Starting /dee2/code/volunteer_pipeline.sh SRR6958258 current disk space = 1550697476096 free memory = 1602349324 SRR6958258 SRAfilesize f7f38f18fee93b8b696d8b9e6e815ba1 SRR6958258.sra SRR6958258.sra file validated SRR6958258 is paired end SRR6958258 is conventional basespace SRR6958258 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958258_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.31975 33.0 31.0 33.0 18.0 34.0 2 31.93725 33.0 31.0 33.0 28.0 34.0 3 31.74725 33.0 31.0 33.0 28.0 34.0 4 32.531 33.0 33.0 34.0 32.0 34.0 5 32.4955 33.0 33.0 34.0 31.0 34.0 6 36.9485 38.0 37.0 38.0 35.0 38.0 7 37.2985 38.0 38.0 38.0 36.0 38.0 8 37.49375 38.0 38.0 38.0 37.0 38.0 9 37.4715 38.0 38.0 38.0 37.0 38.0 10-14 37.4022 38.0 38.0 38.0 37.0 38.0 15-19 37.4471 38.0 38.0 38.0 37.0 38.0 20-24 37.4964 38.0 38.0 38.0 37.4 38.0 25-29 37.37885 38.0 38.0 38.0 37.0 38.0 30-34 37.2617 38.0 38.0 38.0 36.8 38.0 35-39 37.0536 38.0 38.0 38.0 36.0 38.0 40-44 37.16605 38.0 38.0 38.0 36.2 38.0 45-49 37.162549999999996 38.0 38.0 38.0 36.2 38.0 50-54 37.103449999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.91215 38.0 38.0 38.0 35.4 38.0 60-64 37.011649999999996 38.0 38.0 38.0 35.6 38.0 65-69 36.993 38.0 38.0 38.0 35.2 38.0 70-74 37.051399999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.7453 38.0 38.0 38.0 34.6 38.0 80-84 36.4996 38.0 37.8 38.0 34.0 38.0 85-89 36.471149999999994 38.0 38.0 38.0 34.0 38.0 90-94 36.48395000000001 38.0 37.8 38.0 34.0 38.0 95-99 36.51635 38.0 38.0 38.0 34.0 38.0 100-104 36.2964 38.0 37.0 38.0 33.6 38.0 105-109 35.8959 38.0 36.6 38.0 31.8 38.0 110-114 35.74145 38.0 36.4 38.0 31.0 38.0 115-119 35.739799999999995 38.0 36.0 38.0 31.2 38.0 120-124 35.57765 38.0 36.0 38.0 30.6 38.0 125-129 35.0392 38.0 35.0 38.0 28.8 38.0 130-134 34.919900000000005 38.0 35.0 38.0 28.0 38.0 135-139 34.64545 38.0 35.0 38.0 27.2 38.0 140-144 34.2981 38.0 34.6 38.0 25.0 38.0 145-149 33.08055 38.0 33.8 38.0 18.6 38.0 150-151 28.682375 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 0.0 15 0.0 16 0.0 17 3.0 18 2.0 19 2.0 20 1.0 21 4.0 22 3.0 23 5.0 24 6.0 25 9.0 26 15.0 27 22.0 28 29.0 29 31.0 30 54.0 31 52.0 32 108.0 33 133.0 34 227.0 35 384.0 36 879.0 37 2027.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.17496151872756 9.235505387378144 7.28578758337609 42.30374551051821 2 22.625 12.425 37.4 27.55 3 21.5 13.725000000000001 26.375 38.4 4 26.3 23.35 22.1 28.249999999999996 5 25.374999999999996 29.075 24.325 21.224999999999998 6 23.825 31.15 22.525000000000002 22.5 7 18.85 24.725 38.15 18.275 8 21.8 24.3 28.375 25.525 9 20.05 23.1 33.35 23.5 10-14 23.315 26.27 25.919999999999998 24.495 15-19 22.93 25.0 26.46 25.61 20-24 23.25 25.545 26.36 24.845 25-29 23.305 25.405 25.990000000000002 25.3 30-34 23.26 25.035 26.36 25.345000000000002 35-39 23.215 25.430000000000003 25.965 25.39 40-44 22.645 25.205 26.345000000000002 25.805 45-49 22.79 24.709999999999997 26.865 25.635 50-54 22.650000000000002 25.3 26.355 25.695 55-59 23.14 25.119999999999997 26.13 25.61 60-64 23.41 24.875 25.679999999999996 26.035000000000004 65-69 22.945 25.295 26.07 25.69 70-74 23.645 25.264999999999997 25.974999999999998 25.115 75-79 23.235 25.174999999999997 26.115 25.474999999999998 80-84 22.865 24.995 26.0 26.14 85-89 23.885 24.48 25.86 25.775 90-94 23.57 25.085 25.990000000000002 25.355 95-99 23.07 24.959999999999997 25.790000000000003 26.179999999999996 100-104 23.525 24.845 26.055 25.575 105-109 23.535 24.815 25.665 25.985000000000003 110-114 23.26 24.57 26.040000000000003 26.13 115-119 23.905 25.095 25.35 25.650000000000002 120-124 23.715 25.245 25.03 26.009999999999998 125-129 23.445 24.675 25.835 26.045 130-134 24.195 25.069999999999997 24.97 25.765 135-139 23.97 24.695 25.235000000000003 26.1 140-144 24.395 25.555 24.605 25.445 145-149 23.630000000000003 24.87 25.34 26.16 150-151 23.72796599574947 23.75296912114014 26.490811351418923 26.02825353169146 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 2.0 29 2.5 30 5.5 31 10.5 32 14.0 33 21.5 34 28.5 35 31.0 36 41.5 37 60.5 38 75.5 39 108.5 40 150.5 41 172.5 42 176.0 43 179.0 44 198.5 45 209.5 46 201.5 47 187.0 48 185.5 49 188.5 50 169.0 51 147.0 52 133.5 53 124.0 54 106.0 55 95.0 56 99.0 57 103.5 58 95.5 59 77.0 60 74.5 61 68.0 62 61.5 63 61.5 64 52.5 65 42.0 66 37.5 67 36.0 68 33.5 69 29.5 70 25.0 71 21.0 72 15.5 73 10.0 74 7.5 75 5.0 76 4.5 77 4.5 78 1.5 79 1.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11683068382538 98.2 2 0.8327024981074944 1.6500000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7250000000000001 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.3 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.7 0.0 0.0 0.0 0.0 134-135 1.9625 0.0 0.0 0.0 0.0 136-137 2.2249999999999996 0.0 0.0 0.0 0.0 138-139 2.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGTTG 10 0.006832588 144.9875 3 >>END_MODULE SRR6958258 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958258_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.888 33.0 33.0 34.0 32.0 34.0 2 32.96775 34.0 33.0 34.0 32.0 34.0 3 32.952 34.0 33.0 34.0 32.0 34.0 4 32.98675 34.0 33.0 34.0 32.0 34.0 5 32.98125 34.0 33.0 34.0 32.0 34.0 6 37.026 38.0 38.0 38.0 36.0 38.0 7 37.00425 38.0 38.0 38.0 36.0 38.0 8 36.858 38.0 38.0 38.0 36.0 38.0 9 37.0405 38.0 38.0 38.0 36.0 38.0 10-14 36.87519999999999 38.0 38.0 38.0 35.8 38.0 15-19 36.88924999999999 38.0 38.0 38.0 36.0 38.0 20-24 36.86285 38.0 38.0 38.0 36.0 38.0 25-29 36.9865 38.0 38.0 38.0 36.0 38.0 30-34 36.97545 38.0 38.0 38.0 36.0 38.0 35-39 36.9333 38.0 38.0 38.0 36.0 38.0 40-44 36.8175 38.0 38.0 38.0 35.6 38.0 45-49 36.88635 38.0 38.0 38.0 36.0 38.0 50-54 36.804899999999996 38.0 38.0 38.0 35.6 38.0 55-59 36.7474 38.0 38.0 38.0 35.2 38.0 60-64 36.8027 38.0 38.0 38.0 35.2 38.0 65-69 36.6896 38.0 38.0 38.0 35.0 38.0 70-74 36.51825 38.0 38.0 38.0 34.4 38.0 75-79 36.2769 38.0 38.0 38.0 33.6 38.0 80-84 36.1463 38.0 37.8 38.0 33.2 38.0 85-89 36.118700000000004 38.0 37.8 38.0 33.4 38.0 90-94 36.05905 38.0 37.8 38.0 33.0 38.0 95-99 35.96374999999999 38.0 37.2 38.0 32.6 38.0 100-104 35.769999999999996 38.0 37.0 38.0 32.4 38.0 105-109 35.571600000000004 38.0 36.8 38.0 31.2 38.0 110-114 35.34255 38.0 36.0 38.0 29.8 38.0 115-119 35.00790000000001 38.0 35.6 38.0 28.0 38.0 120-124 34.92475 38.0 35.0 38.0 27.6 38.0 125-129 34.6134 38.0 35.0 38.0 26.8 38.0 130-134 34.157799999999995 38.0 34.4 38.0 24.0 38.0 135-139 33.7081 38.0 34.0 38.0 21.8 38.0 140-144 33.502750000000006 38.0 33.6 38.0 21.4 38.0 145-149 32.63 38.0 32.8 38.0 16.4 38.0 150-151 27.7875 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 2.0 5 1.0 6 3.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 4.0 13 0.0 14 3.0 15 4.0 16 2.0 17 2.0 18 2.0 19 3.0 20 7.0 21 4.0 22 4.0 23 15.0 24 16.0 25 12.0 26 17.0 27 25.0 28 31.0 29 56.0 30 45.0 31 89.0 32 104.0 33 135.0 34 217.0 35 363.0 36 814.0 37 2003.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.725 16.975 11.225 35.075 2 29.107276819204802 23.23080770192548 28.732183045761438 18.929732433108278 3 23.605901475368842 25.581395348837212 27.35683920980245 23.455863965991497 4 25.131282820705174 30.83270817704426 19.80495123780945 24.23105776444111 5 27.631907976994246 32.18304576144036 19.70492623155789 20.4801200300075 6 21.625 36.6 19.75 22.025 7 21.8 19.425 34.925 23.849999999999998 8 24.224999999999998 22.875 24.625 28.275 9 24.349999999999998 21.7 28.000000000000004 25.95 10-14 26.419999999999998 26.02 22.625 24.935 15-19 25.3 25.569999999999997 24.48 24.65 20-24 25.485000000000003 25.91 23.855 24.75 25-29 25.924999999999997 25.895000000000003 23.945 24.235 30-34 25.285000000000004 25.650000000000002 24.685000000000002 24.38 35-39 25.580000000000002 25.435000000000002 24.18 24.805 40-44 25.395 25.124999999999996 24.25 25.230000000000004 45-49 25.495 24.945 25.03 24.529999999999998 50-54 25.77 26.005 23.915 24.310000000000002 55-59 26.355 25.259999999999998 23.925 24.46 60-64 25.540000000000003 25.14 24.8 24.52 65-69 25.335 25.629999999999995 25.0 24.035 70-74 25.91 25.465 23.995 24.63 75-79 26.265 25.28 24.47 23.985 80-84 26.035000000000004 25.974999999999998 24.455 23.535 85-89 25.740000000000002 24.9 24.715 24.645 90-94 25.845000000000002 25.515 24.92 23.72 95-99 25.97 25.590000000000003 24.505 23.935000000000002 100-104 25.69 25.650000000000002 24.705 23.955000000000002 105-109 25.81 25.21 25.085 23.895 110-114 25.615 25.66 24.610000000000003 24.115000000000002 115-119 26.005 25.6 24.285 24.11 120-124 26.265 25.740000000000002 24.585 23.41 125-129 26.395000000000003 25.650000000000002 24.445 23.51 130-134 26.700000000000003 25.385 24.5 23.415 135-139 25.575 26.3 24.72 23.405 140-144 26.479999999999997 25.505 24.27 23.745 145-149 26.490000000000002 25.275 24.5 23.735 150-151 25.55319414926866 25.29066133266658 25.778222277784725 23.377922240280036 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 0.5 27 1.5 28 2.5 29 2.0 30 3.0 31 5.5 32 10.5 33 14.5 34 20.5 35 25.0 36 38.5 37 55.0 38 70.0 39 92.0 40 122.5 41 134.5 42 152.5 43 177.0 44 185.0 45 190.5 46 196.0 47 207.5 48 196.5 49 167.5 50 160.5 51 162.0 52 140.5 53 114.5 54 97.0 55 93.5 56 95.0 57 101.0 58 95.0 59 94.0 60 91.0 61 81.5 62 79.5 63 71.0 64 63.5 65 53.0 66 47.5 67 47.5 68 52.0 69 53.0 70 42.0 71 28.0 72 18.5 73 17.5 74 13.0 75 6.5 76 3.5 77 3.0 78 2.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11504424778761 98.0 2 0.7332490518331226 1.4500000000000002 3 0.1011378002528445 0.3 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.025284450063211124 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7250000000000001 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.3 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.7 0.0 0.0 0.0 0.0 134-135 1.95 0.0 0.0 0.0 0.0 136-137 2.1875 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0035366106 20.714287 30-34 >>END_MODULE Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081990 spots for SRR6958258.sra Written 1081990 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra Read 1081987 spots for SRR6958258.sra Written 1081987 spots for SRR6958258.sra SRR ids: ['SRR6958258.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rd31dlut SRR6958258.sra spots: 21639743 blocks: [[1, 1081987], [1081988, 2163974], [2163975, 3245961], [3245962, 4327948], [4327949, 5409935], [5409936, 6491922], [6491923, 7573909], [7573910, 8655896], [8655897, 9737883], [9737884, 10819870], [10819871, 11901857], [11901858, 12983844], [12983845, 14065831], [14065832, 15147818], [15147819, 16229805], [16229806, 17311792], [17311793, 18393779], [18393780, 19475766], [19475767, 20557753], [20557754, 21639743]] SRR6958258 file size 7311298 SRR6958258 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958258 SRR6958258_1.fastq SRR6958258_2.fastq Input file: SRR6958258_1.fastq Paired file: SRR6958258_2.fastq trimmed: SRR6958258-trimmed-pair1.fastq, SRR6958258-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:51:25 2024 >> started Fri Dec 6 17:51:49 2024 >> done (24.189s) 21639743 read pairs processed; of these: 13342 ( 0.06%) short read pairs filtered out after trimming by size control 9493 ( 0.04%) empty read pairs filtered out after trimming by size control 21616908 (99.89%) read pairs available; of these: 7795291 (36.06%) trimmed read pairs available after processing 13821617 (63.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 5 0.00% 21 3 0.00% 22 0 0.00% 23 6 0.00% 24 8 0.00% 25 4 0.00% 26 6 0.00% 27 7 0.00% 28 5 0.00% 29 5 0.00% 30 8 0.00% 31 9 0.00% 32 8 0.00% 33 6 0.00% 34 3 0.00% 35 8 0.00% 36 6 0.00% 37 7 0.00% 38 12 0.00% 39 15 0.00% 40 16 0.00% 41 8 0.00% 42 14 0.00% 43 10 0.00% 44 19 0.00% 45 15 0.00% 46 18 0.00% 47 15 0.00% 48 15 0.00% 49 30 0.00% 50 19 0.00% 51 37 0.00% 52 37 0.00% 53 43 0.00% 54 40 0.00% 55 53 0.00% 56 37 0.00% 57 54 0.00% 58 69 0.00% 59 64 0.00% 60 76 0.00% 61 82 0.00% 62 99 0.00% 63 122 0.00% 64 126 0.00% 65 135 0.00% 66 148 0.00% 67 192 0.00% 68 208 0.00% 69 202 0.00% 70 223 0.00% 71 274 0.00% 72 310 0.00% 73 350 0.00% 74 381 0.00% 75 390 0.00% 76 480 0.00% 77 543 0.00% 78 632 0.00% 79 660 0.00% 80 760 0.00% 81 857 0.00% 82 965 0.00% 83 1077 0.00% 84 1883 0.01% 85 2262 0.01% 86 2299 0.01% 87 2484 0.01% 88 2633 0.01% 89 2718 0.01% 90 2885 0.01% 91 3065 0.01% 92 3283 0.02% 93 3400 0.02% 94 3739 0.02% 95 4080 0.02% 96 4199 0.02% 97 4629 0.02% 98 4856 0.02% 99 5154 0.02% 100 5612 0.03% 101 5860 0.03% 102 6340 0.03% 103 6778 0.03% 104 7285 0.03% 105 7696 0.04% 106 8198 0.04% 107 8806 0.04% 108 9283 0.04% 109 9995 0.05% 110 10790 0.05% 111 11145 0.05% 112 12236 0.06% 113 12863 0.06% 114 13563 0.06% 115 14853 0.07% 116 15580 0.07% 117 16357 0.08% 118 17642 0.08% 119 18153 0.08% 120 19356 0.09% 121 20095 0.09% 122 21389 0.10% 123 22478 0.10% 124 23924 0.11% 125 25268 0.12% 126 26708 0.12% 127 28317 0.13% 128 29808 0.14% 129 31493 0.15% 130 33307 0.15% 131 35452 0.16% 132 37886 0.18% 133 40492 0.19% 134 43114 0.20% 135 46284 0.21% 136 49503 0.23% 137 53352 0.25% 138 57114 0.26% 139 61983 0.29% 140 67410 0.31% 141 74433 0.34% 142 84124 0.39% 143 95359 0.44% 144 112570 0.52% 145 136457 0.63% 146 172559 0.80% 147 238335 1.10% 148 376540 1.74% 149 785576 3.63% 150 4661955 21.57% 151 13821617 63.94% 21616908 reads passed initial QC criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=20 prefix-density=1.18 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=46.78 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=15 prefix-density=0.88 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=19.99 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.9 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958258 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:52:40 Started mapping on | Dec 06 17:52:40 Finished on | Dec 06 17:54:29 Mapping speed, Million of reads per hour | 713.95 Number of input reads | 21616908 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21246321 Uniquely mapped reads % | 98.29% Average mapped length | 297.96 Number of splices: Total | 25553922 Number of splices: Annotated (sjdb) | 24185644 Number of splices: GT/AG | 25220045 Number of splices: GC/AG | 297701 Number of splices: AT/AC | 9309 Number of splices: Non-canonical | 26867 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161522 % of reads mapped to multiple loci | 0.75% Number of reads mapped to too many loci | 11115 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 217840 217840 217840 N_multimapping 161522 161522 161522 N_noFeature 558756 20662477 706975 N_ambiguous 518081 2575 84246 UnstrandedReadsAssigned:20169484 PositiveStrandReadsAssigned:581269 NegativeStrandReadsAssigned:20455100 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958258 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958258-trimmed-pair1.fastq SRR6958258-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,616,908 reads, 20,439,227 reads pseudoaligned [quant] estimated average fragment length: 273.89 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR6958258.ke.tsv 35125 SRR6958258.se.tsv 88098 total ==> SRR6958258.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.523 5.82925e-06 6.25501e-07 PNS24247 1044 771.11 53.4592 4.93602 PNS24249 1928 1655.11 39.1351 1.68349 PNS24246 1044 771.11 53.4592 4.93602 PNS24248 1044 771.11 53.4592 4.93602 PNS24244 1471 1198.11 18.4872 1.09862 PNS24243 293 76.5699 0 0 KQK14069 1603 1330.11 5507.09 294.785 KQK14071 474 215.514 52.2504 17.2617 ==> SRR6958258.se.tsv <== BRADI_1g14170v3 5950 BRADI_1g53295v3 201 BRADI_1g59795v3 197 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 258 BRADI_1g74790v3 120 BRADI_1g09890v3 0 BRADI_1g77505v3 226 BRADI_1g48960v3 0 SRR6958258 completed mapping pipeline successfully