17:50:39 Finished on | Dec 06 17:52:02 Mapping speed, Million of reads per hour | 647.40 Number of input reads | 14926202 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14515400 Uniquely mapped reads % | 97.25% Average mapped length | 293.01 Number of splices: Total | 14859066 Number of splices: Annotated (sjdb) | 13918738 Number of splices: GT/AG | 14673037 Number of splices: GC/AG | 163042 Number of splices: AT/AC | 6631 Number of splices: Non-canonical | 16356 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 99824 % of reads mapped to multiple loci | 0.67% Number of reads mapped to too many loci | 15466 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 326397 326397 326397 N_multimapping 99824 99824 99824 N_noFeature 568473 14095235 709083 N_ambiguous 326192 1804 47347 UnstrandedReadsAssigned:13620735 PositiveStrandReadsAssigned:418361 NegativeStrandReadsAssigned:13758970 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6958257 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958257-trimmed-pair1.fastq SRR6958257-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,926,202 reads, 13,772,258 reads pseudoaligned [quant] estimated average fragment length: 233.462 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52973 SRR6958257.ke.tsv 35125 SRR6958257.se.tsv 88098 total ==> SRR6958257.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.854 111.078 16.1228 PNS24247 1044 811.538 26.1091 3.28683 PNS24249 1928 1695.54 86.8228 5.23144 PNS24246 1044 811.538 26.1091 3.28683 PNS24248 1044 811.538 26.1091 3.28683 PNS24244 1471 1238.54 66.7719 5.50782 PNS24243 293 98.9178 0 0 KQK14069 1603 1370.54 401.815 29.9523 KQK14071 474 250.374 13.241 5.40291 ==> SRR6958257.se.tsv <== BRADI_1g14170v3 475 BRADI_1g53295v3 372 BRADI_1g59795v3 175 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 441 BRADI_1g74790v3 535 BRADI_1g09890v3 0 BRADI_1g77505v3 170 BRADI_1g48960v3 0 SRR6958257 completed mapping pipeline successfully