Starting /dee2/code/volunteer_pipeline.sh SRR6958259 current disk space = 1550551310336 free memory = 1597954928 SRR6958259 SRAfilesize 9520719052098c8b757a7be270afcef4 SRR6958259.sra SRR6958259.sra file validated SRR6958259 is paired end SRR6958259 is conventional basespace SRR6958259 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958259_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.36625 30.0 18.0 33.0 18.0 33.0 2 25.46075 27.0 18.0 31.0 18.0 33.0 3 28.9485 29.0 27.0 31.0 25.0 33.0 4 27.46625 29.0 25.0 31.0 15.0 33.0 5 31.0215 33.0 30.0 33.0 28.0 33.0 6 36.39025 38.0 37.0 38.0 34.0 38.0 7 37.0345 38.0 38.0 38.0 36.0 38.0 8 37.17325 38.0 38.0 38.0 36.0 38.0 9 37.18925 38.0 38.0 38.0 36.0 38.0 10-14 37.282650000000004 38.0 38.0 38.0 36.6 38.0 15-19 37.262649999999994 38.0 38.0 38.0 36.4 38.0 20-24 37.40845 38.0 38.0 38.0 37.0 38.0 25-29 37.3554 38.0 38.0 38.0 37.0 38.0 30-34 37.11815 38.0 38.0 38.0 36.4 38.0 35-39 37.1579 38.0 38.0 38.0 36.2 38.0 40-44 36.958400000000005 38.0 38.0 38.0 35.6 38.0 45-49 37.196999999999996 38.0 38.0 38.0 36.2 38.0 50-54 37.1827 38.0 38.0 38.0 36.4 38.0 55-59 36.74335 38.0 38.0 38.0 34.4 38.0 60-64 36.2887 38.0 37.2 38.0 33.2 38.0 65-69 36.026349999999994 38.0 37.0 38.0 31.8 38.0 70-74 36.038199999999996 38.0 37.0 38.0 32.0 38.0 75-79 36.36409999999999 38.0 37.0 38.0 33.6 38.0 80-84 36.41135 38.0 37.6 38.0 33.6 38.0 85-89 36.01415000000001 38.0 37.0 38.0 32.2 38.0 90-94 36.1787 38.0 37.0 38.0 33.0 38.0 95-99 35.95055 38.0 36.6 38.0 31.6 38.0 100-104 35.52445 38.0 36.0 38.0 29.4 38.0 105-109 35.11635 38.0 35.4 38.0 28.2 38.0 110-114 34.42515 38.0 34.6 38.0 25.2 38.0 115-119 33.6265 37.8 33.6 38.0 20.6 38.0 120-124 33.7331 37.8 33.8 38.0 22.2 38.0 125-129 34.242599999999996 38.0 34.2 38.0 24.4 38.0 130-134 34.4325 38.0 34.6 38.0 26.0 38.0 135-139 34.252250000000004 38.0 34.2 38.0 25.0 38.0 140-144 33.228 38.0 33.6 38.0 18.6 38.0 145-149 31.77045 36.4 31.8 38.0 11.4 38.0 150-151 26.996125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 0.0 18 2.0 19 1.0 20 4.0 21 3.0 22 5.0 23 11.0 24 13.0 25 13.0 26 30.0 27 29.0 28 34.0 29 54.0 30 70.0 31 94.0 32 162.0 33 212.0 34 369.0 35 556.0 36 1201.0 37 1134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.28234031132582 7.675791733762748 7.9173376274825555 36.12453032742888 2 29.599999999999998 11.774999999999999 32.375 26.25 3 22.125 17.5 22.650000000000002 37.724999999999994 4 27.950000000000003 24.175 21.7 26.174999999999997 5 25.55638909727432 30.107526881720432 23.1807951987997 21.155288822205552 6 20.5 32.525 24.65 22.325 7 16.025 23.7 42.375 17.9 8 20.65 24.05 28.525 26.775 9 19.225 21.55 34.375 24.85 10-14 22.264999999999997 27.075 25.990000000000002 24.67 15-19 22.705000000000002 26.229999999999997 26.479999999999997 24.585 20-24 22.24 26.22 26.685 24.855 25-29 22.89 26.21 25.91 24.990000000000002 30-34 21.895 25.915 26.945000000000004 25.245 35-39 22.74 25.775 26.424999999999997 25.06 40-44 22.715 26.240000000000002 25.955000000000002 25.09 45-49 22.830000000000002 25.64 26.365 25.165 50-54 21.94 26.165 26.450000000000003 25.445 55-59 22.595000000000002 26.57 25.905 24.93 60-64 22.235 26.064999999999998 25.69 26.009999999999998 65-69 22.384999999999998 26.68 26.105 24.83 70-74 22.48 26.064999999999998 26.200000000000003 25.255 75-79 22.57 26.51 25.779999999999998 25.14 80-84 22.435 26.064999999999998 26.58 24.92 85-89 22.785 25.874999999999996 26.025 25.314999999999998 90-94 22.7 26.005 26.21 25.085 95-99 22.615 25.885 26.515 24.985 100-104 22.965 26.064999999999998 25.569999999999997 25.4 105-109 22.52 26.07 26.25 25.16 110-114 22.705000000000002 25.545 26.63 25.119999999999997 115-119 22.705000000000002 25.385 26.22 25.69 120-124 23.05 25.569999999999997 26.38 25.0 125-129 22.869999999999997 26.179999999999996 26.200000000000003 24.75 130-134 22.82 26.740000000000002 25.430000000000003 25.009999999999998 135-139 22.62 26.08 25.955000000000002 25.345000000000002 140-144 22.470000000000002 26.44 25.855 25.235000000000003 145-149 22.99 25.69 26.169999999999998 25.15 150-151 23.6125 24.675 25.587500000000002 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 2.0 28 5.0 29 6.0 30 6.5 31 13.5 32 19.0 33 26.5 34 39.0 35 39.5 36 47.0 37 70.0 38 97.5 39 122.0 40 144.0 41 159.5 42 185.5 43 211.0 44 220.0 45 216.0 46 210.5 47 206.0 48 197.5 49 187.5 50 171.0 51 162.0 52 151.5 53 137.5 54 109.5 55 101.0 56 88.0 57 62.0 58 65.5 59 59.0 60 44.0 61 45.0 62 41.0 63 32.5 64 39.0 65 46.5 66 45.5 67 37.5 68 26.5 69 21.5 70 19.5 71 19.0 72 13.5 73 7.5 74 5.5 75 2.0 76 4.0 77 5.0 78 1.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.8500000000000005 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.45 0.0 0.0 0.0 0.0 124-125 1.8625 0.0 0.0 0.0 0.0 126-127 2.15 0.0 0.0 0.0 0.0 128-129 2.4 0.0 0.0 0.0 0.0 130-131 2.6375 0.0 0.0 0.0 0.0 132-133 2.9000000000000004 0.0 0.0 0.0 0.0 134-135 3.1500000000000004 0.0 0.0 0.0 0.0 136-137 3.5625 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCAGC 10 0.006843168 144.91249 6 >>END_MODULE SRR6958259 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958259_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.901 33.0 33.0 34.0 32.0 34.0 2 32.9465 33.0 33.0 34.0 32.0 34.0 3 32.8755 34.0 33.0 34.0 32.0 34.0 4 32.8495 34.0 33.0 34.0 32.0 34.0 5 32.86825 34.0 33.0 34.0 32.0 34.0 6 37.0375 38.0 38.0 38.0 36.0 38.0 7 36.7465 38.0 38.0 38.0 35.0 38.0 8 36.81575 38.0 38.0 38.0 35.0 38.0 9 36.91525 38.0 38.0 38.0 36.0 38.0 10-14 36.8377 38.0 38.0 38.0 35.4 38.0 15-19 36.901599999999995 38.0 38.0 38.0 36.0 38.0 20-24 36.97859999999999 38.0 38.0 38.0 35.8 38.0 25-29 36.914100000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.703 38.0 38.0 38.0 35.0 38.0 35-39 36.677150000000005 38.0 38.0 38.0 34.8 38.0 40-44 36.54665 38.0 38.0 38.0 34.4 38.0 45-49 36.64695 38.0 38.0 38.0 35.0 38.0 50-54 36.48745 38.0 38.0 38.0 34.4 38.0 55-59 36.57015 38.0 38.0 38.0 34.8 38.0 60-64 36.43300000000001 38.0 38.0 38.0 33.8 38.0 65-69 36.500099999999996 38.0 38.0 38.0 34.0 38.0 70-74 36.42380000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.237849999999995 38.0 37.6 38.0 33.6 38.0 80-84 36.11325 38.0 37.4 38.0 33.0 38.0 85-89 36.021 38.0 37.4 38.0 33.0 38.0 90-94 36.0753 38.0 37.4 38.0 33.2 38.0 95-99 35.90984999999999 38.0 37.2 38.0 32.4 38.0 100-104 35.4522 38.0 36.4 38.0 30.0 38.0 105-109 34.8982 38.0 35.6 38.0 27.4 38.0 110-114 34.34835 38.0 34.6 38.0 23.4 38.0 115-119 34.36215 38.0 34.6 38.0 24.6 38.0 120-124 34.05649999999999 38.0 34.2 38.0 23.0 38.0 125-129 33.1452 37.8 33.4 38.0 17.4 38.0 130-134 32.410000000000004 37.0 32.2 38.0 14.4 38.0 135-139 31.172749999999997 35.6 29.2 38.0 13.8 38.0 140-144 30.882500000000004 35.4 28.6 38.0 13.2 38.0 145-149 30.4313 35.6 29.8 38.0 8.6 38.0 150-151 25.691875000000003 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 1.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 2.0 13 7.0 14 2.0 15 2.0 16 4.0 17 3.0 18 2.0 19 8.0 20 9.0 21 17.0 22 12.0 23 11.0 24 21.0 25 28.0 26 33.0 27 41.0 28 40.0 29 58.0 30 68.0 31 102.0 32 153.0 33 180.0 34 293.0 35 471.0 36 937.0 37 1478.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.05 19.125 12.325 31.5 2 29.675 23.9 28.175 18.25 3 21.65 27.05 27.825 23.474999999999998 4 26.875 31.974999999999998 19.775000000000002 21.375 5 27.1 34.300000000000004 19.0 19.6 6 21.95 35.65 21.349999999999998 21.05 7 21.725 19.55 36.225 22.5 8 22.6 25.424999999999997 25.0 26.974999999999998 9 22.825 23.45 28.725 25.0 10-14 26.0 26.985 23.669999999999998 23.345 15-19 24.98 26.534999999999997 24.855 23.630000000000003 20-24 25.295 26.045 25.405 23.255 25-29 25.814999999999998 26.185000000000002 25.064999999999998 22.935 30-34 25.285000000000004 26.495 25.235000000000003 22.985 35-39 24.87 26.445 25.44 23.244999999999997 40-44 25.205 25.705 25.16 23.93 45-49 25.040000000000003 26.450000000000003 25.34 23.169999999999998 50-54 25.685000000000002 26.424999999999997 25.419999999999998 22.470000000000002 55-59 25.72 25.685000000000002 25.56 23.035 60-64 25.174999999999997 25.945 25.55 23.330000000000002 65-69 25.845000000000002 26.51 24.959999999999997 22.685 70-74 26.035000000000004 25.679999999999996 25.465 22.82 75-79 25.41 26.13 25.650000000000002 22.81 80-84 24.81 25.740000000000002 26.669999999999998 22.78 85-89 25.605 26.44 25.39 22.564999999999998 90-94 25.525 25.97 25.455 23.05 95-99 25.145 25.990000000000002 26.025 22.84 100-104 25.85 25.919999999999998 25.45 22.78 105-109 25.445 26.085 26.055 22.415 110-114 25.82 26.46 25.735000000000003 21.985 115-119 25.264999999999997 26.314999999999998 25.564999999999998 22.855 120-124 25.35 25.83 26.090000000000003 22.73 125-129 26.085 25.945 25.590000000000003 22.38 130-134 26.200000000000003 26.435 25.005 22.36 135-139 25.615 26.83 25.345000000000002 22.21 140-144 26.224999999999998 26.545 25.365 21.865000000000002 145-149 26.424999999999997 26.36 25.4 21.815 150-151 26.5 25.900000000000002 24.9375 22.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 3.0 26 3.5 27 2.0 28 3.0 29 7.0 30 10.5 31 10.5 32 14.5 33 19.5 34 23.5 35 37.5 36 56.5 37 71.0 38 86.5 39 108.0 40 135.0 41 156.5 42 171.0 43 187.0 44 207.5 45 227.0 46 227.5 47 204.0 48 187.0 49 190.0 50 178.5 51 155.0 52 144.5 53 133.0 54 115.5 55 95.5 56 81.0 57 70.5 58 61.5 59 64.0 60 67.0 61 63.0 62 56.5 63 49.5 64 45.5 65 42.0 66 33.0 67 27.0 68 25.5 69 27.0 70 23.5 71 20.0 72 22.0 73 16.0 74 9.5 75 7.5 76 4.5 77 3.0 78 2.5 79 2.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6499999999999999 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.425 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 2.125 0.0 0.0 0.0 0.0 128-129 2.375 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.9000000000000004 0.0 0.0 0.0 0.0 134-135 3.1500000000000004 0.0 0.0 0.0 0.0 136-137 3.5374999999999996 0.0 0.0 0.0 0.0 138-139 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTGT 10 0.006830828 145.0 145 AGGGAAA 20 0.00593511 29.0 135-139 GGAAAGA 20 0.00593511 29.0 140-144 >>END_MODULE Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878843 spots for SRR6958259.sra Written 878843 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra Read 878835 spots for SRR6958259.sra Written 878835 spots for SRR6958259.sra SRR ids: ['SRR6958259.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4sctncqy SRR6958259.sra spots: 17576708 blocks: [[1, 878835], [878836, 1757670], [1757671, 2636505], [2636506, 3515340], [3515341, 4394175], [4394176, 5273010], [5273011, 6151845], [6151846, 7030680], [7030681, 7909515], [7909516, 8788350], [8788351, 9667185], [9667186, 10546020], [10546021, 11424855], [11424856, 12303690], [12303691, 13182525], [13182526, 14061360], [14061361, 14940195], [14940196, 15819030], [15819031, 16697865], [16697866, 17576708]] SRR6958259 file size 5934469 SRR6958259 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958259 SRR6958259_1.fastq SRR6958259_2.fastq Input file: SRR6958259_1.fastq Paired file: SRR6958259_2.fastq trimmed: SRR6958259-trimmed-pair1.fastq, SRR6958259-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:55:13 2024 >> started Fri Dec 6 17:55:35 2024 >> done (22.372s) 17576708 read pairs processed; of these: 16262 ( 0.09%) short read pairs filtered out after trimming by size control 12766 ( 0.07%) empty read pairs filtered out after trimming by size control 17547680 (99.83%) read pairs available; of these: 7286705 (41.53%) trimmed read pairs available after processing 10260975 (58.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 2 0.00% 21 4 0.00% 22 2 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 5 0.00% 27 6 0.00% 28 5 0.00% 29 7 0.00% 30 6 0.00% 31 6 0.00% 32 12 0.00% 33 9 0.00% 34 7 0.00% 35 9 0.00% 36 12 0.00% 37 6 0.00% 38 8 0.00% 39 9 0.00% 40 8 0.00% 41 9 0.00% 42 15 0.00% 43 18 0.00% 44 16 0.00% 45 22 0.00% 46 20 0.00% 47 24 0.00% 48 26 0.00% 49 33 0.00% 50 38 0.00% 51 45 0.00% 52 40 0.00% 53 41 0.00% 54 33 0.00% 55 43 0.00% 56 48 0.00% 57 59 0.00% 58 63 0.00% 59 87 0.00% 60 98 0.00% 61 108 0.00% 62 141 0.00% 63 125 0.00% 64 143 0.00% 65 151 0.00% 66 186 0.00% 67 209 0.00% 68 216 0.00% 69 263 0.00% 70 285 0.00% 71 328 0.00% 72 375 0.00% 73 409 0.00% 74 502 0.00% 75 546 0.00% 76 539 0.00% 77 630 0.00% 78 653 0.00% 79 855 0.00% 80 914 0.01% 81 1006 0.01% 82 1235 0.01% 83 1407 0.01% 84 2218 0.01% 85 2643 0.02% 86 2787 0.02% 87 2910 0.02% 88 3112 0.02% 89 3112 0.02% 90 3455 0.02% 91 3718 0.02% 92 3939 0.02% 93 4173 0.02% 94 4778 0.03% 95 5002 0.03% 96 5290 0.03% 97 5655 0.03% 98 5992 0.03% 99 6409 0.04% 100 6982 0.04% 101 7357 0.04% 102 7864 0.04% 103 8601 0.05% 104 9010 0.05% 105 9692 0.06% 106 10248 0.06% 107 10806 0.06% 108 11501 0.07% 109 12085 0.07% 110 12569 0.07% 111 13612 0.08% 112 14569 0.08% 113 15417 0.09% 114 16586 0.09% 115 17344 0.10% 116 18466 0.11% 117 19374 0.11% 118 20368 0.12% 119 21377 0.12% 120 22141 0.13% 121 23367 0.13% 122 24604 0.14% 123 26764 0.15% 124 27714 0.16% 125 29995 0.17% 126 31250 0.18% 127 33142 0.19% 128 34451 0.20% 129 36787 0.21% 130 38982 0.22% 131 41098 0.23% 132 44622 0.25% 133 47917 0.27% 134 51384 0.29% 135 55692 0.32% 136 60718 0.35% 137 65293 0.37% 138 71740 0.41% 139 78873 0.45% 140 86677 0.49% 141 94981 0.54% 142 105381 0.60% 143 114131 0.65% 144 124080 0.71% 145 140024 0.80% 146 166756 0.95% 147 229601 1.31% 148 369857 2.11% 149 782277 4.46% 150 3885234 22.14% 151 10260975 58.47% 17547680 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.18 fanout-score-rank=22 prefix-density=0.35 prefix-fanout=3.7 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=41.79 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=11.6 sequence=AGCTTCTCCTTGATCTT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=22 prefix-density=0.39 prefix-fanout=3.0 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=49.86 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=4.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACT SRR6958259 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:56:28 Started mapping on | Dec 06 17:56:30 Finished on | Dec 06 17:57:46 Mapping speed, Million of reads per hour | 831.21 Number of input reads | 17547680 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17171190 Uniquely mapped reads % | 97.85% Average mapped length | 296.65 Number of splices: Total | 20249539 Number of splices: Annotated (sjdb) | 19158264 Number of splices: GT/AG | 20004159 Number of splices: GC/AG | 220494 Number of splices: AT/AC | 8512 Number of splices: Non-canonical | 16374 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 147333 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 15567 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 239543 239543 239543 N_multimapping 147333 147333 147333 N_noFeature 680269 16743363 796016 N_ambiguous 364163 1852 52883 UnstrandedReadsAssigned:16126758 PositiveStrandReadsAssigned:425975 NegativeStrandReadsAssigned:16322291 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958259 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958259-trimmed-pair1.fastq SRR6958259-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,547,680 reads, 16,372,112 reads pseudoaligned [quant] estimated average fragment length: 269.329 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR6958259.ke.tsv 35125 SRR6958259.se.tsv 88098 total ==> SRR6958259.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.047 0 0 PNS24247 1044 775.671 70.4 8.60527 PNS24249 1928 1659.67 41.5939 2.37617 PNS24246 1044 775.671 70.4 8.60527 PNS24248 1044 775.671 70.4 8.60527 PNS24244 1471 1202.67 52.206 4.1157 PNS24243 293 82.4754 0 0 KQK14069 1603 1334.67 1599.7 113.64 KQK14071 474 221.503 37.4804 16.0433 ==> SRR6958259.se.tsv <== BRADI_1g14170v3 1896 BRADI_1g53295v3 470 BRADI_1g59795v3 304 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 403 BRADI_1g74790v3 186 BRADI_1g09890v3 1 BRADI_1g77505v3 222 BRADI_1g48960v3 0 SRR6958259 completed mapping pipeline successfully